NMR Restraints Grid

Result table
 (Save to zip file containing files for each block)

image mrblock_id pdb_id bmrb_id cing stage program type subtype item_count
496889 2l5z 17292 cing 3-converted-DOCR STAR entry full 1137


data_DOCR_restraints_with_modified_coordinates_PDB_code_2l5z

# This DOCR archive file contains, for PDB entry <2l5z>:
# 
# - Coordinates and sequence information from the PDB mmCIF file
# - NMR restraints from the PDB MR file
# 
# In this file, the coordinates and NMR restraints share the same atom names,
# and in this way can differ from the data deposited at the wwPDB. To achieve
# this aim, the NMR restraints were parsed from their original format files, and
# the coordinates and NMR restraints information were subsequently harmonized.
# 
# Due to the complexity of this harmonization process, minor modifications could
# have occurred to the NMR restraints information, or data could have been lost
# because of parsing or conversion errors. The PDB file remains the
# authoritative reference for the atomic coordinates and the originally deposited
# restraints files remain the primary reference for these data.
# 
# This file is generated at the BioMagResBank (BMRB) in collaboration with the 
# PDBe (formerly MSD) group at the European Bioinformatics Institute (EBI) and 
# the CMBI/IMM group at the Radboud University of Nijmegen.
# 
# Several software packages were used to produce this file:
# 
# - Wattos (BMRB and CMBI/IMM).
# - FormatConverter and NMRStarExport (PDBe).
# - CCPN framework (http://www.ccpn.ac.uk/).
# 
# More information about this process can be found in the references below.
# Please cite the original reference for this PDB entry.
# 
# JF Doreleijers, A Nederveen, W Vranken, J Lin, AM Bonvin, R Kaptein, JL
# Markley, and EL Ulrich (2005). BioMagResBank databases DOCR and FRED
# containing converted and filtered sets of experimental NMR restraints and
# coordinates from over 500 protein PDB structures. J. Biomol. NMR 32, 1-12.
# 
# WF Vranken, W Boucher, TJ Stevens, RH Fogh, A Pajon, M Llinas, EL Ulrich, JL
# Markley, J Ionides, ED Laue (2005). The CCPN data model for NMR spectroscopy:
# development of a software pipeline. Proteins 59, 687-696. 
# 
# JF Doreleijers, WF Vranken, C Schulte, J Lin, JR Wedell, CJ Penkett, GW Vuister, 
# G Vriend, JL Markley, and EL Ulrich (2009). The NMR Restraints Grid at BMRB for 
# 5,266 Protein and Nucleic Acid PDB Entries. J Biomol. NMR 45, 389?396.




save_entry_information
    _Entry.Sf_category                  entry_information
    _Entry.Sf_framecode                 entry_information
    _Entry.ID                           rr_2l5z
    _Entry.Title                        "wwPDB remediated NMR restraints for PDB entry 2l5z"
    _Entry.Version_type                 original
    _Entry.NMR_STAR_version             3.1.0.8
    _Entry.Experimental_method          NMR
    _Entry.Experimental_method_subtype  solution
    _Entry.Details                      "Contains the remediated restraint lists and coordinates for PDB entry 2l5z"
    _Entry.PDB_coordinate_file_version  3.20

    loop_
       _Related_entries.Database_name
       _Related_entries.Database_accession_code
       _Related_entries.Relationship
       _Related_entries.Entry_ID

       PDB 2l5z "Master copy" rr_2l5z 
    stop_

save_


save_assembly
    _Assembly.Sf_category           assembly
    _Assembly.Sf_framecode          assembly
    _Assembly.Entry_ID              rr_2l5z
    _Assembly.ID                    1
    _Assembly.Name                  2l5z
    _Assembly.Number_of_components  1
    _Assembly.Organic_ligands       0
    _Assembly.Metal_ions            0
    _Assembly.Non_standard_bonds    no
    _Assembly.Paramagnetic          no
    _Assembly.Thiol_state           "not present"
    _Assembly.Molecular_mass        8485.14206

    loop_
       _Entity_assembly.ID
       _Entity_assembly.Entity_assembly_name
       _Entity_assembly.Entity_ID
       _Entity_assembly.Entity_label
       _Entity_assembly.Asym_ID
       _Entity_assembly.PDB_chain_ID
       _Entity_assembly.Experimental_data_reported
       _Entity_assembly.Physical_state
       _Entity_assembly.Conformational_isomer
       _Entity_assembly.Chemical_exchange_state
       _Entity_assembly.Magnetic_equivalence_group_code
       _Entity_assembly.Role
       _Entity_assembly.Details
       _Entity_assembly.Entry_ID
       _Entity_assembly.Assembly_ID

       1 "RNA 26 MER" 1 $RNA__26_MER_ A . no . . . . . . rr_2l5z 1 
    stop_

save_


save_RNA__26_MER_
    _Entity.Sf_category                      entity
    _Entity.Sf_framecode                     RNA__26_MER_
    _Entity.Entry_ID                         rr_2l5z
    _Entity.ID                               1
    _Entity.Name                             RNA__26_MER_
    _Entity.Type                             polymer
    _Entity.Polymer_type                     polyribonucleotide
    _Entity.Polymer_strand_ID                A
    _Entity.Polymer_seq_one_letter_code      
;GAGCUGCAGCACGAAAGUGA
CGGCUC
;

    _Entity.Ambiguous_conformational_states  no
    _Entity.Ambiguous_chem_comp_sites        no
    _Entity.Nstd_monomer                     no
    _Entity.Nstd_chirality                   yes
    _Entity.Nstd_linkage                     no
    _Entity.Number_of_monomers               26
    _Entity.Paramagnetic                     no
    _Entity.Thiol_state                      "not present"
    _Entity.Parent_entity_ID                 1
    _Entity.Formula_weight                   8485.14206

    loop_
       _Entity_comp_index.ID
       _Entity_comp_index.Auth_seq_ID
       _Entity_comp_index.Comp_ID
       _Entity_comp_index.Comp_label
       _Entity_comp_index.Entry_ID
       _Entity_comp_index.Entity_ID

        1 . G . rr_2l5z 1 
        2 . A . rr_2l5z 1 
        3 . G . rr_2l5z 1 
        4 . C . rr_2l5z 1 
        5 . U . rr_2l5z 1 
        6 . G . rr_2l5z 1 
        7 . C . rr_2l5z 1 
        8 . A . rr_2l5z 1 
        9 . G . rr_2l5z 1 
       10 . C . rr_2l5z 1 
       11 . A . rr_2l5z 1 
       12 . C . rr_2l5z 1 
       13 . G . rr_2l5z 1 
       14 . A . rr_2l5z 1 
       15 . A . rr_2l5z 1 
       16 . A . rr_2l5z 1 
       17 . G . rr_2l5z 1 
       18 . U . rr_2l5z 1 
       19 . G . rr_2l5z 1 
       20 . A . rr_2l5z 1 
       21 . C . rr_2l5z 1 
       22 . G . rr_2l5z 1 
       23 . G . rr_2l5z 1 
       24 . C . rr_2l5z 1 
       25 . U . rr_2l5z 1 
       26 . C . rr_2l5z 1 
    stop_

    loop_
       _Entity_poly_seq.Hetero
       _Entity_poly_seq.Mon_ID
       _Entity_poly_seq.Num
       _Entity_poly_seq.Comp_index_ID
       _Entity_poly_seq.Entry_ID
       _Entity_poly_seq.Entity_ID

       . G  1  1 rr_2l5z 1 
       . A  2  2 rr_2l5z 1 
       . G  3  3 rr_2l5z 1 
       . C  4  4 rr_2l5z 1 
       . U  5  5 rr_2l5z 1 
       . G  6  6 rr_2l5z 1 
       . C  7  7 rr_2l5z 1 
       . A  8  8 rr_2l5z 1 
       . G  9  9 rr_2l5z 1 
       . C 10 10 rr_2l5z 1 
       . A 11 11 rr_2l5z 1 
       . C 12 12 rr_2l5z 1 
       . G 13 13 rr_2l5z 1 
       . A 14 14 rr_2l5z 1 
       . A 15 15 rr_2l5z 1 
       . A 16 16 rr_2l5z 1 
       . G 17 17 rr_2l5z 1 
       . U 18 18 rr_2l5z 1 
       . G 19 19 rr_2l5z 1 
       . A 20 20 rr_2l5z 1 
       . C 21 21 rr_2l5z 1 
       . G 22 22 rr_2l5z 1 
       . G 23 23 rr_2l5z 1 
       . C 24 24 rr_2l5z 1 
       . U 25 25 rr_2l5z 1 
       . C 26 26 rr_2l5z 1 
    stop_

save_


save_conformer_statistics
    _Conformer_stat_list.Sf_category                    conformer_statistics
    _Conformer_stat_list.Sf_framecode                   conformer_statistics
    _Conformer_stat_list.Entry_ID                       rr_2l5z
    _Conformer_stat_list.ID                             1
    _Conformer_stat_list.Conf_family_coord_set_ID       1
    _Conformer_stat_list.Conf_family_coord_set_label    $Original_constraints_and_structures
    _Conformer_stat_list.Conformer_submitted_total_num  21

save_


save_ensemble_of_conformers
    _Conformer_family_coord_set.Sf_category   conformer_family_coord_set
    _Conformer_family_coord_set.Sf_framecode  ensemble_of_conformers
    _Conformer_family_coord_set.Entry_ID      rr_2l5z
    _Conformer_family_coord_set.ID            1

    loop_
       _Conformer_family_refinement.Refine_method
       _Conformer_family_refinement.Refine_details
       _Conformer_family_refinement.Software_ID
       _Conformer_family_refinement.Software_label
       _Conformer_family_refinement.Entry_ID
       _Conformer_family_refinement.Conformer_family_coord_set_ID

       1 . . . rr_2l5z 1 
    stop_

    loop_
       _Conformer_family_software.Software_ID
       _Conformer_family_software.Software_label
       _Conformer_family_software.Method_ID
       _Conformer_family_software.Method_label
       _Conformer_family_software.Entry_ID
       _Conformer_family_software.Conformer_family_coord_set_ID

       . . . . rr_2l5z 1 
    stop_

    loop_
       _Atom_site.Assembly_ID
       _Atom_site.Model_ID
       _Atom_site.Model_site_ID
       _Atom_site.ID
       _Atom_site.Assembly_atom_ID
       _Atom_site.Label_entity_assembly_ID
       _Atom_site.Label_entity_ID
       _Atom_site.Label_comp_index_ID
       _Atom_site.Label_comp_ID
       _Atom_site.Label_atom_ID
       _Atom_site.Type_symbol
       _Atom_site.Cartn_x
       _Atom_site.Cartn_y
       _Atom_site.Cartn_z
       _Atom_site.Cartn_x_esd
       _Atom_site.Cartn_y_esd
       _Atom_site.Cartn_z_esd
       _Atom_site.Occupancy
       _Atom_site.Occupancy_esd
       _Atom_site.Uncertainty
       _Atom_site.Ordered_flag
       _Atom_site.Footnote_ID
       _Atom_site.PDBX_label_asym_ID
       _Atom_site.PDBX_label_seq_ID
       _Atom_site.PDBX_label_comp_ID
       _Atom_site.PDBX_label_atom_ID
       _Atom_site.PDBX_formal_charge
       _Atom_site.PDBX_label_entity_ID
       _Atom_site.PDB_record_ID
       _Atom_site.PDB_model_num
       _Atom_site.PDB_strand_ID
       _Atom_site.PDB_ins_code
       _Atom_site.PDB_residue_no
       _Atom_site.PDB_residue_name
       _Atom_site.PDB_atom_name
       _Atom_site.Auth_entity_assembly_ID
       _Atom_site.Auth_asym_ID
       _Atom_site.Auth_chain_ID
       _Atom_site.Auth_seq_ID
       _Atom_site.Auth_comp_ID
       _Atom_site.Auth_atom_ID
       _Atom_site.Auth_alt_ID
       _Atom_site.Auth_atom_name
       _Atom_site.Details
       _Atom_site.Entry_ID
       _Atom_site.Conformer_family_coord_set_ID

