Result table
| image | mrblock_id | pdb_id | bmrb_id | cing | stage | position | type |
|
|
7012 | 1jve RC | 5167 | cing | 1-original | 1 | comment |
# May 25, 2001 # # N.B. Ulyanov, W.R. Bauer, T.L. James # # Experimental data for the DNA 27mer d(CCTAATTATAACGAAGTTATAATTAGG) # # Content of this file: # # (1) Distance restraints for nonexchangeable protons # (2) Distance restraints for exchangeable protons # (3) Integrated intensities of cross-peaks in the 150-ms # D2O NOESY acquired with a weak presat of HDO # (4) Integrated intensities of cross-peaks in the 150-ms # D2O NOESY acquired without presat # (5) Integrated intensities of cross-peaks in the 75-ms # D2O NOESY acquired without presat # # Distances are in angstroms, force constants are in kcal/mol per # angstrom squared # # Format is a modified MARDIGRAS format: first four columns contain # atom names and residue numbers; columns 5 and 6 contain lower and # upper distance bounds; columns 7 and 8 contain lower and upper # force constants # # M7 stands for pseudoatom involving a methyl group (protons 1H5M, 2H5M, 3H5M) # # (1) Distance restraints involving nonexchangeable protons were calculated with # the MARDIGRAS program using integrated intensities in three D2O NOESY datasets. # The RANDMARDI procedure was run 50 times with correlation times of 8 and 9 ns # for each of the three data sets. For each proton pair, all distance estimates # were pooled together, and 10% of the lowest and 10% of the highest estimates # were discarded. Min-max of the remaining estimates were accepted as the lower # and upper bounds. # Fixed distances and intra-sugar distances with low variation (such as H1*-H2*) # were excluded from the list of restraints. # # (2) Distance restraints involving exchangeable protons were qualitatively # categorized based on water NOESY dataset intensities. # # (1) restraints involving nonexchangeable protons # ATOM- i ATOM- j r_low r_up k_low k_up