![]() |
NMR Restraints Grid |
![]() |
Result table
(Save to zip file containing files for each block)
image | mrblock_id | pdb_id | cing | stage | program | type | subtype |
![]() |
35845 |
1mfj ![]() ![]() |
cing | 2-parsed | STAR | entry | full |
data_1mfj_MR_file_constraints save_Conversion_project _Study_list.Sf_category study_list _Study_list.Entry_ID parsed_1mfj _Study_list.ID 1 loop_ _Study.ID _Study.Name _Study.Type _Study.Details _Study.Entry_ID _Study.Study_list_ID 1 "Conversion project" NMR . parsed_1mfj 1 stop_ save_ save_entry_information _Entry.Sf_category entry_information _Entry.ID parsed_1mfj _Entry.Title "Original constraint list(s)" _Entry.Version_type original _Entry.Submission_date . _Entry.Accession_date . _Entry.Last_release_date . _Entry.Original_release_date . _Entry.Origination . _Entry.NMR_STAR_version 3.1 _Entry.Original_NMR_STAR_version . _Entry.Experimental_method NMR _Entry.Experimental_method_subtype . loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID PDB 1mfj "Master copy" parsed_1mfj stop_ save_ save_global_Org_file_characteristics _Constraint_stat_list.Sf_category constraint_statistics _Constraint_stat_list.Entry_ID parsed_1mfj _Constraint_stat_list.ID 1 loop_ _Constraint_file.ID _Constraint_file.Constraint_filename _Constraint_file.Software_ID _Constraint_file.Software_label _Constraint_file.Software_name _Constraint_file.Block_ID _Constraint_file.Constraint_type _Constraint_file.Constraint_subtype _Constraint_file.Constraint_subsubtype _Constraint_file.Constraint_number _Constraint_file.Entry_ID _Constraint_file.Constraint_stat_list_ID 1 1mfj.mr . . "MR format" 1 comment "Not applicable" "Not applicable" 0 parsed_1mfj 1 1 1mfj.mr . . n/a 2 comment "Not applicable" "Not applicable" 0 parsed_1mfj 1 1 1mfj.mr . . MARDIGRAS/CORMA 3 distance NOE simple 0 parsed_1mfj 1 1 1mfj.mr . . n/a 4 comment "Not applicable" "Not applicable" 0 parsed_1mfj 1 1 1mfj.mr . . MARDIGRAS/CORMA 5 distance NOE simple 0 parsed_1mfj 1 1 1mfj.mr . . MARDIGRAS/CORMA 6 distance "hydrogen bond" simple 0 parsed_1mfj 1 1 1mfj.mr . . n/a 7 comment "Not applicable" "Not applicable" 0 parsed_1mfj 1 1 1mfj.mr . . MARDIGRAS/CORMA 8 peak "Not applicable" "Not applicable" 0 parsed_1mfj 1 1 1mfj.mr . . n/a 9 comment "Not applicable" "Not applicable" 0 parsed_1mfj 1 1 1mfj.mr . . MARDIGRAS/CORMA 10 peak "Not applicable" "Not applicable" 0 parsed_1mfj 1 1 1mfj.mr . . n/a 11 comment "Not applicable" "Not applicable" 0 parsed_1mfj 1 1 1mfj.mr . . n/a 12 "chemical shift" "Not applicable" "format 3" 0 parsed_1mfj 1 1 1mfj.mr . . "MR format" 13 "nomenclature mapping" "Not applicable" "Not applicable" 0 parsed_1mfj 1 stop_ save_ save_MR_file_comment_1 _Org_constr_file_comment.Sf_category org_constr_file_comment _Org_constr_file_comment.Entry_ID parsed_1mfj _Org_constr_file_comment.ID 1 _Org_constr_file_comment.Constraint_file_ID 1 _Org_constr_file_comment.Block_ID 1 _Org_constr_file_comment.Details "Generated by Wattos" _Org_constr_file_comment.Comment ; *HEADER RNA 11-AUG-02 1MFJ *TITLE 3' STEM-LOOP FROM HUMAN U4 SNRNA *COMPND MOL_ID: 1; *COMPND 2 MOLECULE: 5'- *COMPND 3 R(*GP*AP*CP*AP*GP*UP*CP*UP*CP*UP*AP*CP*GP*GP*AP*GP*AP*CP*UP *COMPND 4 *G)-3'; *COMPND 5 CHAIN: A; *COMPND 6 ENGINEERED: YES; *COMPND 7 OTHER_DETAILS: 3'STEM-LOOP OF HUMAN U4 SNRNA *SOURCE MOL_ID: 1; *SOURCE 2 SYNTHETIC: YES; *SOURCE 3 OTHER_DETAILS: THIS SEQUENCE IS PART OF HUMAN U4 SNRNA. *KEYWDS RIBONUCLEIC ACID, RNA OLIGONUCLEOTIDE, STEM-AND-LOOP, U4 *KEYWDS 2 SMALL NUCLEAR RNA, UACG TETRALOOP *EXPDTA NMR, 10 STRUCTURES *AUTHOR L.R.COMOLLI, N.B.ULYANOV, T.L.JAMES, W.H.GMEINER *REVDAT 1 06-NOV-02 1MFJ 0 ; save_ save_MR_file_comment_2 _Org_constr_file_comment.Sf_category org_constr_file_comment _Org_constr_file_comment.Entry_ID parsed_1mfj _Org_constr_file_comment.ID 2 _Org_constr_file_comment.Constraint_file_ID 1 _Org_constr_file_comment.Block_ID 2 _Org_constr_file_comment.Details "Generated by Wattos" _Org_constr_file_comment.Comment ; # August 10, 2002 # # L.R. Comolli, N.B. Ulyanov, T.L. James, W.H. Gmeiner # # Experimental NMR data for the RNA 20mer r(GACAGUCUCUACGGAGACUG) # # Content of this file: # # (1) Distance restraints for nonexchangeable protons # (2) Distance restraints for exchangeable protons # (3) Integrated intensities of cross-peaks in the 80-ms # 600 MHz D2O NOESY acquired at 30 oC # (4) Integrated intensities of cross-peaks in the 400-ms # 600 MHz D2O NOESY acquired at 30 oC # (5) Table of proton chemical shifts # # Format is a modified MARDIGRAS format: first four columns contain # atom names and residue numbers; columns 5 and 6 contain lower and # upper distance bounds; columns 7 and 8 contain lower and upper # force constants # # # (1) restraints involving nonexchangeable protons # # Distance restraints involving nonexchangeable protons were calculated with the # MARDIGRAS program using integrated intensities in two D2O NOESY datasets. The # RANDMARDI procedure was run 50 times assuming isotropic effective correlation # times of 2 ns for each of the three data sets. For each proton pair, all distance # estimates were pooled together, and 10% of the lowest and 10% of the highest estimates # were discarded. Min-max of the remaining estimates were accepted as the lower # and upper bounds. # Fixed distances and intra-sugar distances with low variation (such as H1*-H2*) # were excluded from the list of restraints. # #Restraints obtained from mardigras inp= 2.mardi * filter= filter *** Tue Mar 26 16:53:24 2002 ATOM- i ATOM- j r_low r_up k_low k_up ; save_ save_MR_file_comment_4 _Org_constr_file_comment.Sf_category org_constr_file_comment _Org_constr_file_comment.Entry_ID parsed_1mfj _Org_constr_file_comment.ID 3 _Org_constr_file_comment.Constraint_file_ID 1 _Org_constr_file_comment.Block_ID 4 _Org_constr_file_comment.Details "Generated by Wattos" _Org_constr_file_comment.Comment ; # # (2) restraints involving exchangeable protons # # For these distances, only upper bounds (6 A) were used for the peaks # observed in the water NOESY data set at 20 oC. # ; save_ save_MR_file_comment_7 _Org_constr_file_comment.Sf_category org_constr_file_comment _Org_constr_file_comment.Entry_ID parsed_1mfj _Org_constr_file_comment.ID 4 _Org_constr_file_comment.Constraint_file_ID 1 _Org_constr_file_comment.Block_ID 7 _Org_constr_file_comment.Details "Generated by Wattos" _Org_constr_file_comment.Comment ; # # (3) Integrated intensities of cross-peaks in the 80-ms # D2O NOESY dataset. # # NOE cross-peaks were integrated with SPARKY. Relative integration # error was determined by comparing the below- and above-the-diagonal # intensities, but in no case it was set below 10%. The intensities # are not normalized. # HEADER prepared from tnn_80ms_mar26_02.mardilist by mardi.in Tue Mar 26 15:36:35 2002 MIXING TIME: 0.08 ATOM1 ATOM2 INTENSITY ERROR Note ; save_ save_MR_file_comment_9 _Org_constr_file_comment.Sf_category org_constr_file_comment _Org_constr_file_comment.Entry_ID parsed_1mfj _Org_constr_file_comment.ID 5 _Org_constr_file_comment.Constraint_file_ID 1 _Org_constr_file_comment.Block_ID 9 _Org_constr_file_comment.Details "Generated by Wattos" _Org_constr_file_comment.Comment ; # # (4) Integrated intensities of cross-peaks in the 400-ms # D2O NOESY dataset. # HEADER prepared from tnn_006_mar26_02.mardilist by mardi.in Tue Mar 26 15:36:51 2002 MIXING TIME: 0.4 ATOM1 ATOM2 INTENSITY ERROR Note ; save_ save_MR_file_comment_11 _Org_constr_file_comment.Sf_category org_constr_file_comment _Org_constr_file_comment.Entry_ID parsed_1mfj _Org_constr_file_comment.ID 6 _Org_constr_file_comment.Constraint_file_ID 1 _Org_constr_file_comment.Block_ID 11 _Org_constr_file_comment.Details "Generated by Wattos" _Org_constr_file_comment.Comment ; # # (5) Proton chemical shifts. Nonexchangeable protons are # at 30 oC; exchangeable protons are at 20 oC. # # "nd" stands for "not determined" # ; save_
Contact the webmaster for help, if required. Wednesday, July 3, 2024 3:41:33 AM GMT (wattos1)