       .  1 .     1 . 1 1  1 G C1'  C -24.542  20.353 22.666 . . . 1.0 . . . . . . . . . . . . A .  1 G C1'  . . . . . . . . . rr_2l5z 1 
       .  1 .     2 . 1 1  1 G C2   C -20.225  21.326 22.515 . . . 1.0 . . . . . . . . . . . . A .  1 G C2   . . . . . . . . . rr_2l5z 1 
       .  1 .     3 . 1 1  1 G C2'  C -24.666  18.860 22.376 . . . 1.0 . . . . . . . . . . . . A .  1 G C2'  . . . . . . . . . rr_2l5z 1 
       .  1 .     4 . 1 1  1 G C3'  C -25.812  18.445 23.279 . . . 1.0 . . . . . . . . . . . . A .  1 G C3'  . . . . . . . . . rr_2l5z 1 
       .  1 .     5 . 1 1  1 G C4   C -22.172  20.903 23.517 . . . 1.0 . . . . . . . . . . . . A .  1 G C4   . . . . . . . . . rr_2l5z 1 
       .  1 .     6 . 1 1  1 G C4'  C -26.712  19.678 23.266 . . . 1.0 . . . . . . . . . . . . A .  1 G C4'  . . . . . . . . . rr_2l5z 1 
       .  1 .     7 . 1 1  1 G C5   C -21.660  21.037 24.800 . . . 1.0 . . . . . . . . . . . . A .  1 G C5   . . . . . . . . . rr_2l5z 1 
       .  1 .     8 . 1 1  1 G C5'  C -27.555  19.788 24.539 . . . 1.0 . . . . . . . . . . . . A .  1 G C5'  . . . . . . . . . rr_2l5z 1 
       .  1 .     9 . 1 1  1 G C6   C -20.285  21.349 24.975 . . . 1.0 . . . . . . . . . . . . A .  1 G C6   . . . . . . . . . rr_2l5z 1 
       .  1 .    10 . 1 1  1 G C8   C -23.694  20.583 25.011 . . . 1.0 . . . . . . . . . . . . A .  1 G C8   . . . . . . . . . rr_2l5z 1 
       .  1 .    11 . 1 1  1 G H1   H -18.619  21.706 23.801 . . . 1.0 . . . . . . . . . . . . A .  1 G H1   . . . . . . . . . rr_2l5z 1 
       .  1 .    12 . 1 1  1 G H1'  H -24.287  20.880 21.747 . . . 1.0 . . . . . . . . . . . . A .  1 G H1'  . . . . . . . . . rr_2l5z 1 
       .  1 .    13 . 1 1  1 G H2'  H -23.749  18.344 22.673 . . . 1.0 . . . . . . . . . . . . A .  1 G H2'  . . . . . . . . . rr_2l5z 1 
       .  1 .    14 . 1 1  1 G H21  H -18.454  21.713 21.590 . . . 1.0 . . . . . . . . . . . . A .  1 G H21  . . . . . . . . . rr_2l5z 1 
       .  1 .    15 . 1 1  1 G H22  H -19.805  21.396 20.525 . . . 1.0 . . . . . . . . . . . . A .  1 G H22  . . . . . . . . . rr_2l5z 1 
       .  1 .    16 . 1 1  1 G H3'  H -25.461  18.186 24.282 . . . 1.0 . . . . . . . . . . . . A .  1 G H3'  . . . . . . . . . rr_2l5z 1 
       .  1 .    17 . 1 1  1 G H4'  H -27.370  19.637 22.400 . . . 1.0 . . . . . . . . . . . . A .  1 G H4'  . . . . . . . . . rr_2l5z 1 
       .  1 .    18 . 1 1  1 G H5'  H -28.005  20.780 24.583 . . . 1.0 . . . . . . . . . . . . A .  1 G H5'  . . . . . . . . . rr_2l5z 1 
       .  1 .    19 . 1 1  1 G H5'' H -28.346  19.039 24.507 . . . 1.0 . . . . . . . . . . . . A .  1 G H5'' . . . . . . . . . rr_2l5z 1 
       .  1 .    20 . 1 1  1 G H8   H -24.664  20.372 25.437 . . . 1.0 . . . . . . . . . . . . A .  1 G H8   . . . . . . . . . rr_2l5z 1 
       .  1 .    21 . 1 1  1 G HO2' H -25.910  18.762 20.882 . . . 1.0 . . . . . . . . . . . . A .  1 G HO2' . . . . . . . . . rr_2l5z 1 
       .  1 .    22 . 1 1  1 G HO5' H -27.182  18.882 26.219 . . . 1.0 . . . . . . . . . . . . A .  1 G HO5' . . . . . . . . . rr_2l5z 1 
       .  1 .    23 . 1 1  1 G N1   N -19.633  21.477 23.754 . . . 1.0 . . . . . . . . . . . . A .  1 G N1   . . . . . . . . . rr_2l5z 1 
       .  1 .    24 . 1 1  1 G N2   N -19.430  21.492 21.458 . . . 1.0 . . . . . . . . . . . . A .  1 G N2   . . . . . . . . . rr_2l5z 1 
       .  1 .    25 . 1 1  1 G N3   N -21.518  21.033 22.341 . . . 1.0 . . . . . . . . . . . . A .  1 G N3   . . . . . . . . . rr_2l5z 1 
       .  1 .    26 . 1 1  1 G N7   N -22.667  20.825 25.758 . . . 1.0 . . . . . . . . . . . . A .  1 G N7   . . . . . . . . . rr_2l5z 1 
       .  1 .    27 . 1 1  1 G N9   N -23.501  20.607 23.680 . . . 1.0 . . . . . . . . . . . . A .  1 G N9   . . . . . . . . . rr_2l5z 1 
       .  1 .    28 . 1 1  1 G O2'  O -24.968  18.616 20.998 . . . 1.0 . . . . . . . . . . . . A .  1 G O2'  . . . . . . . . . rr_2l5z 1 
       .  1 .    29 . 1 1  1 G O3'  O -26.513  17.365 22.654 . . . 1.0 . . . . . . . . . . . . A .  1 G O3'  . . . . . . . . . rr_2l5z 1 
       .  1 .    30 . 1 1  1 G O4'  O -25.829  20.796 23.130 . . . 1.0 . . . . . . . . . . . . A .  1 G O4'  . . . . . . . . . rr_2l5z 1 
       .  1 .    31 . 1 1  1 G O5'  O -26.765  19.583 25.713 . . . 1.0 . . . . . . . . . . . . A .  1 G O5'  . . . . . . . . . rr_2l5z 1 
       .  1 .    32 . 1 1  1 G O6   O -19.665  21.503 26.026 . . . 1.0 . . . . . . . . . . . . A .  1 G O6   . . . . . . . . . rr_2l5z 1 
       .  1 .    33 . 1 1  2 A C1'  C -21.286  14.713 21.836 . . . 1.0 . . . . . . . . . . . . A .  2 A C1'  . . . . . . . . . rr_2l5z 1 
       .  1 .    34 . 1 1  2 A C2   C -17.499  15.914 23.778 . . . 1.0 . . . . . . . . . . . . A .  2 A C2   . . . . . . . . . rr_2l5z 1 
       .  1 .    35 . 1 1  2 A C2'  C -21.575  13.315 22.377 . . . 1.0 . . . . . . . . . . . . A .  2 A C2'  . . . . . . . . . rr_2l5z 1 
       .  1 .    36 . 1 1  2 A C3'  C -23.089  13.301 22.463 . . . 1.0 . . . . . . . . . . . . A .  2 A C3'  . . . . . . . . . rr_2l5z 1 
       .  1 .    37 . 1 1  2 A C4   C -19.683  15.919 23.453 . . . 1.0 . . . . . . . . . . . . A .  2 A C4   . . . . . . . . . rr_2l5z 1 
       .  1 .    38 . 1 1  2 A C4'  C -23.496  14.161 21.273 . . . 1.0 . . . . . . . . . . . . A .  2 A C4'  . . . . . . . . . rr_2l5z 1 
       .  1 .    39 . 1 1  2 A C5   C -19.910  16.823 24.467 . . . 1.0 . . . . . . . . . . . . A .  2 A C5   . . . . . . . . . rr_2l5z 1 
       .  1 .    40 . 1 1  2 A C5'  C -24.878  14.786 21.466 . . . 1.0 . . . . . . . . . . . . A .  2 A C5'  . . . . . . . . . rr_2l5z 1 
       .  1 .    41 . 1 1  2 A C6   C -18.784  17.275 25.161 . . . 1.0 . . . . . . . . . . . . A .  2 A C6   . . . . . . . . . rr_2l5z 1 
       .  1 .    42 . 1 1  2 A C8   C -21.782  16.363 23.654 . . . 1.0 . . . . . . . . . . . . A .  2 A C8   . . . . . . . . . rr_2l5z 1 
       .  1 .    43 . 1 1  2 A H1'  H -20.467  14.661 21.118 . . . 1.0 . . . . . . . . . . . . A .  2 A H1'  . . . . . . . . . rr_2l5z 1 
       .  1 .    44 . 1 1  2 A H2   H -16.498  15.563 23.526 . . . 1.0 . . . . . . . . . . . . A .  2 A H2   . . . . . . . . . rr_2l5z 1 
       .  1 .    45 . 1 1  2 A H2'  H -21.142  13.204 23.374 . . . 1.0 . . . . . . . . . . . . A .  2 A H2'  . . . . . . . . . rr_2l5z 1 
       .  1 .    46 . 1 1  2 A H3'  H -23.443  13.706 23.414 . . . 1.0 . . . . . . . . . . . . A .  2 A H3'  . . . . . . . . . rr_2l5z 1 
       .  1 .    47 . 1 1  2 A H4'  H -23.495  13.554 20.369 . . . 1.0 . . . . . . . . . . . . A .  2 A H4'  . . . . . . . . . rr_2l5z 1 
       .  1 .    48 . 1 1  2 A H5'  H -25.020  15.572 20.724 . . . 1.0 . . . . . . . . . . . . A .  2 A H5'  . . . . . . . . . rr_2l5z 1 
       .  1 .    49 . 1 1  2 A H5'' H -25.639  14.020 21.322 . . . 1.0 . . . . . . . . . . . . A .  2 A H5'' . . . . . . . . . rr_2l5z 1 
       .  1 .    50 . 1 1  2 A H61  H -18.005  18.443 26.635 . . . 1.0 . . . . . . . . . . . . A .  2 A H61  . . . . . . . . . rr_2l5z 1 
       .  1 .    51 . 1 1  2 A H62  H -19.744  18.514 26.459 . . . 1.0 . . . . . . . . . . . . A .  2 A H62  . . . . . . . . . rr_2l5z 1 
       .  1 .    52 . 1 1  2 A H8   H -22.844  16.329 23.468 . . . 1.0 . . . . . . . . . . . . A .  2 A H8   . . . . . . . . . rr_2l5z 1 
       .  1 .    53 . 1 1  2 A HO2' H -20.843  12.730 20.671 . . . 1.0 . . . . . . . . . . . . A .  2 A HO2' . . . . . . . . . rr_2l5z 1 
       .  1 .    54 . 1 1  2 A N1   N -17.586  16.792 24.781 . . . 1.0 . . . . . . . . . . . . A .  2 A N1   . . . . . . . . . rr_2l5z 1 
       .  1 .    55 . 1 1  2 A N3   N -18.498  15.420 23.053 . . . 1.0 . . . . . . . . . . . . A .  2 A N3   . . . . . . . . . rr_2l5z 1 
       .  1 .    56 . 1 1  2 A N6   N -18.849  18.148 26.166 . . . 1.0 . . . . . . . . . . . . A .  2 A N6   . . . . . . . . . rr_2l5z 1 
       .  1 .    57 . 1 1  2 A N7   N -21.281  17.104 24.588 . . . 1.0 . . . . . . . . . . . . A .  2 A N7   . . . . . . . . . rr_2l5z 1 
       .  1 .    58 . 1 1  2 A N9   N -20.917  15.628 22.932 . . . 1.0 . . . . . . . . . . . . A .  2 A N9   . . . . . . . . . rr_2l5z 1 
       .  1 .    59 . 1 1  2 A O2'  O -21.089  12.299 21.493 . . . 1.0 . . . . . . . . . . . . A .  2 A O2'  . . . . . . . . . rr_2l5z 1 
       .  1 .    60 . 1 1  2 A O3'  O -23.543  11.963 22.240 . . . 1.0 . . . . . . . . . . . . A .  2 A O3'  . . . . . . . . . rr_2l5z 1 
       .  1 .    61 . 1 1  2 A O4'  O -22.479  15.160 21.168 . . . 1.0 . . . . . . . . . . . . A .  2 A O4'  . . . . . . . . . rr_2l5z 1 
       .  1 .    62 . 1 1  2 A O5'  O -25.022  15.346 22.774 . . . 1.0 . . . . . . . . . . . . A .  2 A O5'  . . . . . . . . . rr_2l5z 1 
       .  1 .    63 . 1 1  2 A OP1  O -27.508  15.067 22.638 . . . 1.0 . . . . . . . . . . . . A .  2 A OP1  . . . . . . . . . rr_2l5z 1 
       .  1 .    64 . 1 1  2 A OP2  O -26.408  16.004 24.754 . . . 1.0 . . . . . . . . . . . . A .  2 A OP2  . . . . . . . . . rr_2l5z 1 
       .  1 .    65 . 1 1  2 A P    P -26.453  15.883 23.280 . . . 1.0 . . . . . . . . . . . . A .  2 A P    . . . . . . . . . rr_2l5z 1 
       .  1 .    66 . 1 1  3 G C1'  C -18.231  11.029 23.905 . . . 1.0 . . . . . . . . . . . . A .  3 G C1'  . . . . . . . . . rr_2l5z 1 
       .  1 .    67 . 1 1  3 G C2   C -15.882  13.137 27.004 . . . 1.0 . . . . . . . . . . . . A .  3 G C2   . . . . . . . . . rr_2l5z 1 
       .  1 .    68 . 1 1  3 G C2'  C -18.047   9.550 24.235 . . . 1.0 . . . . . . . . . . . . A .  3 G C2'  . . . . . . . . . rr_2l5z 1 
       .  1 .    69 . 1 1  3 G C3'  C -19.411   8.978 23.900 . . . 1.0 . . . . . . . . . . . . A .  3 G C3'  . . . . . . . . . rr_2l5z 1 
       .  1 .    70 . 1 1  3 G C4   C -17.749  12.415 26.022 . . . 1.0 . . . . . . . . . . . . A .  3 G C4   . . . . . . . . . rr_2l5z 1 
       .  1 .    71 . 1 1  3 G C4'  C -19.810   9.799 22.683 . . . 1.0 . . . . . . . . . . . . A .  3 G C4'  . . . . . . . . . rr_2l5z 1 
       .  1 .    72 . 1 1  3 G C5   C -18.591  12.976 26.971 . . . 1.0 . . . . . . . . . . . . A .  3 G C5   . . . . . . . . . rr_2l5z 1 
       .  1 .    73 . 1 1  3 G C5'  C -21.326   9.826 22.487 . . . 1.0 . . . . . . . . . . . . A .  3 G C5'  . . . . . . . . . rr_2l5z 1 
       .  1 .    74 . 1 1  3 G C6   C -18.034  13.700 28.059 . . . 1.0 . . . . . . . . . . . . A .  3 G C6   . . . . . . . . . rr_2l5z 1 
       .  1 .    75 . 1 1  3 G C8   C -19.820  12.017 25.572 . . . 1.0 . . . . . . . . . . . . A .  3 G C8   . . . . . . . . . rr_2l5z 1 
       .  1 .    76 . 1 1  3 G H1   H -16.165  14.243 28.756 . . . 1.0 . . . . . . . . . . . . A .  3 G H1   . . . . . . . . . rr_2l5z 1 
       .  1 .    77 . 1 1  3 G H1'  H -17.310  11.424 23.476 . . . 1.0 . . . . . . . . . . . . A .  3 G H1'  . . . . . . . . . rr_2l5z 1 
       .  1 .    78 . 1 1  3 G H2'  H -17.837   9.425 25.300 . . . 1.0 . . . . . . . . . . . . A .  3 G H2'  . . . . . . . . . rr_2l5z 1 
       .  1 .    79 . 1 1  3 G H21  H -14.170  13.786 27.895 . . . 1.0 . . . . . . . . . . . . A .  3 G H21  . . . . . . . . . rr_2l5z 1 
       .  1 .    80 . 1 1  3 G H22  H -13.949  12.857 26.429 . . . 1.0 . . . . . . . . . . . . A .  3 G H22  . . . . . . . . . rr_2l5z 1 
       .  1 .    81 . 1 1  3 G H3'  H -20.113   9.093 24.729 . . . 1.0 . . . . . . . . . . . . A .  3 G H3'  . . . . . . . . . rr_2l5z 1 
       .  1 .    82 . 1 1  3 G H4'  H -19.336   9.386 21.794 . . . 1.0 . . . . . . . . . . . . A .  3 G H4'  . . . . . . . . . rr_2l5z 1 
       .  1 .    83 . 1 1  3 G H5'  H -21.554  10.339 21.553 . . . 1.0 . . . . . . . . . . . . A .  3 G H5'  . . . . . . . . . rr_2l5z 1 
       .  1 .    84 . 1 1  3 G H5'' H -21.694   8.802 22.430 . . . 1.0 . . . . . . . . . . . . A .  3 G H5'' . . . . . . . . . rr_2l5z 1 
       .  1 .    85 . 1 1  3 G H8   H -20.685  11.630 25.055 . . . 1.0 . . . . . . . . . . . . A .  3 G H8   . . . . . . . . . rr_2l5z 1 
