NMR Restraints Grid |
Result table
image | mrblock_id | pdb_id | bmrb_id | cing | stage | program | type |
34412 | 1jve | 5167 | cing | 2-parsed | STAR | comment |
data_1jve_MR_file_constraints save_Conversion_project _Study_list.Sf_category study_list _Study_list.Entry_ID parsed_1jve _Study_list.ID 1 loop_ _Study.ID _Study.Name _Study.Type _Study.Details _Study.Entry_ID _Study.Study_list_ID 1 "Conversion project" NMR . parsed_1jve 1 stop_ save_ save_entry_information _Entry.Sf_category entry_information _Entry.ID parsed_1jve _Entry.Title "Original constraint list(s)" _Entry.Version_type original _Entry.Submission_date . _Entry.Accession_date . _Entry.Last_release_date . _Entry.Original_release_date . _Entry.Origination . _Entry.NMR_STAR_version 3.1 _Entry.Original_NMR_STAR_version . _Entry.Experimental_method NMR _Entry.Experimental_method_subtype . loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID PDB 1jve "Master copy" parsed_1jve stop_ save_ save_global_Org_file_characteristics _Constraint_stat_list.Sf_category constraint_statistics _Constraint_stat_list.Entry_ID parsed_1jve _Constraint_stat_list.ID 1 loop_ _Constraint_file.ID _Constraint_file.Constraint_filename _Constraint_file.Software_ID _Constraint_file.Software_label _Constraint_file.Software_name _Constraint_file.Block_ID _Constraint_file.Constraint_type _Constraint_file.Constraint_subtype _Constraint_file.Constraint_subsubtype _Constraint_file.Constraint_number _Constraint_file.Entry_ID _Constraint_file.Constraint_stat_list_ID 1 1jve.mr . . "MR format" 1 comment "Not applicable" "Not applicable" 0 parsed_1jve 1 1 1jve.mr . . n/a 2 comment "Not applicable" "Not applicable" 0 parsed_1jve 1 1 1jve.mr . . MARDIGRAS/CORMA 3 distance NOE simple 0 parsed_1jve 1 1 1jve.mr . . MARDIGRAS/CORMA 4 distance NOE simple 0 parsed_1jve 1 1 1jve.mr . . n/a 5 comment "Not applicable" "Not applicable" 0 parsed_1jve 1 1 1jve.mr . . MARDIGRAS/CORMA 6 peak "Not applicable" "Not applicable" 0 parsed_1jve 1 1 1jve.mr . . n/a 7 comment "Not applicable" "Not applicable" 0 parsed_1jve 1 1 1jve.mr . . MARDIGRAS/CORMA 8 peak "Not applicable" "Not applicable" 0 parsed_1jve 1 1 1jve.mr . . n/a 9 comment "Not applicable" "Not applicable" 0 parsed_1jve 1 1 1jve.mr . . MARDIGRAS/CORMA 10 peak "Not applicable" "Not applicable" 0 parsed_1jve 1 1 1jve.mr . . "MR format" 11 "nomenclature mapping" "Not applicable" "Not applicable" 0 parsed_1jve 1 stop_ save_ save_MR_file_comment_2 _Org_constr_file_comment.Sf_category org_constr_file_comment _Org_constr_file_comment.Entry_ID parsed_1jve _Org_constr_file_comment.ID 1 _Org_constr_file_comment.Constraint_file_ID 1 _Org_constr_file_comment.Block_ID 2 _Org_constr_file_comment.Details "Generated by Wattos" _Org_constr_file_comment.Comment ; # May 25, 2001 # # N.B. Ulyanov, W.R. Bauer, T.L. James # # Experimental data for the DNA 27mer d(CCTAATTATAACGAAGTTATAATTAGG) # # Content of this file: # # (1) Distance restraints for nonexchangeable protons # (2) Distance restraints for exchangeable protons # (3) Integrated intensities of cross-peaks in the 150-ms # D2O NOESY acquired with a weak presat of HDO # (4) Integrated intensities of cross-peaks in the 150-ms # D2O NOESY acquired without presat # (5) Integrated intensities of cross-peaks in the 75-ms # D2O NOESY acquired without presat # # Distances are in angstroms, force constants are in kcal/mol per # angstrom squared # # Format is a modified MARDIGRAS format: first four columns contain # atom names and residue numbers; columns 5 and 6 contain lower and # upper distance bounds; columns 7 and 8 contain lower and upper # force constants # # M7 stands for pseudoatom involving a methyl group (protons 1H5M, 2H5M, 3H5M) # # (1) Distance restraints involving nonexchangeable protons were calculated with # the MARDIGRAS program using integrated intensities in three D2O NOESY datasets. # The RANDMARDI procedure was run 50 times with correlation times of 8 and 9 ns # for each of the three data sets. For each proton pair, all distance estimates # were pooled together, and 10% of the lowest and 10% of the highest estimates # were discarded. Min-max of the remaining estimates were accepted as the lower # and upper bounds. # Fixed distances and intra-sugar distances with low variation (such as H1*-H2*) # were excluded from the list of restraints. # # (2) Distance restraints involving exchangeable protons were qualitatively # categorized based on water NOESY dataset intensities. # # (1) restraints involving nonexchangeable protons # ATOM- i ATOM- j r_low r_up k_low k_up ; save_
Contact the webmaster for help, if required. Tuesday, June 4, 2024 2:22:55 PM GMT (wattos1)