NMR Restraints Grid

Result table
 (Save to zip file containing files for each block)

image	mrblock_id	pdb_id	bmrb_id	cing	stage	program	type
	34412	1jve	5167	cing	2-parsed	STAR	comment

data_1jve_MR_file_constraints


save_Conversion_project
    _Study_list.Sf_category  study_list 
    _Study_list.Entry_ID     parsed_1jve 
    _Study_list.ID           1 

    loop_
        _Study.ID 
        _Study.Name 
        _Study.Type 
        _Study.Details 
        _Study.Entry_ID 
        _Study.Study_list_ID 

        1   "Conversion project"    NMR   .   parsed_1jve   1   
    stop_

save_


save_entry_information
    _Entry.Sf_category                  entry_information 
    _Entry.ID                           parsed_1jve 
    _Entry.Title                       "Original constraint list(s)" 
    _Entry.Version_type                 original 
    _Entry.Submission_date              . 
    _Entry.Accession_date               . 
    _Entry.Last_release_date            . 
    _Entry.Original_release_date        . 
    _Entry.Origination                  . 
    _Entry.NMR_STAR_version             3.1 
    _Entry.Original_NMR_STAR_version    . 
    _Entry.Experimental_method          NMR 
    _Entry.Experimental_method_subtype  . 

    loop_
        _Related_entries.Database_name 
        _Related_entries.Database_accession_code 
        _Related_entries.Relationship 
        _Related_entries.Entry_ID 

        PDB   1jve   "Master copy"    parsed_1jve   
    stop_

save_


save_global_Org_file_characteristics
    _Constraint_stat_list.Sf_category  constraint_statistics 
    _Constraint_stat_list.Entry_ID     parsed_1jve 
    _Constraint_stat_list.ID           1 

    loop_
        _Constraint_file.ID 
        _Constraint_file.Constraint_filename 
        _Constraint_file.Software_ID 
        _Constraint_file.Software_label 
        _Constraint_file.Software_name 
        _Constraint_file.Block_ID 
        _Constraint_file.Constraint_type 
        _Constraint_file.Constraint_subtype 
        _Constraint_file.Constraint_subsubtype 
        _Constraint_file.Constraint_number 
        _Constraint_file.Entry_ID 
        _Constraint_file.Constraint_stat_list_ID 

        1   1jve.mr   .   .   "MR format"         1    comment                  "Not applicable"    "Not applicable"    0   parsed_1jve   1   
        1   1jve.mr   .   .    n/a                2    comment                  "Not applicable"    "Not applicable"    0   parsed_1jve   1   
        1   1jve.mr   .   .    MARDIGRAS/CORMA    3    distance                  NOE                 simple             0   parsed_1jve   1   
        1   1jve.mr   .   .    MARDIGRAS/CORMA    4    distance                  NOE                 simple             0   parsed_1jve   1   
        1   1jve.mr   .   .    n/a                5    comment                  "Not applicable"    "Not applicable"    0   parsed_1jve   1   
        1   1jve.mr   .   .    MARDIGRAS/CORMA    6    peak                     "Not applicable"    "Not applicable"    0   parsed_1jve   1   
        1   1jve.mr   .   .    n/a                7    comment                  "Not applicable"    "Not applicable"    0   parsed_1jve   1   
        1   1jve.mr   .   .    MARDIGRAS/CORMA    8    peak                     "Not applicable"    "Not applicable"    0   parsed_1jve   1   
        1   1jve.mr   .   .    n/a                9    comment                  "Not applicable"    "Not applicable"    0   parsed_1jve   1   
        1   1jve.mr   .   .    MARDIGRAS/CORMA   10    peak                     "Not applicable"    "Not applicable"    0   parsed_1jve   1   
        1   1jve.mr   .   .   "MR format"        11   "nomenclature mapping"    "Not applicable"    "Not applicable"    0   parsed_1jve   1   
    stop_

save_


save_MR_file_comment_2
    _Org_constr_file_comment.Sf_category         org_constr_file_comment 
    _Org_constr_file_comment.Entry_ID            parsed_1jve 
    _Org_constr_file_comment.ID                  1 
    _Org_constr_file_comment.Constraint_file_ID  1 
    _Org_constr_file_comment.Block_ID            2 
    _Org_constr_file_comment.Details            "Generated by Wattos" 
    _Org_constr_file_comment.Comment            
;
# May 25, 2001
#
# N.B. Ulyanov, W.R. Bauer, T.L. James
#
# Experimental data for the DNA 27mer d(CCTAATTATAACGAAGTTATAATTAGG)
#
# Content of this file:
#
# (1)  Distance restraints for nonexchangeable protons
# (2)  Distance restraints for exchangeable protons
# (3)  Integrated intensities of cross-peaks in the 150-ms
#  D2O NOESY acquired with a weak presat of HDO
# (4)  Integrated intensities of cross-peaks in the 150-ms
#  D2O NOESY acquired without presat
# (5)  Integrated intensities of cross-peaks in the 75-ms
#  D2O NOESY acquired without presat
#
# Distances are in angstroms, force constants are in kcal/mol per
# angstrom squared
#
# Format is a modified MARDIGRAS format: first four columns contain
# atom names and residue numbers; columns 5 and 6 contain lower and
# upper distance bounds; columns 7 and 8 contain lower and upper
# force constants
#
# M7 stands for pseudoatom involving a methyl group (protons 1H5M, 2H5M, 3H5M)
#
# (1) Distance restraints involving nonexchangeable protons were calculated with
# the MARDIGRAS program using integrated intensities in three D2O NOESY datasets.
# The RANDMARDI procedure was run 50 times with correlation times of 8 and 9 ns
# for each of the three data sets. For each proton pair, all distance estimates
# were pooled together, and 10% of the lowest and 10% of the highest estimates
# were discarded. Min-max of the remaining estimates were accepted as the lower
# and upper bounds.
# Fixed distances and intra-sugar distances with low variation (such as H1*-H2*)
# were excluded from the list of restraints.
#
# (2) Distance restraints involving exchangeable protons were qualitatively
# categorized based on water NOESY dataset intensities.
#
# (1) restraints involving nonexchangeable protons
#
ATOM- i ATOM- j   r_low   r_up     k_low     k_up
;

save_

Contact the webmaster for help, if required. Monday, May 20, 2024 6:17:31 PM GMT (wattos1)