       .  1 .    86 . 1 1  3 G HO2' H -17.402   8.197 22.993 . . . 1.0 . . . . . . . . . . . . A .  3 G HO2' . . . . . . . . . rr_2l5z 1 
       .  1 .    87 . 1 1  3 G N1   N -16.646  13.729 27.992 . . . 1.0 . . . . . . . . . . . . A .  3 G N1   . . . . . . . . . rr_2l5z 1 
       .  1 .    88 . 1 1  3 G N2   N -14.560  13.271 27.118 . . . 1.0 . . . . . . . . . . . . A .  3 G N2   . . . . . . . . . rr_2l5z 1 
       .  1 .    89 . 1 1  3 G N3   N -16.399  12.456 25.976 . . . 1.0 . . . . . . . . . . . . A .  3 G N3   . . . . . . . . . rr_2l5z 1 
       .  1 .    90 . 1 1  3 G N7   N -19.935  12.707 26.660 . . . 1.0 . . . . . . . . . . . . A .  3 G N7   . . . . . . . . . rr_2l5z 1 
       .  1 .    91 . 1 1  3 G N9   N -18.573  11.795 25.119 . . . 1.0 . . . . . . . . . . . . A .  3 G N9   . . . . . . . . . rr_2l5z 1 
       .  1 .    92 . 1 1  3 G O2'  O -17.017   8.957 23.435 . . . 1.0 . . . . . . . . . . . . A .  3 G O2'  . . . . . . . . . rr_2l5z 1 
       .  1 .    93 . 1 1  3 G O3'  O -19.252   7.613 23.505 . . . 1.0 . . . . . . . . . . . . A .  3 G O3'  . . . . . . . . . rr_2l5z 1 
       .  1 .    94 . 1 1  3 G O4'  O -19.287  11.107 22.929 . . . 1.0 . . . . . . . . . . . . A .  3 G O4'  . . . . . . . . . rr_2l5z 1 
       .  1 .    95 . 1 1  3 G O5'  O -21.986  10.499 23.562 . . . 1.0 . . . . . . . . . . . . A .  3 G O5'  . . . . . . . . . rr_2l5z 1 
       .  1 .    96 . 1 1  3 G O6   O -18.619  14.261 28.983 . . . 1.0 . . . . . . . . . . . . A .  3 G O6   . . . . . . . . . rr_2l5z 1 
       .  1 .    97 . 1 1  3 G OP1  O -24.291   9.696 22.999 . . . 1.0 . . . . . . . . . . . . A .  3 G OP1  . . . . . . . . . rr_2l5z 1 
       .  1 .    98 . 1 1  3 G OP2  O -23.939  11.592 24.685 . . . 1.0 . . . . . . . . . . . . A .  3 G OP2  . . . . . . . . . rr_2l5z 1 
       .  1 .    99 . 1 1  3 G P    P -23.542  10.893 23.443 . . . 1.0 . . . . . . . . . . . . A .  3 G P    . . . . . . . . . rr_2l5z 1 
       .  1 .   100 . 1 1  4 C C1'  C -16.489   8.257 28.361 . . . 1.0 . . . . . . . . . . . . A .  4 C C1'  . . . . . . . . . rr_2l5z 1 
       .  1 .   101 . 1 1  4 C C2   C -17.194   9.849 30.103 . . . 1.0 . . . . . . . . . . . . A .  4 C C2   . . . . . . . . . rr_2l5z 1 
       .  1 .   102 . 1 1  4 C C2'  C -16.524   6.926 29.124 . . . 1.0 . . . . . . . . . . . . A .  4 C C2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   103 . 1 1  4 C C3'  C -17.067   5.941 28.095 . . . 1.0 . . . . . . . . . . . . A .  4 C C3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   104 . 1 1  4 C C4   C -19.271  10.939 29.989 . . . 1.0 . . . . . . . . . . . . A .  4 C C4   . . . . . . . . . rr_2l5z 1 
       .  1 .   105 . 1 1  4 C C4'  C -16.625   6.556 26.779 . . . 1.0 . . . . . . . . . . . . A .  4 C C4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   106 . 1 1  4 C C5   C -19.585  10.276 28.760 . . . 1.0 . . . . . . . . . . . . A .  4 C C5   . . . . . . . . . rr_2l5z 1 
       .  1 .   107 . 1 1  4 C C5'  C -17.474   6.066 25.606 . . . 1.0 . . . . . . . . . . . . A .  4 C C5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   108 . 1 1  4 C C6   C -18.672   9.421 28.258 . . . 1.0 . . . . . . . . . . . . A .  4 C C6   . . . . . . . . . rr_2l5z 1 
       .  1 .   109 . 1 1  4 C H1'  H -15.490   8.692 28.439 . . . 1.0 . . . . . . . . . . . . A .  4 C H1'  . . . . . . . . . rr_2l5z 1 
       .  1 .   110 . 1 1  4 C H2'  H -17.213   7.002 29.968 . . . 1.0 . . . . . . . . . . . . A .  4 C H2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   111 . 1 1  4 C H3'  H -18.152   5.838 28.160 . . . 1.0 . . . . . . . . . . . . A .  4 C H3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   112 . 1 1  4 C H4'  H -15.579   6.319 26.598 . . . 1.0 . . . . . . . . . . . . A .  4 C H4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   113 . 1 1  4 C H41  H -19.929  12.267 31.384 . . . 1.0 . . . . . . . . . . . . A .  4 C H41  . . . . . . . . . rr_2l5z 1 
       .  1 .   114 . 1 1  4 C H42  H -21.020  11.977 30.049 . . . 1.0 . . . . . . . . . . . . A .  4 C H42  . . . . . . . . . rr_2l5z 1 
       .  1 .   115 . 1 1  4 C H5   H -20.521  10.455 28.253 . . . 1.0 . . . . . . . . . . . . A .  4 C H5   . . . . . . . . . rr_2l5z 1 
       .  1 .   116 . 1 1  4 C H5'  H -17.054   6.455 24.678 . . . 1.0 . . . . . . . . . . . . A .  4 C H5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   117 . 1 1  4 C H5'' H -17.446   4.977 25.578 . . . 1.0 . . . . . . . . . . . . A .  4 C H5'' . . . . . . . . . rr_2l5z 1 
       .  1 .   118 . 1 1  4 C H6   H -18.880   8.899 27.337 . . . 1.0 . . . . . . . . . . . . A .  4 C H6   . . . . . . . . . rr_2l5z 1 
       .  1 .   119 . 1 1  4 C HO2' H -14.586   7.107 29.112 . . . 1.0 . . . . . . . . . . . . A .  4 C HO2' . . . . . . . . . rr_2l5z 1 
       .  1 .   120 . 1 1  4 C N1   N -17.492   9.202 28.908 . . . 1.0 . . . . . . . . . . . . A .  4 C N1   . . . . . . . . . rr_2l5z 1 
       .  1 .   121 . 1 1  4 C N3   N -18.110  10.714 30.617 . . . 1.0 . . . . . . . . . . . . A .  4 C N3   . . . . . . . . . rr_2l5z 1 
       .  1 .   122 . 1 1  4 C N4   N -20.144  11.796 30.517 . . . 1.0 . . . . . . . . . . . . A .  4 C N4   . . . . . . . . . rr_2l5z 1 
       .  1 .   123 . 1 1  4 C O2   O -16.124   9.634 30.669 . . . 1.0 . . . . . . . . . . . . A .  4 C O2   . . . . . . . . . rr_2l5z 1 
       .  1 .   124 . 1 1  4 C O2'  O -15.217   6.546 29.569 . . . 1.0 . . . . . . . . . . . . A .  4 C O2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   125 . 1 1  4 C O3'  O -16.392   4.691 28.263 . . . 1.0 . . . . . . . . . . . . A .  4 C O3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   126 . 1 1  4 C O4'  O -16.761   7.957 26.981 . . . 1.0 . . . . . . . . . . . . A .  4 C O4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   127 . 1 1  4 C O5'  O -18.833   6.493 25.716 . . . 1.0 . . . . . . . . . . . . A .  4 C O5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   128 . 1 1  4 C OP1  O -19.578   5.140 23.743 . . . 1.0 . . . . . . . . . . . . A .  4 C OP1  . . . . . . . . . rr_2l5z 1 
       .  1 .   129 . 1 1  4 C OP2  O -21.177   6.788 24.881 . . . 1.0 . . . . . . . . . . . . A .  4 C OP2  . . . . . . . . . rr_2l5z 1 
       .  1 .   130 . 1 1  4 C P    P -19.812   6.426 24.439 . . . 1.0 . . . . . . . . . . . . A .  4 C P    . . . . . . . . . rr_2l5z 1 
       .  1 .   131 . 1 1  5 U C1'  C -16.097   6.363 33.492 . . . 1.0 . . . . . . . . . . . . A .  5 U C1'  . . . . . . . . . rr_2l5z 1 
       .  1 .   132 . 1 1  5 U C2   C -18.035   7.779 34.125 . . . 1.0 . . . . . . . . . . . . A .  5 U C2   . . . . . . . . . rr_2l5z 1 
       .  1 .   133 . 1 1  5 U C2'  C -16.027   5.239 34.530 . . . 1.0 . . . . . . . . . . . . A .  5 U C2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   134 . 1 1  5 U C3'  C -15.967   3.994 33.663 . . . 1.0 . . . . . . . . . . . . A .  5 U C3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   135 . 1 1  5 U C4   C -20.171   7.631 32.900 . . . 1.0 . . . . . . . . . . . . A .  5 U C4   . . . . . . . . . rr_2l5z 1 
       .  1 .   136 . 1 1  5 U C4'  C -15.162   4.470 32.462 . . . 1.0 . . . . . . . . . . . . A .  5 U C4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   137 . 1 1  5 U C5   C -19.545   6.623 32.075 . . . 1.0 . . . . . . . . . . . . A .  5 U C5   . . . . . . . . . rr_2l5z 1 
       .  1 .   138 . 1 1  5 U C5'  C -15.444   3.630 31.216 . . . 1.0 . . . . . . . . . . . . A .  5 U C5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   139 . 1 1  5 U C6   C -18.260   6.247 32.286 . . . 1.0 . . . . . . . . . . . . A .  5 U C6   . . . . . . . . . rr_2l5z 1 
       .  1 .   140 . 1 1  5 U H1'  H -15.476   7.202 33.820 . . . 1.0 . . . . . . . . . . . . A .  5 U H1'  . . . . . . . . . rr_2l5z 1 
       .  1 .   141 . 1 1  5 U H2'  H -16.937   5.231 35.135 . . . 1.0 . . . . . . . . . . . . A .  5 U H2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   142 . 1 1  5 U H3   H -19.751   8.876 34.504 . . . 1.0 . . . . . . . . . . . . A .  5 U H3   . . . . . . . . . rr_2l5z 1 
       .  1 .   143 . 1 1  5 U H3'  H -16.964   3.645 33.387 . . . 1.0 . . . . . . . . . . . . A .  5 U H3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   144 . 1 1  5 U H4'  H -14.100   4.429 32.697 . . . 1.0 . . . . . . . . . . . . A .  5 U H4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   145 . 1 1  5 U H5   H -20.109   6.162 31.279 . . . 1.0 . . . . . . . . . . . . A .  5 U H5   . . . . . . . . . rr_2l5z 1 
       .  1 .   146 . 1 1  5 U H5'  H -14.664   3.818 30.477 . . . 1.0 . . . . . . . . . . . . A .  5 U H5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   147 . 1 1  5 U H5'' H -15.430   2.573 31.486 . . . 1.0 . . . . . . . . . . . . A .  5 U H5'' . . . . . . . . . rr_2l5z 1 
       .  1 .   148 . 1 1  5 U H6   H -17.822   5.487 31.656 . . . 1.0 . . . . . . . . . . . . A .  5 U H6   . . . . . . . . . rr_2l5z 1 
       .  1 .   149 . 1 1  5 U HO2' H -14.447   6.199 35.141 . . . 1.0 . . . . . . . . . . . . A .  5 U HO2' . . . . . . . . . rr_2l5z 1 
       .  1 .   150 . 1 1  5 U N1   N -17.506   6.803 33.284 . . . 1.0 . . . . . . . . . . . . A .  5 U N1   . . . . . . . . . rr_2l5z 1 
       .  1 .   151 . 1 1  5 U N3   N -19.347   8.144 33.886 . . . 1.0 . . . . . . . . . . . . A .  5 U N3   . . . . . . . . . rr_2l5z 1 
       .  1 .   152 . 1 1  5 U O2   O -17.376   8.288 35.028 . . . 1.0 . . . . . . . . . . . . A .  5 U O2   . . . . . . . . . rr_2l5z 1 
       .  1 .   153 . 1 1  5 U O2'  O -14.863   5.361 35.356 . . . 1.0 . . . . . . . . . . . . A .  5 U O2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   154 . 1 1  5 U O3'  O -15.211   2.994 34.351 . . . 1.0 . . . . . . . . . . . . A .  5 U O3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   155 . 1 1  5 U O4   O -21.325   8.033 32.778 . . . 1.0 . . . . . . . . . . . . A .  5 U O4   . . . . . . . . . rr_2l5z 1 
       .  1 .   156 . 1 1  5 U O4'  O -15.547   5.830 32.271 . . . 1.0 . . . . . . . . . . . . A .  5 U O4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   157 . 1 1  5 U O5'  O -16.715   3.948 30.643 . . . 1.0 . . . . . . . . . . . . A .  5 U O5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   158 . 1 1  5 U OP1  O -16.344   2.253 28.837 . . . 1.0 . . . . . . . . . . . . A .  5 U OP1  . . . . . . . . . rr_2l5z 1 
       .  1 .   159 . 1 1  5 U OP2  O -18.530   3.585 28.956 . . . 1.0 . . . . . . . . . . . . A .  5 U OP2  . . . . . . . . . rr_2l5z 1 
       .  1 .   160 . 1 1  5 U P    P -17.062   3.513 29.132 . . . 1.0 . . . . . . . . . . . . A .  5 U P    . . . . . . . . . rr_2l5z 1 
       .  1 .   161 . 1 1  6 G C1'  C -18.277   5.223 38.178 . . . 1.0 . . . . . . . . . . . . A .  6 G C1'  . . . . . . . . . rr_2l5z 1 
       .  1 .   162 . 1 1  6 G C2   C -20.753   8.866 37.800 . . . 1.0 . . . . . . . . . . . . A .  6 G C2   . . . . . . . . . rr_2l5z 1 
       .  1 .   163 . 1 1  6 G C2'  C -18.824   4.214 39.197 . . . 1.0 . . . . . . . . . . . . A .  6 G C2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   164 . 1 1  6 G C3'  C -17.940   2.975 39.005 . . . 1.0 . . . . . . . . . . . . A .  6 G C3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   165 . 1 1  6 G C4   C -20.044   6.833 37.224 . . . 1.0 . . . . . . . . . . . . A .  6 G C4   . . . . . . . . . rr_2l5z 1 
       .  1 .   166 . 1 1  6 G C4'  C -16.715   3.519 38.275 . . . 1.0 . . . . . . . . . . . . A .  6 G C4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   167 . 1 1  6 G C5   C -20.898   6.728 36.135 . . . 1.0 . . . . . . . . . . . . A .  6 G C5   . . . . . . . . . rr_2l5z 1 
