![]() |
NMR Restraints Grid |
![]() |
Result table
(Save to zip file containing files for each block)
image | mrblock_id | pdb_id | bmrb_id | cing | stage | program | type | subtype |
![]() |
38293 |
1r7w ![]() ![]() |
6076 | cing | 2-parsed | STAR | entry | full |
data_1r7w_MR_file_constraints save_Conversion_project _Study_list.Sf_category study_list _Study_list.Entry_ID parsed_1r7w _Study_list.ID 1 loop_ _Study.ID _Study.Name _Study.Type _Study.Details _Study.Entry_ID _Study.Study_list_ID 1 "Conversion project" NMR . parsed_1r7w 1 stop_ save_ save_entry_information _Entry.Sf_category entry_information _Entry.ID parsed_1r7w _Entry.Title "Original constraint list(s)" _Entry.Version_type original _Entry.Submission_date . _Entry.Accession_date . _Entry.Last_release_date . _Entry.Original_release_date . _Entry.Origination . _Entry.NMR_STAR_version 3.1 _Entry.Original_NMR_STAR_version . _Entry.Experimental_method NMR _Entry.Experimental_method_subtype . loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID PDB 1r7w "Master copy" parsed_1r7w stop_ save_ save_global_Org_file_characteristics _Constraint_stat_list.Sf_category constraint_statistics _Constraint_stat_list.Entry_ID parsed_1r7w _Constraint_stat_list.ID 1 loop_ _Constraint_file.ID _Constraint_file.Constraint_filename _Constraint_file.Software_ID _Constraint_file.Software_label _Constraint_file.Software_name _Constraint_file.Block_ID _Constraint_file.Constraint_type _Constraint_file.Constraint_subtype _Constraint_file.Constraint_subsubtype _Constraint_file.Constraint_number _Constraint_file.Entry_ID _Constraint_file.Constraint_stat_list_ID 1 1r7w.mr . . "MR format" 1 comment "Not applicable" "Not applicable" 0 parsed_1r7w 1 1 1r7w.mr . . MARDIGRAS/CORMA 2 distance NOE simple 0 parsed_1r7w 1 1 1r7w.mr . . MARDIGRAS/CORMA 3 distance NOE simple 0 parsed_1r7w 1 1 1r7w.mr . . MARDIGRAS/CORMA 4 distance NOE simple 0 parsed_1r7w 1 1 1r7w.mr . . MARDIGRAS/CORMA 5 distance "hydrogen bond" simple 0 parsed_1r7w 1 1 1r7w.mr . . MARDIGRAS/CORMA 6 distance "NOE not seen" simple 0 parsed_1r7w 1 1 1r7w.mr . . MARDIGRAS/CORMA 7 peak "Not applicable" "Not applicable" 0 parsed_1r7w 1 1 1r7w.mr . . n/a 8 "dihedral angle" "Not applicable" "Not applicable" 0 parsed_1r7w 1 1 1r7w.mr . . n/a 9 "dipolar coupling" "Not applicable" "Not applicable" 0 parsed_1r7w 1 1 1r7w.mr . . n/a 10 "chemical shift" "Not applicable" "Not applicable" 0 parsed_1r7w 1 1 1r7w.mr . . n/a 11 "chemical shift" "Not applicable" "Not applicable" 0 parsed_1r7w 1 1 1r7w.mr . . "MR format" 12 "nomenclature mapping" "Not applicable" "Not applicable" 0 parsed_1r7w 1 stop_ save_ save_MR_file_comment_1 _Org_constr_file_comment.Sf_category org_constr_file_comment _Org_constr_file_comment.Entry_ID parsed_1r7w _Org_constr_file_comment.ID 1 _Org_constr_file_comment.Constraint_file_ID 1 _Org_constr_file_comment.Block_ID 1 _Org_constr_file_comment.Details "Generated by Wattos" _Org_constr_file_comment.Comment ; *HEADER RNA 22-OCT-03 1R7W *TITLE NMR STRUCTURE OF THE R(GGAGGACAUCCCUCACGGGUGACCGUGGUCCUCC), *TITLE 2 DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUCCCU BULGE *COMPND MOL_ID: 1; *COMPND 2 MOLECULE: 34-MER; *COMPND 3 CHAIN: A; *COMPND 4 FRAGMENT: DOMAIN IV, LOOP B; *COMPND 5 ENGINEERED: YES; *COMPND 6 MUTATION: YES; *COMPND 7 OTHER_DETAILS: RNA FRAGMENT OF ENTEROVIRAL IRES *SOURCE MOL_ID: 1; *SOURCE 2 SYNTHETIC: YES; *SOURCE 3 OTHER_DETAILS: RNA WAS PREPARED BY IN VITRO TRANSCRIPTION *SOURCE 4 WITH T7 RNA POLYMERASE *KEYWDS STEM-AND-LOOP STRUCTURE, SIX-NUCLEOTIDE BULGE, GUGA *KEYWDS 2 TETRALOOP *EXPDTA NMR, 20 STRUCTURES *AUTHOR Z.DU, N.B.ULYANOV, J.YU, T.L.JAMES *REVDAT 1 25-MAY-04 1R7W 0 ; save_
Contact the webmaster for help, if required. Monday, July 8, 2024 7:31:23 AM GMT (wattos1)