BMRB

NMR Restraints Grid

Result table
 (Save to zip file containing files for each block)

image mrblock_id pdb_id bmrb_id cing stage position type
7012 1jve RC 5167 cing 1-original 1 comment


# May 25, 2001
#
# N.B. Ulyanov, W.R. Bauer, T.L. James
#
# Experimental data for the DNA 27mer d(CCTAATTATAACGAAGTTATAATTAGG)
#
# Content of this file:
#
# (1)  Distance restraints for nonexchangeable protons
# (2)  Distance restraints for exchangeable protons
# (3)  Integrated intensities of cross-peaks in the 150-ms
#  D2O NOESY acquired with a weak presat of HDO
# (4)  Integrated intensities of cross-peaks in the 150-ms
#  D2O NOESY acquired without presat
# (5)  Integrated intensities of cross-peaks in the 75-ms
#  D2O NOESY acquired without presat
#
# Distances are in angstroms, force constants are in kcal/mol per
# angstrom squared
#
# Format is a modified MARDIGRAS format: first four columns contain
# atom names and residue numbers; columns 5 and 6 contain lower and
# upper distance bounds; columns 7 and 8 contain lower and upper
# force constants
#
# M7 stands for pseudoatom involving a methyl group (protons 1H5M, 2H5M, 3H5M)
#
# (1) Distance restraints involving nonexchangeable protons were calculated with
# the MARDIGRAS program using integrated intensities in three D2O NOESY datasets.
# The RANDMARDI procedure was run 50 times with correlation times of 8 and 9 ns
# for each of the three data sets. For each proton pair, all distance estimates
# were pooled together, and 10% of the lowest and 10% of the highest estimates
# were discarded. Min-max of the remaining estimates were accepted as the lower
# and upper bounds.
# Fixed distances and intra-sugar distances with low variation (such as H1*-H2*)
# were excluded from the list of restraints.
#
# (2) Distance restraints involving exchangeable protons were qualitatively
# categorized based on water NOESY dataset intensities.
#
# (1) restraints involving nonexchangeable protons
#
ATOM- i ATOM- j   r_low   r_up     k_low     k_up