       .  1 .   168 . 1 1  6 G C5'  C -16.019   2.451 37.425 . . . 1.0 . . . . . . . . . . . . A .  6 G C5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   169 . 1 1  6 G C6   C -21.780   7.800 35.834 . . . 1.0 . . . . . . . . . . . . A .  6 G C6   . . . . . . . . . rr_2l5z 1 
       .  1 .   170 . 1 1  6 G C8   C -19.795   4.949 36.204 . . . 1.0 . . . . . . . . . . . . A .  6 G C8   . . . . . . . . . rr_2l5z 1 
       .  1 .   171 . 1 1  6 G H1   H -22.246   9.672 36.579 . . . 1.0 . . . . . . . . . . . . A .  6 G H1   . . . . . . . . . rr_2l5z 1 
       .  1 .   172 . 1 1  6 G H1'  H -17.884   6.090 38.709 . . . 1.0 . . . . . . . . . . . . A .  6 G H1'  . . . . . . . . . rr_2l5z 1 
       .  1 .   173 . 1 1  6 G H2'  H -19.867   3.979 38.960 . . . 1.0 . . . . . . . . . . . . A .  6 G H2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   174 . 1 1  6 G H21  H -21.393  10.723 38.336 . . . 1.0 . . . . . . . . . . . . A .  6 G H21  . . . . . . . . . rr_2l5z 1 
       .  1 .   175 . 1 1  6 G H22  H -20.140  10.038 39.347 . . . 1.0 . . . . . . . . . . . . A .  6 G H22  . . . . . . . . . rr_2l5z 1 
       .  1 .   176 . 1 1  6 G H3'  H -18.451   2.187 38.440 . . . 1.0 . . . . . . . . . . . . A .  6 G H3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   177 . 1 1  6 G H4'  H -16.010   3.922 39.000 . . . 1.0 . . . . . . . . . . . . A .  6 G H4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   178 . 1 1  6 G H5'  H -15.010   2.786 37.193 . . . 1.0 . . . . . . . . . . . . A .  6 G H5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   179 . 1 1  6 G H5'' H -15.964   1.522 37.992 . . . 1.0 . . . . . . . . . . . . A .  6 G H5'' . . . . . . . . . rr_2l5z 1 
       .  1 .   180 . 1 1  6 G H8   H -19.409   3.966 35.977 . . . 1.0 . . . . . . . . . . . . A .  6 G H8   . . . . . . . . . rr_2l5z 1 
       .  1 .   181 . 1 1  6 G HO2' H -18.046   5.410 40.522 . . . 1.0 . . . . . . . . . . . . A .  6 G HO2' . . . . . . . . . rr_2l5z 1 
       .  1 .   182 . 1 1  6 G N1   N -21.635   8.847 36.737 . . . 1.0 . . . . . . . . . . . . A .  6 G N1   . . . . . . . . . rr_2l5z 1 
       .  1 .   183 . 1 1  6 G N2   N -20.763   9.964 38.556 . . . 1.0 . . . . . . . . . . . . A .  6 G N2   . . . . . . . . . rr_2l5z 1 
       .  1 .   184 . 1 1  6 G N3   N -19.920   7.862 38.090 . . . 1.0 . . . . . . . . . . . . A .  6 G N3   . . . . . . . . . rr_2l5z 1 
       .  1 .   185 . 1 1  6 G N7   N -20.721   5.495 35.485 . . . 1.0 . . . . . . . . . . . . A .  6 G N7   . . . . . . . . . rr_2l5z 1 
       .  1 .   186 . 1 1  6 G N9   N -19.335   5.661 37.248 . . . 1.0 . . . . . . . . . . . . A .  6 G N9   . . . . . . . . . rr_2l5z 1 
       .  1 .   187 . 1 1  6 G O2'  O -18.715   4.721 40.532 . . . 1.0 . . . . . . . . . . . . A .  6 G O2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   188 . 1 1  6 G O3'  O -17.521   2.525 40.298 . . . 1.0 . . . . . . . . . . . . A .  6 G O3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   189 . 1 1  6 G O4'  O -17.212   4.578 37.474 . . . 1.0 . . . . . . . . . . . . A .  6 G O4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   190 . 1 1  6 G O5'  O -16.720   2.211 36.202 . . . 1.0 . . . . . . . . . . . . A .  6 G O5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   191 . 1 1  6 G O6   O -22.599   7.882 34.921 . . . 1.0 . . . . . . . . . . . . A .  6 G O6   . . . . . . . . . rr_2l5z 1 
       .  1 .   192 . 1 1  6 G OP1  O -14.888   0.724 35.360 . . . 1.0 . . . . . . . . . . . . A .  6 G OP1  . . . . . . . . . rr_2l5z 1 
       .  1 .   193 . 1 1  6 G OP2  O -16.935   1.234 33.906 . . . 1.0 . . . . . . . . . . . . A .  6 G OP2  . . . . . . . . . rr_2l5z 1 
       .  1 .   194 . 1 1  6 G P    P -15.934   1.667 34.906 . . . 1.0 . . . . . . . . . . . . A .  6 G P    . . . . . . . . . rr_2l5z 1 
       .  1 .   195 . 1 1  7 C C1'  C -18.607   4.022 44.982 . . . 1.0 . . . . . . . . . . . . A .  7 C C1'  . . . . . . . . . rr_2l5z 1 
       .  1 .   196 . 1 1  7 C C2   C -20.913   4.844 45.099 . . . 1.0 . . . . . . . . . . . . A .  7 C C2   . . . . . . . . . rr_2l5z 1 
       .  1 .   197 . 1 1  7 C C2'  C -18.744   2.768 45.850 . . . 1.0 . . . . . . . . . . . . A .  7 C C2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   198 . 1 1  7 C C3'  C -18.054   1.699 45.019 . . . 1.0 . . . . . . . . . . . . A .  7 C C3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   199 . 1 1  7 C C4   C -22.270   4.947 43.183 . . . 1.0 . . . . . . . . . . . . A .  7 C C4   . . . . . . . . . rr_2l5z 1 
       .  1 .   200 . 1 1  7 C C4'  C -16.983   2.487 44.277 . . . 1.0 . . . . . . . . . . . . A .  7 C C4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   201 . 1 1  7 C C5   C -21.213   4.429 42.371 . . . 1.0 . . . . . . . . . . . . A .  7 C C5   . . . . . . . . . rr_2l5z 1 
       .  1 .   202 . 1 1  7 C C5'  C -16.559   1.793 42.979 . . . 1.0 . . . . . . . . . . . . A .  7 C C5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   203 . 1 1  7 C C6   C -20.043   4.140 42.973 . . . 1.0 . . . . . . . . . . . . A .  7 C C6   . . . . . . . . . rr_2l5z 1 
       .  1 .   204 . 1 1  7 C H1'  H -18.309   4.863 45.608 . . . 1.0 . . . . . . . . . . . . A .  7 C H1'  . . . . . . . . . rr_2l5z 1 
       .  1 .   205 . 1 1  7 C H2'  H -19.801   2.517 45.979 . . . 1.0 . . . . . . . . . . . . A .  7 C H2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   206 . 1 1  7 C H3'  H -18.752   1.201 44.342 . . . 1.0 . . . . . . . . . . . . A .  7 C H3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   207 . 1 1  7 C H4'  H -16.116   2.622 44.924 . . . 1.0 . . . . . . . . . . . . A .  7 C H4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   208 . 1 1  7 C H41  H -24.193   5.611 43.196 . . . 1.0 . . . . . . . . . . . . A .  7 C H41  . . . . . . . . . rr_2l5z 1 
       .  1 .   209 . 1 1  7 C H42  H -23.584   5.103 41.637 . . . 1.0 . . . . . . . . . . . . A .  7 C H42  . . . . . . . . . rr_2l5z 1 
       .  1 .   210 . 1 1  7 C H5   H -21.349   4.273 41.311 . . . 1.0 . . . . . . . . . . . . A .  7 C H5   . . . . . . . . . rr_2l5z 1 
       .  1 .   211 . 1 1  7 C H5'  H -16.171   2.541 42.287 . . . 1.0 . . . . . . . . . . . . A .  7 C H5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   212 . 1 1  7 C H5'' H -15.772   1.070 43.198 . . . 1.0 . . . . . . . . . . . . A .  7 C H5'' . . . . . . . . . rr_2l5z 1 
       .  1 .   213 . 1 1  7 C H6   H -19.223   3.748 42.390 . . . 1.0 . . . . . . . . . . . . A .  7 C H6   . . . . . . . . . rr_2l5z 1 
       .  1 .   214 . 1 1  7 C HO2' H -18.475   2.287 47.717 . . . 1.0 . . . . . . . . . . . . A .  7 C HO2' . . . . . . . . . rr_2l5z 1 
       .  1 .   215 . 1 1  7 C N1   N -19.885   4.340 44.314 . . . 1.0 . . . . . . . . . . . . A .  7 C N1   . . . . . . . . . rr_2l5z 1 
       .  1 .   216 . 1 1  7 C N3   N -22.099   5.138 44.497 . . . 1.0 . . . . . . . . . . . . A .  7 C N3   . . . . . . . . . rr_2l5z 1 
       .  1 .   217 . 1 1  7 C N4   N -23.444   5.244 42.627 . . . 1.0 . . . . . . . . . . . . A .  7 C N4   . . . . . . . . . rr_2l5z 1 
       .  1 .   218 . 1 1  7 C O2   O -20.745   5.016 46.305 . . . 1.0 . . . . . . . . . . . . A .  7 C O2   . . . . . . . . . rr_2l5z 1 
       .  1 .   219 . 1 1  7 C O2'  O -18.103   2.939 47.119 . . . 1.0 . . . . . . . . . . . . A .  7 C O2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   220 . 1 1  7 C O3'  O -17.411   0.782 45.907 . . . 1.0 . . . . . . . . . . . . A .  7 C O3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   221 . 1 1  7 C O4'  O -17.573   3.760 44.017 . . . 1.0 . . . . . . . . . . . . A .  7 C O4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   222 . 1 1  7 C O5'  O -17.660   1.111 42.368 . . . 1.0 . . . . . . . . . . . . A .  7 C O5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   223 . 1 1  7 C OP1  O -16.659   0.173 40.271 . . . 1.0 . . . . . . . . . . . . A .  7 C OP1  . . . . . . . . . rr_2l5z 1 
       .  1 .   224 . 1 1  7 C OP2  O -19.173   0.646 40.426 . . . 1.0 . . . . . . . . . . . . A .  7 C OP2  . . . . . . . . . rr_2l5z 1 
       .  1 .   225 . 1 1  7 C P    P -17.778   1.006 40.765 . . . 1.0 . . . . . . . . . . . . A .  7 C P    . . . . . . . . . rr_2l5z 1 
       .  1 .   226 . 1 1  8 A C1'  C -23.000   0.405 44.270 . . . 1.0 . . . . . . . . . . . . A .  8 A C1'  . . . . . . . . . rr_2l5z 1 
       .  1 .   227 . 1 1  8 A C2   C -26.445   3.086 43.564 . . . 1.0 . . . . . . . . . . . . A .  8 A C2   . . . . . . . . . rr_2l5z 1 
       .  1 .   228 . 1 1  8 A C2'  C -21.694   0.673 43.544 . . . 1.0 . . . . . . . . . . . . A .  8 A C2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   229 . 1 1  8 A C3'  C -21.044  -0.701 43.536 . . . 1.0 . . . . . . . . . . . . A .  8 A C3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   230 . 1 1  8 A C4   C -24.617   2.387 44.587 . . . 1.0 . . . . . . . . . . . . A .  8 A C4   . . . . . . . . . rr_2l5z 1 
       .  1 .   231 . 1 1  8 A C4'  C -21.574  -1.371 44.824 . . . 1.0 . . . . . . . . . . . . A .  8 A C4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   232 . 1 1  8 A C5   C -24.636   3.422 45.494 . . . 1.0 . . . . . . . . . . . . A .  8 A C5   . . . . . . . . . rr_2l5z 1 
       .  1 .   233 . 1 1  8 A C5'  C -20.523  -1.440 45.944 . . . 1.0 . . . . . . . . . . . . A .  8 A C5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   234 . 1 1  8 A C6   C -25.683   4.341 45.369 . . . 1.0 . . . . . . . . . . . . A .  8 A C6   . . . . . . . . . rr_2l5z 1 
       .  1 .   235 . 1 1  8 A C8   C -22.963   2.255 45.961 . . . 1.0 . . . . . . . . . . . . A .  8 A C8   . . . . . . . . . rr_2l5z 1 
       .  1 .   236 . 1 1  8 A H1'  H -23.737   0.022 43.564 . . . 1.0 . . . . . . . . . . . . A .  8 A H1'  . . . . . . . . . rr_2l5z 1 
       .  1 .   237 . 1 1  8 A H2   H -27.204   2.981 42.788 . . . 1.0 . . . . . . . . . . . . A .  8 A H2   . . . . . . . . . rr_2l5z 1 
       .  1 .   238 . 1 1  8 A H2'  H -21.083   1.375 44.118 . . . 1.0 . . . . . . . . . . . . A .  8 A H2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   239 . 1 1  8 A H3'  H -19.952  -0.632 43.495 . . . 1.0 . . . . . . . . . . . . A .  8 A H3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   240 . 1 1  8 A H4'  H -21.910  -2.380 44.587 . . . 1.0 . . . . . . . . . . . . A .  8 A H4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   241 . 1 1  8 A H5'  H -21.033  -1.528 46.904 . . . 1.0 . . . . . . . . . . . . A .  8 A H5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   242 . 1 1  8 A H5'' H -19.897  -2.319 45.793 . . . 1.0 . . . . . . . . . . . . A .  8 A H5'' . . . . . . . . . rr_2l5z 1 
       .  1 .   243 . 1 1  8 A H61  H -26.605   6.027 46.040 . . . 1.0 . . . . . . . . . . . . A .  8 A H61  . . . . . . . . . rr_2l5z 1 
       .  1 .   244 . 1 1  8 A H62  H -25.165   5.558 46.916 . . . 1.0 . . . . . . . . . . . . A .  8 A H62  . . . . . . . . . rr_2l5z 1 
       .  1 .   245 . 1 1  8 A H8   H -22.067   1.879 46.432 . . . 1.0 . . . . . . . . . . . . A .  8 A H8   . . . . . . . . . rr_2l5z 1 
       .  1 .   246 . 1 1  8 A HO2' H -21.235   1.801 42.024 . . . 1.0 . . . . . . . . . . . . A .  8 A HO2' . . . . . . . . . rr_2l5z 1 
       .  1 .   247 . 1 1  8 A N1   N -26.574   4.133 44.382 . . . 1.0 . . . . . . . . . . . . A .  8 A N1   . . . . . . . . . rr_2l5z 1 
       .  1 .   248 . 1 1  8 A N3   N -25.495   2.156 43.592 . . . 1.0 . . . . . . . . . . . . A .  8 A N3   . . . . . . . . . rr_2l5z 1 
       .  1 .   249 . 1 1  8 A N6   N -25.830   5.394 46.173 . . . 1.0 . . . . . . . . . . . . A .  8 A N6   . . . . . . . . . rr_2l5z 1 
       .  1 .   250 . 1 1  8 A N7   N -23.552   3.326 46.384 . . . 1.0 . . . . . . . . . . . . A .  8 A N7   . . . . . . . . . rr_2l5z 1 
       .  1 .   251 . 1 1  8 A N9   N -23.518   1.633 44.905 . . . 1.0 . . . . . . . . . . . . A .  8 A N9   . . . . . . . . . rr_2l5z 1 
       .  1 .   252 . 1 1  8 A O2'  O -21.921   1.157 42.215 . . . 1.0 . . . . . . . . . . . . A .  8 A O2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   253 . 1 1  8 A O3'  O -21.567  -1.425 42.417 . . . 1.0 . . . . . . . . . . . . A .  8 A O3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   254 . 1 1  8 A O4'  O -22.706  -0.598 45.246 . . . 1.0 . . . . . . . . . . . . A .  8 A O4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   255 . 1 1  8 A O5'  O -19.692  -0.276 45.962 . . . 1.0 . . . . . . . . . . . . A .  8 A O5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   256 . 1 1  8 A OP1  O -18.486   0.225 48.100 . . . 1.0 . . . . . . . . . . . . A .  8 A OP1  . . . . . . . . . rr_2l5z 1 
       .  1 .   257 . 1 1  8 A OP2  O -17.664  -1.630 46.536 . . . 1.0 . . . . . . . . . . . . A .  8 A OP2  . . . . . . . . . rr_2l5z 1 
       .  1 .   258 . 1 1  8 A P    P -18.277  -0.297 46.731 . . . 1.0 . . . . . . . . . . . . A .  8 A P    . . . . . . . . . rr_2l5z 1 
       .  1 .   259 . 1 1  9 G C1'  C -23.496   1.793 39.923 . . . 1.0 . . . . . . . . . . . . A .  9 G C1'  . . . . . . . . . rr_2l5z 1 
       .  1 .   260 . 1 1  9 G C2   C -25.053   5.927 39.963 . . . 1.0 . . . . . . . . . . . . A .  9 G C2   . . . . . . . . . rr_2l5z 1 
       .  1 .   261 . 1 1  9 G C2'  C -24.729   0.900 39.723 . . . 1.0 . . . . . . . . . . . . A .  9 G C2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   262 . 1 1  9 G C3'  C -24.140  -0.490 39.455 . . . 1.0 . . . . . . . . . . . . A .  9 G C3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   263 . 1 1  9 G C4   C -24.026   4.162 39.069 . . . 1.0 . . . . . . . . . . . . A .  9 G C4   . . . . . . . . . rr_2l5z 1 
       .  1 .   264 . 1 1  9 G C4'  C -22.724  -0.386 40.011 . . . 1.0 . . . . . . . . . . . . A .  9 G C4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   265 . 1 1  9 G C5   C -23.806   4.776 37.845 . . . 1.0 . . . . . . . . . . . . A .  9 G C5   . . . . . . . . . rr_2l5z 1 
       .  1 .   266 . 1 1  9 G C5'  C -21.761  -1.373 39.345 . . . 1.0 . . . . . . . . . . . . A .  9 G C5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   267 . 1 1  9 G C6   C -24.254   6.109 37.643 . . . 1.0 . . . . . . . . . . . . A .  9 G C6   . . . . . . . . . rr_2l5z 1 
       .  1 .   268 . 1 1  9 G C8   C -22.995   2.849 37.704 . . . 1.0 . . . . . . . . . . . . A .  9 G C8   . . . . . . . . . rr_2l5z 1 
       .  1 .   269 . 1 1  9 G H1   H -25.235   7.589 38.706 . . . 1.0 . . . . . . . . . . . . A .  9 G H1   . . . . . . . . . rr_2l5z 1 
       .  1 .   270 . 1 1  9 G H1'  H -23.511   2.200 40.934 . . . 1.0 . . . . . . . . . . . . A .  9 G H1'  . . . . . . . . . rr_2l5z 1 
       .  1 .   271 . 1 1  9 G H2'  H -25.299   1.244 38.853 . . . 1.0 . . . . . . . . . . . . A .  9 G H2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   272 . 1 1  9 G H21  H -25.979   7.534 40.800 . . . 1.0 . . . . . . . . . . . . A .  9 G H21  . . . . . . . . . rr_2l5z 1 
       .  1 .   273 . 1 1  9 G H22  H -25.816   6.137 41.838 . . . 1.0 . . . . . . . . . . . . A .  9 G H22  . . . . . . . . . rr_2l5z 1 
       .  1 .   274 . 1 1  9 G H3'  H -24.151  -0.746 38.390 . . . 1.0 . . . . . . . . . . . . A .  9 G H3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   275 . 1 1  9 G H4'  H -22.740  -0.562 41.085 . . . 1.0 . . . . . . . . . . . . A .  9 G H4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   276 . 1 1  9 G H5'  H -22.252  -2.342 39.244 . . . 1.0 . . . . . . . . . . . . A .  9 G H5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   277 . 1 1  9 G H5'' H -21.498  -1.001 38.355 . . . 1.0 . . . . . . . . . . . . A .  9 G H5'' . . . . . . . . . rr_2l5z 1 
       .  1 .   278 . 1 1  9 G H8   H -22.495   1.965 37.334 . . . 1.0 . . . . . . . . . . . . A .  9 G H8   . . . . . . . . . rr_2l5z 1 
       .  1 .   279 . 1 1  9 G HO2' H -25.320   1.666 41.412 . . . 1.0 . . . . . . . . . . . . A .  9 G HO2' . . . . . . . . . rr_2l5z 1 
       .  1 .   280 . 1 1  9 G N1   N -24.878   6.615 38.778 . . . 1.0 . . . . . . . . . . . . A .  9 G N1   . . . . . . . . . rr_2l5z 1 
       .  1 .   281 . 1 1  9 G N2   N -25.666   6.586 40.946 . . . 1.0 . . . . . . . . . . . . A .  9 G N2   . . . . . . . . . rr_2l5z 1 
       .  1 .   282 . 1 1  9 G N3   N -24.637   4.672 40.160 . . . 1.0 . . . . . . . . . . . . A .  9 G N3   . . . . . . . . . rr_2l5z 1 
       .  1 .   283 . 1 1  9 G N7   N -23.132   3.906 36.970 . . . 1.0 . . . . . . . . . . . . A .  9 G N7   . . . . . . . . . rr_2l5z 1 
       .  1 .   284 . 1 1  9 G N9   N -23.493   2.905 38.953 . . . 1.0 . . . . . . . . . . . . A .  9 G N9   . . . . . . . . . rr_2l5z 1 
       .  1 .   285 . 1 1  9 G O2'  O -25.554   0.893 40.893 . . . 1.0 . . . . . . . . . . . . A .  9 G O2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   286 . 1 1  9 G O3'  O -24.864  -1.440 40.243 . . . 1.0 . . . . . . . . . . . . A .  9 G O3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   287 . 1 1  9 G O4'  O -22.343   0.960 39.767 . . . 1.0 . . . . . . . . . . . . A .  9 G O4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   288 . 1 1  9 G O5'  O -20.566  -1.537 40.114 . . . 1.0 . . . . . . . . . . . . A .  9 G O5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   289 . 1 1  9 G O6   O -24.163   6.800 36.631 . . . 1.0 . . . . . . . . . . . . A .  9 G O6   . . . . . . . . . rr_2l5z 1 
       .  1 .   290 . 1 1  9 G OP1  O -21.265  -3.639 41.285 . . . 1.0 . . . . . . . . . . . . A .  9 G OP1  . . . . . . . . . rr_2l5z 1 
       .  1 .   291 . 1 1  9 G OP2  O -19.240  -2.296 42.099 . . . 1.0 . . . . . . . . . . . . A .  9 G OP2  . . . . . . . . . rr_2l5z 1 
       .  1 .   292 . 1 1  9 G P    P -20.598  -2.337 41.511 . . . 1.0 . . . . . . . . . . . . A .  9 G P    . . . . . . . . . rr_2l5z 1 
       .  1 .   293 . 1 1 10 C C1'  C -28.960   2.420 40.651 . . . 1.0 . . . . . . . . . . . . A . 10 C C1'  . . . . . . . . . rr_2l5z 1 
       .  1 .   294 . 1 1 10 C C2   C -29.673   3.445 38.524 . . . 1.0 . . . . . . . . . . . . A . 10 C C2   . . . . . . . . . rr_2l5z 1 
       .  1 .   295 . 1 1 10 C C2'  C -30.242   1.748 41.140 . . . 1.0 . . . . . . . . . . . . A . 10 C C2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   296 . 1 1 10 C C3'  C -29.789   0.327 41.422 . . . 1.0 . . . . . . . . . . . . A . 10 C C3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   297 . 1 1 10 C C4   C -28.903   2.622 36.464 . . . 1.0 . . . . . . . . . . . . A . 10 C C4   . . . . . . . . . rr_2l5z 1 
       .  1 .   298 . 1 1 10 C C4'  C -28.350   0.519 41.891 . . . 1.0 . . . . . . . . . . . . A . 10 C C4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   299 . 1 1 10 C C5   C -28.130   1.614 37.120 . . . 1.0 . . . . . . . . . . . . A . 10 C C5   . . . . . . . . . rr_2l5z 1 
       .  1 .   300 . 1 1 10 C C5'  C -27.490  -0.720 41.635 . . . 1.0 . . . . . . . . . . . . A . 10 C C5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   301 . 1 1 10 C C6   C -28.168   1.572 38.466 . . . 1.0 . . . . . . . . . . . . A . 10 C C6   . . . . . . . . . rr_2l5z 1 
       .  1 .   302 . 1 1 10 C H1'  H -28.903   3.433 41.057 . . . 1.0 . . . . . . . . . . . . A . 10 C H1'  . . . . . . . . . rr_2l5z 1 
       .  1 .   303 . 1 1 10 C H2'  H -30.991   1.751 40.344 . . . 1.0 . . . . . . . . . . . . A . 10 C H2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   304 . 1 1 10 C H3'  H -29.863  -0.304 40.533 . . . 1.0 . . . . . . . . . . . . A . 10 C H3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   305 . 1 1 10 C H4'  H -28.344   0.750 42.955 . . . 1.0 . . . . . . . . . . . . A . 10 C H4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   306 . 1 1 10 C H41  H -29.437   3.413 34.666 . . . 1.0 . . . . . . . . . . . . A . 10 C H41  . . . . . . . . . rr_2l5z 1 
       .  1 .   307 . 1 1 10 C H42  H -28.339   2.052 34.593 . . . 1.0 . . . . . . . . . . . . A . 10 C H42  . . . . . . . . . rr_2l5z 1 
       .  1 .   308 . 1 1 10 C H5   H -27.535   0.911 36.556 . . . 1.0 . . . . . . . . . . . . A . 10 C H5   . . . . . . . . . rr_2l5z 1 
       .  1 .   309 . 1 1 10 C H5'  H -26.505  -0.567 42.077 . . . 1.0 . . . . . . . . . . . . A . 10 C H5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   310 . 1 1 10 C H5'' H -27.960  -1.583 42.105 . . . 1.0 . . . . . . . . . . . . A . 10 C H5'' . . . . . . . . . rr_2l5z 1 
       .  1 .   311 . 1 1 10 C H6   H -27.603   0.817 38.994 . . . 1.0 . . . . . . . . . . . . A . 10 C H6   . . . . . . . . . rr_2l5z 1 
       .  1 .   312 . 1 1 10 C HO2' H -30.649   1.757 43.044 . . . 1.0 . . . . . . . . . . . . A . 10 C HO2' . . . . . . . . . rr_2l5z 1 
       .  1 .   313 . 1 1 10 C N1   N -28.921   2.467 39.170 . . . 1.0 . . . . . . . . . . . . A . 10 C N1   . . . . . . . . . rr_2l5z 1 
       .  1 .   314 . 1 1 10 C N3   N -29.639   3.492 37.165 . . . 1.0 . . . . . . . . . . . . A . 10 C N3   . . . . . . . . . rr_2l5z 1 
       .  1 .   315 . 1 1 10 C N4   N -28.892   2.702 35.134 . . . 1.0 . . . . . . . . . . . . A . 10 C N4   . . . . . . . . . rr_2l5z 1 
       .  1 .   316 . 1 1 10 C O2   O -30.347   4.239 39.179 . . . 1.0 . . . . . . . . . . . . A . 10 C O2   . . . . . . . . . rr_2l5z 1 
       .  1 .   317 . 1 1 10 C O2'  O -30.749   2.381 42.320 . . . 1.0 . . . . . . . . . . . . A . 10 C O2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   318 . 1 1 10 C O3'  O -30.558  -0.183 42.515 . . . 1.0 . . . . . . . . . . . . A . 10 C O3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   319 . 1 1 10 C O4'  O -27.861   1.647 41.165 . . . 1.0 . . . . . . . . . . . . A . 10 C O4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   320 . 1 1 10 C O5'  O -27.338  -0.976 40.236 . . . 1.0 . . . . . . . . . . . . A . 10 C O5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   321 . 1 1 10 C OP1  O -26.500  -3.330 40.416 . . . 1.0 . . . . . . . . . . . . A . 10 C OP1  . . . . . . . . . rr_2l5z 1 
       .  1 .   322 . 1 1 10 C OP2  O -26.246  -2.012 38.233 . . . 1.0 . . . . . . . . . . . . A . 10 C OP2  . . . . . . . . . rr_2l5z 1 
       .  1 .   323 . 1 1 10 C P    P -26.257  -2.050 39.713 . . . 1.0 . . . . . . . . . . . . A . 10 C P    . . . . . . . . . rr_2l5z 1 
       .  1 .   324 . 1 1 11 A C1'  C -35.264   2.597 40.060 . . . 1.0 . . . . . . . . . . . . A . 11 A C1'  . . . . . . . . . rr_2l5z 1 
       .  1 .   325 . 1 1 11 A C2   C -35.191   4.205 35.935 . . . 1.0 . . . . . . . . . . . . A . 11 A C2   . . . . . . . . . rr_2l5z 1 
       .  1 .   326 . 1 1 11 A C2'  C -36.333   1.534 40.303 . . . 1.0 . . . . . . . . . . . . A . 11 A C2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   327 . 1 1 11 A C3'  C -35.652   0.601 41.288 . . . 1.0 . . . . . . . . . . . . A . 11 A C3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   328 . 1 1 11 A C4   C -34.569   2.882 37.592 . . . 1.0 . . . . . . . . . . . . A . 11 A C4   . . . . . . . . . rr_2l5z 1 
       .  1 .   329 . 1 1 11 A C4'  C -34.791   1.555 42.112 . . . 1.0 . . . . . . . . . . . . A . 11 A C4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   330 . 1 1 11 A C5   C -33.638   2.225 36.820 . . . 1.0 . . . . . . . . . . . . A . 11 A C5   . . . . . . . . . rr_2l5z 1 
       .  1 .   331 . 1 1 11 A C5'  C -33.568   0.854 42.710 . . . 1.0 . . . . . . . . . . . . A . 11 A C5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   332 . 1 1 11 A C6   C -33.522   2.645 35.491 . . . 1.0 . . . . . . . . . . . . A . 11 A C6   . . . . . . . . . rr_2l5z 1 
       .  1 .   333 . 1 1 11 A C8   C -33.548   1.357 38.721 . . . 1.0 . . . . . . . . . . . . A . 11 A C8   . . . . . . . . . rr_2l5z 1 
       .  1 .   334 . 1 1 11 A H1'  H -35.740   3.572 39.962 . . . 1.0 . . . . . . . . . . . . A . 11 A H1'  . . . . . . . . . rr_2l5z 1 
       .  1 .   335 . 1 1 11 A H2   H -35.809   5.010 35.538 . . . 1.0 . . . . . . . . . . . . A . 11 A H2   . . . . . . . . . rr_2l5z 1 
       .  1 .   336 . 1 1 11 A H2'  H -36.551   1.003 39.374 . . . 1.0 . . . . . . . . . . . . A . 11 A H2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   337 . 1 1 11 A H3'  H -35.065  -0.166 40.777 . . . 1.0 . . . . . . . . . . . . A . 11 A H3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   338 . 1 1 11 A H4'  H -35.391   1.981 42.915 . . . 1.0 . . . . . . . . . . . . A . 11 A H4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   339 . 1 1 11 A H5'  H -32.842   1.607 43.019 . . . 1.0 . . . . . . . . . . . . A . 11 A H5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   340 . 1 1 11 A H5'' H -33.879   0.281 43.584 . . . 1.0 . . . . . . . . . . . . A . 11 A H5'' . . . . . . . . . rr_2l5z 1 
       .  1 .   341 . 1 1 11 A H61  H -32.620   2.438 33.679 . . . 1.0 . . . . . . . . . . . . A . 11 A H61  . . . . . . . . . rr_2l5z 1 
       .  1 .   342 . 1 1 11 A H62  H -32.062   1.345 34.925 . . . 1.0 . . . . . . . . . . . . A . 11 A H62  . . . . . . . . . rr_2l5z 1 
       .  1 .   343 . 1 1 11 A H8   H -33.270   0.732 39.557 . . . 1.0 . . . . . . . . . . . . A . 11 A H8   . . . . . . . . . rr_2l5z 1 
       .  1 .   344 . 1 1 11 A HO2' H -37.359   2.254 41.792 . . . 1.0 . . . . . . . . . . . . A . 11 A HO2' . . . . . . . . . rr_2l5z 1 
       .  1 .   345 . 1 1 11 A N1   N -34.324   3.647 35.085 . . . 1.0 . . . . . . . . . . . . A . 11 A N1   . . . . . . . . . rr_2l5z 1 
       .  1 .   346 . 1 1 11 A N3   N -35.384   3.886 37.212 . . . 1.0 . . . . . . . . . . . . A . 11 A N3   . . . . . . . . . rr_2l5z 1 
       .  1 .   347 . 1 1 11 A N6   N -32.665   2.099 34.629 . . . 1.0 . . . . . . . . . . . . A . 11 A N6   . . . . . . . . . rr_2l5z 1 
       .  1 .   348 . 1 1 11 A N7   N -32.979   1.234 37.567 . . . 1.0 . . . . . . . . . . . . A . 11 A N7   . . . . . . . . . rr_2l5z 1 
       .  1 .   349 . 1 1 11 A N9   N -34.498   2.302 38.833 . . . 1.0 . . . . . . . . . . . . A . 11 A N9   . . . . . . . . . rr_2l5z 1 
       .  1 .   350 . 1 1 11 A O2'  O -37.523   2.104 40.858 . . . 1.0 . . . . . . . . . . . . A . 11 A O2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   351 . 1 1 11 A O3'  O -36.652   0.038 42.143 . . . 1.0 . . . . . . . . . . . . A . 11 A O3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   352 . 1 1 11 A O4'  O -34.405   2.598 41.213 . . . 1.0 . . . . . . . . . . . . A . 11 A O4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   353 . 1 1 11 A O5'  O -32.954  -0.028 41.767 . . . 1.0 . . . . . . . . . . . . A . 11 A O5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   354 . 1 1 11 A OP1  O -32.293  -1.669 43.541 . . . 1.0 . . . . . . . . . . . . A . 11 A OP1  . . . . . . . . . rr_2l5z 1 
       .  1 .   355 . 1 1 11 A OP2  O -31.556  -2.000 41.110 . . . 1.0 . . . . . . . . . . . . A . 11 A OP2  . . . . . . . . . rr_2l5z 1 
       .  1 .   356 . 1 1 11 A P    P -31.853  -1.101 42.247 . . . 1.0 . . . . . . . . . . . . A . 11 A P    . . . . . . . . . rr_2l5z 1 
       .  1 .   357 . 1 1 12 C C1'  C -39.236   0.259 37.212 . . . 1.0 . . . . . . . . . . . . A . 12 C C1'  . . . . . . . . . rr_2l5z 1 
       .  1 .   358 . 1 1 12 C C2   C -37.888   0.059 35.140 . . . 1.0 . . . . . . . . . . . . A . 12 C C2   . . . . . . . . . rr_2l5z 1 
       .  1 .   359 . 1 1 12 C C2'  C -40.344  -0.794 37.067 . . . 1.0 . . . . . . . . . . . . A . 12 C C2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   360 . 1 1 12 C C3'  C -40.435  -1.404 38.460 . . . 1.0 . . . . . . . . . . . . A . 12 C C3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   361 . 1 1 12 C C4   C -35.773  -0.963 35.168 . . . 1.0 . . . . . . . . . . . . A . 12 C C4   . . . . . . . . . rr_2l5z 1 
       .  1 .   362 . 1 1 12 C C4'  C -39.997  -0.260 39.360 . . . 1.0 . . . . . . . . . . . . A . 12 C C4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   363 . 1 1 12 C C5   C -35.878  -1.212 36.573 . . . 1.0 . . . . . . . . . . . . A . 12 C C5   . . . . . . . . . rr_2l5z 1 
       .  1 .   364 . 1 1 12 C C5'  C -39.457  -0.754 40.705 . . . 1.0 . . . . . . . . . . . . A . 12 C C5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   365 . 1 1 12 C C6   C -36.999  -0.806 37.201 . . . 1.0 . . . . . . . . . . . . A . 12 C C6   . . . . . . . . . rr_2l5z 1 
       .  1 .   366 . 1 1 12 C H1'  H -39.587   1.212 36.805 . . . 1.0 . . . . . . . . . . . . A . 12 C H1'  . . . . . . . . . rr_2l5z 1 
       .  1 .   367 . 1 1 12 C H2'  H -40.040  -1.556 36.344 . . . 1.0 . . . . . . . . . . . . A . 12 C H2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   368 . 1 1 12 C H3'  H -39.794  -2.282 38.564 . . . 1.0 . . . . . . . . . . . . A . 12 C H3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   369 . 1 1 12 C H4'  H -40.836   0.413 39.527 . . . 1.0 . . . . . . . . . . . . A . 12 C H4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   370 . 1 1 12 C H41  H -34.600  -1.174 33.518 . . . 1.0 . . . . . . . . . . . . A . 12 C H41  . . . . . . . . . rr_2l5z 1 
       .  1 .   371 . 1 1 12 C H42  H -33.930  -1.810 35.004 . . . 1.0 . . . . . . . . . . . . A . 12 C H42  . . . . . . . . . rr_2l5z 1 
       .  1 .   372 . 1 1 12 C H5   H -35.084  -1.708 37.111 . . . 1.0 . . . . . . . . . . . . A . 12 C H5   . . . . . . . . . rr_2l5z 1 
       .  1 .   373 . 1 1 12 C H5'  H -39.454   0.077 41.411 . . . 1.0 . . . . . . . . . . . . A . 12 C H5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   374 . 1 1 12 C H5'' H -40.107  -1.542 41.088 . . . 1.0 . . . . . . . . . . . . A . 12 C H5'' . . . . . . . . . rr_2l5z 1 
       .  1 .   375 . 1 1 12 C H6   H -37.111  -0.988 38.262 . . . 1.0 . . . . . . . . . . . . A . 12 C H6   . . . . . . . . . rr_2l5z 1 
       .  1 .   376 . 1 1 12 C HO2' H -41.416   0.330 35.894 . . . 1.0 . . . . . . . . . . . . A . 12 C HO2' . . . . . . . . . rr_2l5z 1 
       .  1 .   377 . 1 1 12 C N1   N -37.998  -0.178 36.512 . . . 1.0 . . . . . . . . . . . . A . 12 C N1   . . . . . . . . . rr_2l5z 1 
       .  1 .   378 . 1 1 12 C N3   N -36.758  -0.349 34.501 . . . 1.0 . . . . . . . . . . . . A . 12 C N3   . . . . . . . . . rr_2l5z 1 
       .  1 .   379 . 1 1 12 C N4   N -34.679  -1.347 34.510 . . . 1.0 . . . . . . . . . . . . A . 12 C N4   . . . . . . . . . rr_2l5z 1 
       .  1 .   380 . 1 1 12 C O2   O -38.795   0.632 34.537 . . . 1.0 . . . . . . . . . . . . A . 12 C O2   . . . . . . . . . rr_2l5z 1 
       .  1 .   381 . 1 1 12 C O2'  O -41.585  -0.194 36.680 . . . 1.0 . . . . . . . . . . . . A . 12 C O2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   382 . 1 1 12 C O3'  O -41.807  -1.698 38.737 . . . 1.0 . . . . . . . . . . . . A . 12 C O3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   383 . 1 1 12 C O4'  O -38.992   0.422 38.620 . . . 1.0 . . . . . . . . . . . . A . 12 C O4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   384 . 1 1 12 C O5'  O -38.127  -1.263 40.581 . . . 1.0 . . . . . . . . . . . . A . 12 C O5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   385 . 1 1 12 C OP1  O -38.072  -1.830 43.020 . . . 1.0 . . . . . . . . . . . . A . 12 C OP1  . . . . . . . . . rr_2l5z 1 
       .  1 .   386 . 1 1 12 C OP2  O -36.054  -2.313 41.516 . . . 1.0 . . . . . . . . . . . . A . 12 C OP2  . . . . . . . . . rr_2l5z 1 
       .  1 .   387 . 1 1 12 C P    P -37.201  -1.453 41.884 . . . 1.0 . . . . . . . . . . . . A . 12 C P    . . . . . . . . . rr_2l5z 1 
       .  1 .   388 . 1 1 13 G C1'  C -39.654  -3.310 33.373 . . . 1.0 . . . . . . . . . . . . A . 13 G C1'  . . . . . . . . . rr_2l5z 1 
       .  1 .   389 . 1 1 13 G C2   C -36.065  -3.276 30.781 . . . 1.0 . . . . . . . . . . . . A . 13 G C2   . . . . . . . . . rr_2l5z 1 
       .  1 .   390 . 1 1 13 G C2'  C -40.204  -4.620 32.800 . . . 1.0 . . . . . . . . . . . . A . 13 G C2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   391 . 1 1 13 G C3'  C -40.930  -5.236 33.984 . . . 1.0 . . . . . . . . . . . . A . 13 G C3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   392 . 1 1 13 G C4   C -37.163  -3.393 32.719 . . . 1.0 . . . . . . . . . . . . A . 13 G C4   . . . . . . . . . rr_2l5z 1 
       .  1 .   393 . 1 1 13 G C4'  C -41.399  -4.016 34.762 . . . 1.0 . . . . . . . . . . . . A . 13 G C4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   394 . 1 1 13 G C5   C -36.014  -3.539 33.482 . . . 1.0 . . . . . . . . . . . . A . 13 G C5   . . . . . . . . . rr_2l5z 1 
       .  1 .   395 . 1 1 13 G C5'  C -41.639  -4.334 36.239 . . . 1.0 . . . . . . . . . . . . A . 13 G C5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   396 . 1 1 13 G C6   C -34.747  -3.556 32.841 . . . 1.0 . . . . . . . . . . . . A . 13 G C6   . . . . . . . . . rr_2l5z 1 
       .  1 .   397 . 1 1 13 G C8   C -37.626  -3.567 34.818 . . . 1.0 . . . . . . . . . . . . A . 13 G C8   . . . . . . . . . rr_2l5z 1 
       .  1 .   398 . 1 1 13 G H1   H -33.983  -3.419 30.922 . . . 1.0 . . . . . . . . . . . . A . 13 G H1   . . . . . . . . . rr_2l5z 1 
       .  1 .   399 . 1 1 13 G H1'  H -39.845  -2.500 32.670 . . . 1.0 . . . . . . . . . . . . A . 13 G H1'  . . . . . . . . . rr_2l5z 1 
       .  1 .   400 . 1 1 13 G H2'  H -39.379  -5.266 32.489 . . . 1.0 . . . . . . . . . . . . A . 13 G H2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   401 . 1 1 13 G H21  H -35.072  -3.166 29.008 . . . 1.0 . . . . . . . . . . . . A . 13 G H21  . . . . . . . . . rr_2l5z 1 
       .  1 .   402 . 1 1 13 G H22  H -36.814  -3.046 28.903 . . . 1.0 . . . . . . . . . . . . A . 13 G H22  . . . . . . . . . rr_2l5z 1 
       .  1 .   403 . 1 1 13 G H3'  H -40.272  -5.879 34.573 . . . 1.0 . . . . . . . . . . . . A . 13 G H3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   404 . 1 1 13 G H4'  H -42.317  -3.632 34.319 . . . 1.0 . . . . . . . . . . . . A . 13 G H4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   405 . 1 1 13 G H5'  H -42.196  -5.268 36.317 . . . 1.0 . . . . . . . . . . . . A . 13 G H5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   406 . 1 1 13 G H5'' H -40.678  -4.451 36.739 . . . 1.0 . . . . . . . . . . . . A . 13 G H5'' . . . . . . . . . rr_2l5z 1 
       .  1 .   407 . 1 1 13 G H8   H -38.214  -3.617 35.722 . . . 1.0 . . . . . . . . . . . . A . 13 G H8   . . . . . . . . . rr_2l5z 1 
       .  1 .   408 . 1 1 13 G HO2' H -41.515  -5.213 31.488 . . . 1.0 . . . . . . . . . . . . A . 13 G HO2' . . . . . . . . . rr_2l5z 1 
       .  1 .   409 . 1 1 13 G N1   N -34.871  -3.416 31.463 . . . 1.0 . . . . . . . . . . . . A . 13 G N1   . . . . . . . . . rr_2l5z 1 
       .  1 .   410 . 1 1 13 G N2   N -35.976  -3.153 29.457 . . . 1.0 . . . . . . . . . . . . A . 13 G N2   . . . . . . . . . rr_2l5z 1 
       .  1 .   411 . 1 1 13 G N3   N -37.262  -3.258 31.378 . . . 1.0 . . . . . . . . . . . . A . 13 G N3   . . . . . . . . . rr_2l5z 1 
       .  1 .   412 . 1 1 13 G N7   N -36.336  -3.650 34.845 . . . 1.0 . . . . . . . . . . . . A . 13 G N7   . . . . . . . . . rr_2l5z 1 
       .  1 .   413 . 1 1 13 G N9   N -38.203  -3.415 33.613 . . . 1.0 . . . . . . . . . . . . A . 13 G N9   . . . . . . . . . rr_2l5z 1 
       .  1 .   414 . 1 1 13 G O2'  O -41.099  -4.377 31.708 . . . 1.0 . . . . . . . . . . . . A . 13 G O2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   415 . 1 1 13 G O3'  O -42.079  -5.935 33.499 . . . 1.0 . . . . . . . . . . . . A . 13 G O3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   416 . 1 1 13 G O4'  O -40.362  -3.052 34.597 . . . 1.0 . . . . . . . . . . . . A . 13 G O4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   417 . 1 1 13 G O5'  O -42.379  -3.295 36.885 . . . 1.0 . . . . . . . . . . . . A . 13 G O5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   418 . 1 1 13 G O6   O -33.635  -3.675 33.351 . . . 1.0 . . . . . . . . . . . . A . 13 G O6   . . . . . . . . . rr_2l5z 1 
       .  1 .   419 . 1 1 13 G OP1  O -43.800  -3.201 38.944 . . . 1.0 . . . . . . . . . . . . A . 13 G OP1  . . . . . . . . . rr_2l5z 1 
       .  1 .   420 . 1 1 13 G OP2  O -41.424  -4.156 39.034 . . . 1.0 . . . . . . . . . . . . A . 13 G OP2  . . . . . . . . . rr_2l5z 1 
       .  1 .   421 . 1 1 13 G P    P -42.392  -3.177 38.490 . . . 1.0 . . . . . . . . . . . . A . 13 G P    . . . . . . . . . rr_2l5z 1 
       .  1 .   422 . 1 1 14 A C1'  C -42.274  -8.961 28.508 . . . 1.0 . . . . . . . . . . . . A . 14 A C1'  . . . . . . . . . rr_2l5z 1 
       .  1 .   423 . 1 1 14 A C2   C -43.974  -6.091 25.605 . . . 1.0 . . . . . . . . . . . . A . 14 A C2   . . . . . . . . . rr_2l5z 1 
       .  1 .   424 . 1 1 14 A C2'  C -40.880  -8.461 28.141 . . . 1.0 . . . . . . . . . . . . A . 14 A C2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   425 . 1 1 14 A C3'  C -40.228  -8.286 29.499 . . . 1.0 . . . . . . . . . . . . A . 14 A C3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   426 . 1 1 14 A C4   C -43.688  -7.010 27.592 . . . 1.0 . . . . . . . . . . . . A . 14 A C4   . . . . . . . . . rr_2l5z 1 
       .  1 .   427 . 1 1 14 A C4'  C -40.848  -9.417 30.322 . . . 1.0 . . . . . . . . . . . . A . 14 A C4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   428 . 1 1 14 A C5   C -44.565  -6.142 28.205 . . . 1.0 . . . . . . . . . . . . A . 14 A C5   . . . . . . . . . rr_2l5z 1 
       .  1 .   429 . 1 1 14 A C5'  C -40.913  -9.078 31.814 . . . 1.0 . . . . . . . . . . . . A . 14 A C5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   430 . 1 1 14 A C6   C -45.169  -5.184 27.383 . . . 1.0 . . . . . . . . . . . . A . 14 A C6   . . . . . . . . . rr_2l5z 1 
       .  1 .   431 . 1 1 14 A C8   C -43.855  -7.422 29.701 . . . 1.0 . . . . . . . . . . . . A . 14 A C8   . . . . . . . . . rr_2l5z 1 
       .  1 .   432 . 1 1 14 A H1'  H -42.611  -9.676 27.757 . . . 1.0 . . . . . . . . . . . . A . 14 A H1'  . . . . . . . . . rr_2l5z 1 
       .  1 .   433 . 1 1 14 A H2   H -43.755  -6.038 24.538 . . . 1.0 . . . . . . . . . . . . A . 14 A H2   . . . . . . . . . rr_2l5z 1 
       .  1 .   434 . 1 1 14 A H2'  H -40.950  -7.497 27.631 . . . 1.0 . . . . . . . . . . . . A . 14 A H2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   435 . 1 1 14 A H3'  H -40.430  -7.295 29.917 . . . 1.0 . . . . . . . . . . . . A . 14 A H3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   436 . 1 1 14 A H4'  H -40.263 -10.325 30.184 . . . 1.0 . . . . . . . . . . . . A . 14 A H4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   437 . 1 1 14 A H5'  H -41.271  -9.950 32.361 . . . 1.0 . . . . . . . . . . . . A . 14 A H5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   438 . 1 1 14 A H5'' H -39.914  -8.823 32.165 . . . 1.0 . . . . . . . . . . . . A . 14 A H5'' . . . . . . . . . rr_2l5z 1 
       .  1 .   439 . 1 1 14 A H61  H -46.445  -3.609 27.199 . . . 1.0 . . . . . . . . . . . . A . 14 A H61  . . . . . . . . . rr_2l5z 1 
       .  1 .   440 . 1 1 14 A H62  H -46.289  -4.265 28.813 . . . 1.0 . . . . . . . . . . . . A . 14 A H62  . . . . . . . . . rr_2l5z 1 
       .  1 .   441 . 1 1 14 A H8   H -43.685  -7.897 30.657 . . . 1.0 . . . . . . . . . . . . A . 14 A H8   . . . . . . . . . rr_2l5z 1 
       .  1 .   442 . 1 1 14 A HO2' H -40.264 -10.270 27.769 . . . 1.0 . . . . . . . . . . . . A . 14 A HO2' . . . . . . . . . rr_2l5z 1 
       .  1 .   443 . 1 1 14 A N1   N -44.842  -5.194 26.078 . . . 1.0 . . . . . . . . . . . . A . 14 A N1   . . . . . . . . . rr_2l5z 1 
       .  1 .   444 . 1 1 14 A N3   N -43.344  -7.041 26.291 . . . 1.0 . . . . . . . . . . . . A . 14 A N3   . . . . . . . . . rr_2l5z 1 
       .  1 .   445 . 1 1 14 A N6   N -46.038  -4.280 27.835 . . . 1.0 . . . . . . . . . . . . A . 14 A N6   . . . . . . . . . rr_2l5z 1 
       .  1 .   446 . 1 1 14 A N7   N -44.665  -6.421 29.578 . . . 1.0 . . . . . . . . . . . . A . 14 A N7   . . . . . . . . . rr_2l5z 1 
       .  1 .   447 . 1 1 14 A N9   N -43.232  -7.840 28.583 . . . 1.0 . . . . . . . . . . . . A . 14 A N9   . . . . . . . . . rr_2l5z 1 
       .  1 .   448 . 1 1 14 A O2'  O -40.175  -9.416 27.340 . . . 1.0 . . . . . . . . . . . . A . 14 A O2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   449 . 1 1 14 A O3'  O -38.828  -8.542 29.363 . . . 1.0 . . . . . . . . . . . . A . 14 A O3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   450 . 1 1 14 A O4'  O -42.157  -9.620 29.780 . . . 1.0 . . . . . . . . . . . . A . 14 A O4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   451 . 1 1 14 A O5'  O -41.791  -7.978 32.064 . . . 1.0 . . . . . . . . . . . . A . 14 A O5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   452 . 1 1 14 A OP1  O -43.548  -7.934 33.849 . . . 1.0 . . . . . . . . . . . . A . 14 A OP1  . . . . . . . . . rr_2l5z 1 
       .  1 .   453 . 1 1 14 A OP2  O -41.060  -8.012 34.459 . . . 1.0 . . . . . . . . . . . . A . 14 A OP2  . . . . . . . . . rr_2l5z 1 
       .  1 .   454 . 1 1 14 A P    P -42.148  -7.542 33.572 . . . 1.0 . . . . . . . . . . . . A . 14 A P    . . . . . . . . . rr_2l5z 1 
       .  1 .   455 . 1 1 15 A C1'  C -40.652  -5.059 25.926 . . . 1.0 . . . . . . . . . . . . A . 15 A C1'  . . . . . . . . . rr_2l5z 1 
       .  1 .   456 . 1 1 15 A C2   C -43.389  -1.607 26.312 . . . 1.0 . . . . . . . . . . . . A . 15 A C2   . . . . . . . . . rr_2l5z 1 
       .  1 .   457 . 1 1 15 A C2'  C -39.552  -4.311 25.168 . . . 1.0 . . . . . . . . . . . . A . 15 A C2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   458 . 1 1 15 A C3'  C -38.278  -5.006 25.624 . . . 1.0 . . . . . . . . . . . . A . 15 A C3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   459 . 1 1 15 A C4   C -42.026  -3.185 27.040 . . . 1.0 . . . . . . . . . . . . A . 15 A C4   . . . . . . . . . rr_2l5z 1 
       .  1 .   460 . 1 1 15 A C4'  C -38.749  -6.427 25.916 . . . 1.0 . . . . . . . . . . . . A . 15 A C4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   461 . 1 1 15 A C5   C -42.177  -2.815 28.357 . . . 1.0 . . . . . . . . . . . . A . 15 A C5   . . . . . . . . . rr_2l5z 1 
       .  1 .   462 . 1 1 15 A C5'  C -37.854  -7.131 26.937 . . . 1.0 . . . . . . . . . . . . A . 15 A C5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   463 . 1 1 15 A C6   C -43.026  -1.733 28.607 . . . 1.0 . . . . . . . . . . . . A . 15 A C6   . . . . . . . . . rr_2l5z 1 
       .  1 .   464 . 1 1 15 A C8   C -40.860  -4.441 28.345 . . . 1.0 . . . . . . . . . . . . A . 15 A C8   . . . . . . . . . rr_2l5z 1 
       .  1 .   465 . 1 1 15 A H1'  H -41.471  -5.282 25.244 . . . 1.0 . . . . . . . . . . . . A . 15 A H1'  . . . . . . . . . rr_2l5z 1 
       .  1 .   466 . 1 1 15 A H2   H -43.902  -1.088 25.502 . . . 1.0 . . . . . . . . . . . . A . 15 A H2   . . . . . . . . . rr_2l5z 1 
       .  1 .   467 . 1 1 15 A H2'  H -39.537  -3.261 25.473 . . . 1.0 . . . . . . . . . . . . A . 15 A H2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   468 . 1 1 15 A H3'  H -37.842  -4.518 26.500 . . . 1.0 . . . . . . . . . . . . A . 15 A H3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   469 . 1 1 15 A H4'  H -38.765  -7.001 24.991 . . . 1.0 . . . . . . . . . . . . A . 15 A H4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   470 . 1 1 15 A H5'  H -38.175  -8.168 27.035 . . . 1.0 . . . . . . . . . . . . A . 15 A H5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   471 . 1 1 15 A H5'' H -36.824  -7.109 26.582 . . . 1.0 . . . . . . . . . . . . A . 15 A H5'' . . . . . . . . . rr_2l5z 1 
       .  1 .   472 . 1 1 15 A H61  H -43.893  -0.479 29.956 . . . 1.0 . . . . . . . . . . . . A . 15 A H61  . . . . . . . . . rr_2l5z 1 
       .  1 .   473 . 1 1 15 A H62  H -42.832  -1.695 30.633 . . . 1.0 . . . . . . . . . . . . A . 15 A H62  . . . . . . . . . rr_2l5z 1 
       .  1 .   474 . 1 1 15 A H8   H -40.188  -5.227 28.658 . . . 1.0 . . . . . . . . . . . . A . 15 A H8   . . . . . . . . . rr_2l5z 1 
       .  1 .   475 . 1 1 15 A HO2' H -40.395  -5.099 23.600 . . . 1.0 . . . . . . . . . . . . A . 15 A HO2' . . . . . . . . . rr_2l5z 1 
       .  1 .   476 . 1 1 15 A N1   N -43.618  -1.152 27.547 . . . 1.0 . . . . . . . . . . . . A . 15 A N1   . . . . . . . . . rr_2l5z 1 
       .  1 .   477 . 1 1 15 A N3   N -42.605  -2.622 25.962 . . . 1.0 . . . . . . . . . . . . A . 15 A N3   . . . . . . . . . rr_2l5z 1 
       .  1 .   478 . 1 1 15 A N6   N -43.270  -1.264 29.831 . . . 1.0 . . . . . . . . . . . . A . 15 A N6   . . . . . . . . . rr_2l5z 1 
       .  1 .   479 . 1 1 15 A N7   N -41.411  -3.641 29.198 . . . 1.0 . . . . . . . . . . . . A . 15 A N7   . . . . . . . . . rr_2l5z 1 
       .  1 .   480 . 1 1 15 A N9   N -41.163  -4.250 27.048 . . . 1.0 . . . . . . . . . . . . A . 15 A N9   . . . . . . . . . rr_2l5z 1 
       .  1 .   481 . 1 1 15 A O2'  O -39.729  -4.425 23.751 . . . 1.0 . . . . . . . . . . . . A . 15 A O2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   482 . 1 1 15 A O3'  O -37.370  -5.051 24.520 . . . 1.0 . . . . . . . . . . . . A . 15 A O3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   483 . 1 1 15 A O4'  O -40.082  -6.290 26.402 . . . 1.0 . . . . . . . . . . . . A . 15 A O4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   484 . 1 1 15 A O5'  O -37.920  -6.497 28.218 . . . 1.0 . . . . . . . . . . . . A . 15 A O5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   485 . 1 1 15 A OP1  O -36.403  -7.954 29.580 . . . 1.0 . . . . . . . . . . . . A . 15 A OP1  . . . . . . . . . rr_2l5z 1 
       .  1 .   486 . 1 1 15 A OP2  O -38.204  -6.522 30.707 . . . 1.0 . . . . . . . . . . . . A . 15 A OP2  . . . . . . . . . rr_2l5z 1 
       .  1 .   487 . 1 1 15 A P    P -37.757  -7.357 29.570 . . . 1.0 . . . . . . . . . . . . A . 15 A P    . . . . . . . . . rr_2l5z 1 
       .  1 .   488 . 1 1 16 A C1'  C -39.668  -0.629 24.955 . . . 1.0 . . . . . . . . . . . . A . 16 A C1'  . . . . . . . . . rr_2l5z 1 
       .  1 .   489 . 1 1 16 A C2   C -40.941   0.466 29.046 . . . 1.0 . . . . . . . . . . . . A . 16 A C2   . . . . . . . . . rr_2l5z 1 
       .  1 .   490 . 1 1 16 A C2'  C -39.038   0.574 24.260 . . . 1.0 . . . . . . . . . . . . A . 16 A C2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   491 . 1 1 16 A C3'  C -37.918  -0.058 23.456 . . . 1.0 . . . . . . . . . . . . A . 16 A C3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   492 . 1 1 16 A C4   C -39.611  -0.421 27.523 . . . 1.0 . . . . . . . . . . . . A . 16 A C4   . . . . . . . . . rr_2l5z 1 
       .  1 .   493 . 1 1 16 A C4'  C -38.495  -1.425 23.079 . . . 1.0 . . . . . . . . . . . . A . 16 A C4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   494 . 1 1 16 A C5   C -38.703  -0.860 28.460 . . . 1.0 . . . . . . . . . . . . A . 16 A C5   . . . . . . . . . rr_2l5z 1 
       .  1 .   495 . 1 1 16 A C5'  C -37.406  -2.488 22.909 . . . 1.0 . . . . . . . . . . . . A . 16 A C5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   496 . 1 1 16 A C6   C -39.002  -0.577 29.797 . . . 1.0 . . . . . . . . . . . . A . 16 A C6   . . . . . . . . . rr_2l5z 1 
       .  1 .   497 . 1 1 16 A C8   C -37.958  -1.443 26.594 . . . 1.0 . . . . . . . . . . . . A . 16 A C8   . . . . . . . . . rr_2l5z 1 
       .  1 .   498 . 1 1 16 A H1'  H -40.745  -0.482 25.026 . . . 1.0 . . . . . . . . . . . . A . 16 A H1'  . . . . . . . . . rr_2l5z 1 
       .  1 .   499 . 1 1 16 A H2   H -41.846   1.006 29.324 . . . 1.0 . . . . . . . . . . . . A . 16 A H2   . . . . . . . . . rr_2l5z 1 
       .  1 .   500 . 1 1 16 A H2'  H -38.625   1.263 25.002 . . . 1.0 . . . . . . . . . . . . A . 16 A H2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   501 . 1 1 16 A H3'  H -36.996  -0.131 24.041 . . . 1.0 . . . . . . . . . . . . A . 16 A H3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   502 . 1 1 16 A H4'  H -39.056  -1.334 22.150 . . . 1.0 . . . . . . . . . . . . A . 16 A H4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   503 . 1 1 16 A H5'  H -37.872  -3.433 22.628 . . . 1.0 . . . . . . . . . . . . A . 16 A H5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   504 . 1 1 16 A H5'' H -36.726  -2.177 22.117 . . . 1.0 . . . . . . . . . . . . A . 16 A H5'' . . . . . . . . . rr_2l5z 1 
       .  1 .   505 . 1 1 16 A H61  H -38.482  -0.715 31.760 . . . 1.0 . . . . . . . . . . . . A . 16 A H61  . . . . . . . . . rr_2l5z 1 
       .  1 .   506 . 1 1 16 A H62  H -37.365  -1.452 30.634 . . . 1.0 . . . . . . . . . . . . A . 16 A H62  . . . . . . . . . rr_2l5z 1 
       .  1 .   507 . 1 1 16 A H8   H -37.337  -1.864 25.818 . . . 1.0 . . . . . . . . . . . . A . 16 A H8   . . . . . . . . . rr_2l5z 1 
       .  1 .   508 . 1 1 16 A HO2' H -40.404   1.924 23.937 . . . 1.0 . . . . . . . . . . . . A . 16 A HO2' . . . . . . . . . rr_2l5z 1 
       .  1 .   509 . 1 1 16 A N1   N -40.141   0.094 30.048 . . . 1.0 . . . . . . . . . . . . A . 16 A N1   . . . . . . . . . rr_2l5z 1 
       .  1 .   510 . 1 1 16 A N3   N -40.757   0.250 27.747 . . . 1.0 . . . . . . . . . . . . A . 16 A N3   . . . . . . . . . rr_2l5z 1 
       .  1 .   511 . 1 1 16 A N6   N -38.220  -0.944 30.812 . . . 1.0 . . . . . . . . . . . . A . 16 A N6   . . . . . . . . . rr_2l5z 1 
       .  1 .   512 . 1 1 16 A N7   N -37.630  -1.524 27.842 . . . 1.0 . . . . . . . . . . . . A . 16 A N7   . . . . . . . . . rr_2l5z 1 
       .  1 .   513 . 1 1 16 A N9   N -39.110  -0.811 26.309 . . . 1.0 . . . . . . . . . . . . A . 16 A N9   . . . . . . . . . rr_2l5z 1 
       .  1 .   514 . 1 1 16 A O2'  O -39.980   1.242 23.411 . . . 1.0 . . . . . . . . . . . . A . 16 A O2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   515 . 1 1 16 A O3'  O -37.741   0.702 22.257 . . . 1.0 . . . . . . . . . . . . A . 16 A O3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   516 . 1 1 16 A O4'  O -39.397  -1.774 24.133 . . . 1.0 . . . . . . . . . . . . A . 16 A O4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   517 . 1 1 16 A O5'  O -36.662  -2.673 24.118 . . . 1.0 . . . . . . . . . . . . A . 16 A O5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   518 . 1 1 16 A OP1  O -35.188  -4.563 23.389 . . . 1.0 . . . . . . . . . . . . A . 16 A OP1  . . . . . . . . . rr_2l5z 1 
       .  1 .   519 . 1 1 16 A OP2  O -35.521  -4.045 25.876 . . . 1.0 . . . . . . . . . . . . A . 16 A OP2  . . . . . . . . . rr_2l5z 1 
       .  1 .   520 . 1 1 16 A P    P -36.059  -4.116 24.500 . . . 1.0 . . . . . . . . . . . . A . 16 A P    . . . . . . . . . rr_2l5z 1 
       .  1 .   521 . 1 1 17 G C1'  C -36.921   2.525 26.918 . . . 1.0 . . . . . . . . . . . . A . 17 G C1'  . . . . . . . . . rr_2l5z 1 
       .  1 .   522 . 1 1 17 G C2   C -37.643   1.728 31.213 . . . 1.0 . . . . . . . . . . . . A . 17 G C2   . . . . . . . . . rr_2l5z 1 
       .  1 .   523 . 1 1 17 G C2'  C -36.389   3.955 26.874 . . . 1.0 . . . . . . . . . . . . A . 17 G C2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   524 . 1 1 17 G C3'  C -35.336   3.871 25.786 . . . 1.0 . . . . . . . . . . . . A . 17 G C3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   525 . 1 1 17 G C4   C -36.543   1.567 29.279 . . . 1.0 . . . . . . . . . . . . A . 17 G C4   . . . . . . . . . rr_2l5z 1 
       .  1 .   526 . 1 1 17 G C4'  C -35.954   2.879 24.807 . . . 1.0 . . . . . . . . . . . . A . 17 G C4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   527 . 1 1 17 G C5   C -35.541   0.758 29.796 . . . 1.0 . . . . . . . . . . . . A . 17 G C5   . . . . . . . . . rr_2l5z 1 
       .  1 .   528 . 1 1 17 G C5'  C -34.892   2.157 23.975 . . . 1.0 . . . . . . . . . . . . A . 17 G C5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   529 . 1 1 17 G C6   C -35.580   0.387 31.166 . . . 1.0 . . . . . . . . . . . . A . 17 G C6   . . . . . . . . . rr_2l5z 1 
       .  1 .   530 . 1 1 17 G C8   C -35.090   1.049 27.773 . . . 1.0 . . . . . . . . . . . . A . 17 G C8   . . . . . . . . . rr_2l5z 1 
       .  1 .   531 . 1 1 17 G H1   H -36.781   0.704 32.816 . . . 1.0 . . . . . . . . . . . . A . 17 G H1   . . . . . . . . . rr_2l5z 1 
       .  1 .   532 . 1 1 17 G H1'  H -37.990   2.542 27.130 . . . 1.0 . . . . . . . . . . . . A . 17 G H1'  . . . . . . . . . rr_2l5z 1 
       .  1 .   533 . 1 1 17 G H2'  H -35.923   4.210 27.829 . . . 1.0 . . . . . . . . . . . . A . 17 G H2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   534 . 1 1 17 G H21  H -38.655   1.877 32.972 . . . 1.0 . . . . . . . . . . . . A . 17 G H21  . . . . . . . . . rr_2l5z 1 
       .  1 .   535 . 1 1 17 G H22  H -39.367   2.730 31.622 . . . 1.0 . . . . . . . . . . . . A . 17 G H22  . . . . . . . . . rr_2l5z 1 
       .  1 .   536 . 1 1 17 G H3'  H -34.375   3.532 26.181 . . . 1.0 . . . . . . . . . . . . A . 17 G H3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   537 . 1 1 17 G H4'  H -36.639   3.404 24.143 . . . 1.0 . . . . . . . . . . . . A . 17 G H4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   538 . 1 1 17 G H5'  H -34.441   2.867 23.282 . . . 1.0 . . . . . . . . . . . . A . 17 G H5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   539 . 1 1 17 G H5'' H -34.121   1.771 24.641 . . . 1.0 . . . . . . . . . . . . A . 17 G H5'' . . . . . . . . . rr_2l5z 1 
       .  1 .   540 . 1 1 17 G H8   H -34.602   1.012 26.811 . . . 1.0 . . . . . . . . . . . . A . 17 G H8   . . . . . . . . . rr_2l5z 1 
       .  1 .   541 . 1 1 17 G HO2' H -37.700   4.697 25.641 . . . 1.0 . . . . . . . . . . . . A . 17 G HO2' . . . . . . . . . rr_2l5z 1 
       .  1 .   542 . 1 1 17 G N1   N -36.687   0.928 31.808 . . . 1.0 . . . . . . . . . . . . A . 17 G N1   . . . . . . . . . rr_2l5z 1 
       .  1 .   543 . 1 1 17 G N2   N -38.635   2.146 31.999 . . . 1.0 . . . . . . . . . . . . A . 17 G N2   . . . . . . . . . rr_2l5z 1 
       .  1 .   544 . 1 1 17 G N3   N -37.614   2.083 29.924 . . . 1.0 . . . . . . . . . . . . A . 17 G N3   . . . . . . . . . rr_2l5z 1 
       .  1 .   545 . 1 1 17 G N7   N -34.606   0.432 28.800 . . . 1.0 . . . . . . . . . . . . A . 17 G N7   . . . . . . . . . rr_2l5z 1 
       .  1 .   546 . 1 1 17 G N9   N -36.227   1.743 27.958 . . . 1.0 . . . . . . . . . . . . A . 17 G N9   . . . . . . . . . rr_2l5z 1 
       .  1 .   547 . 1 1 17 G O2'  O -37.420   4.890 26.539 . . . 1.0 . . . . . . . . . . . . A . 17 G O2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   548 . 1 1 17 G O3'  O -35.241   5.147 25.146 . . . 1.0 . . . . . . . . . . . . A . 17 G O3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   549 . 1 1 17 G O4'  O -36.699   1.961 25.614 . . . 1.0 . . . . . . . . . . . . A . 17 G O4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   550 . 1 1 17 G O5'  O -35.454   1.072 23.232 . . . 1.0 . . . . . . . . . . . . A . 17 G O5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   551 . 1 1 17 G O6   O -34.788  -0.316 31.790 . . . 1.0 . . . . . . . . . . . . A . 17 G O6   . . . . . . . . . rr_2l5z 1 
       .  1 .   552 . 1 1 17 G OP1  O -36.488   2.814 21.761 . . . 1.0 . . . . . . . . . . . . A . 17 G OP1  . . . . . . . . . rr_2l5z 1 
       .  1 .   553 . 1 1 17 G OP2  O -35.713   0.573 20.791 . . . 1.0 . . . . . . . . . . . . A . 17 G OP2  . . . . . . . . . rr_2l5z 1 
       .  1 .   554 . 1 1 17 G P    P -36.311   1.352 21.899 . . . 1.0 . . . . . . . . . . . . A . 17 G P    . . . . . . . . . rr_2l5z 1 
       .  1 .   555 . 1 1 18 U C1'  C -36.181   7.014 30.258 . . . 1.0 . . . . . . . . . . . . A . 18 U C1'  . . . . . . . . . rr_2l5z 1 
       .  1 .   556 . 1 1 18 U C2   C -35.121   5.694 32.059 . . . 1.0 . . . . . . . . . . . . A . 18 U C2   . . . . . . . . . rr_2l5z 1 
       .  1 .   557 . 1 1 18 U C2'  C -35.680   8.439 30.506 . . . 1.0 . . . . . . . . . . . . A . 18 U C2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   558 . 1 1 18 U C3'  C -35.150   8.845 29.143 . . . 1.0 . . . . . . . . . . . . A . 18 U C3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   559 . 1 1 18 U C4   C -33.268   4.138 31.576 . . . 1.0 . . . . . . . . . . . . A . 18 U C4   . . . . . . . . . rr_2l5z 1 
       .  1 .   560 . 1 1 18 U C4'  C -36.100   8.130 28.195 . . . 1.0 . . . . . . . . . . . . A . 18 U C4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   561 . 1 1 18 U C5   C -33.395   4.532 30.191 . . . 1.0 . . . . . . . . . . . . A . 18 U C5   . . . . . . . . . rr_2l5z 1 
       .  1 .   562 . 1 1 18 U C5'  C -35.471   7.898 26.820 . . . 1.0 . . . . . . . . . . . . A . 18 U C5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   563 . 1 1 18 U C6   C -34.324   5.440 29.807 . . . 1.0 . . . . . . . . . . . . A . 18 U C6   . . . . . . . . . rr_2l5z 1 
       .  1 .   564 . 1 1 18 U H1'  H -37.126   6.862 30.786 . . . 1.0 . . . . . . . . . . . . A . 18 U H1'  . . . . . . . . . rr_2l5z 1 
       .  1 .   565 . 1 1 18 U H2'  H -34.867   8.428 31.237 . . . 1.0 . . . . . . . . . . . . A . 18 U H2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   566 . 1 1 18 U H3   H -34.113   4.513 33.433 . . . 1.0 . . . . . . . . . . . . A . 18 U H3   . . . . . . . . . rr_2l5z 1 
       .  1 .   567 . 1 1 18 U H3'  H -34.111   8.536 29.005 . . . 1.0 . . . . . . . . . . . . A . 18 U H3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   568 . 1 1 18 U H4'  H -37.011   8.716 28.083 . . . 1.0 . . . . . . . . . . . . A . 18 U H4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   569 . 1 1 18 U H5   H -32.739   4.097 29.451 . . . 1.0 . . . . . . . . . . . . A . 18 U H5   . . . . . . . . . rr_2l5z 1 
       .  1 .   570 . 1 1 18 U H5'  H -36.256   7.643 26.109 . . . 1.0 . . . . . . . . . . . . A . 18 U H5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   571 . 1 1 18 U H5'' H -34.978   8.814 26.494 . . . 1.0 . . . . . . . . . . . . A . 18 U H5'' . . . . . . . . . rr_2l5z 1 
       .  1 .   572 . 1 1 18 U H6   H -34.389   5.721 28.767 . . . 1.0 . . . . . . . . . . . . A . 18 U H6   . . . . . . . . . rr_2l5z 1 
       .  1 .   573 . 1 1 18 U HO2' H -37.268   8.811 31.570 . . . 1.0 . . . . . . . . . . . . A . 18 U HO2' . . . . . . . . . rr_2l5z 1 
       .  1 .   574 . 1 1 18 U N1   N -35.176   6.016 30.708 . . . 1.0 . . . . . . . . . . . . A . 18 U N1   . . . . . . . . . rr_2l5z 1 
       .  1 .   575 . 1 1 18 U N3   N -34.164   4.765 32.425 . . . 1.0 . . . . . . . . . . . . A . 18 U N3   . . . . . . . . . rr_2l5z 1 
       .  1 .   576 . 1 1 18 U O2   O -35.878   6.203 32.883 . . . 1.0 . . . . . . . . . . . . A . 18 U O2   . . . . . . . . . rr_2l5z 1 
       .  1 .   577 . 1 1 18 U O2'  O -36.741   9.300 30.934 . . . 1.0 . . . . . . . . . . . . A . 18 U O2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   578 . 1 1 18 U O3'  O -35.324  10.255 28.985 . . . 1.0 . . . . . . . . . . . . A . 18 U O3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   579 . 1 1 18 U O4   O -32.456   3.326 32.011 . . . 1.0 . . . . . . . . . . . . A . 18 U O4   . . . . . . . . . rr_2l5z 1 
       .  1 .   580 . 1 1 18 U O4'  O -36.414   6.897 28.842 . . . 1.0 . . . . . . . . . . . . A . 18 U O4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   581 . 1 1 18 U O5'  O -34.511   6.839 26.853 . . . 1.0 . . . . . . . . . . . . A . 18 U O5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   582 . 1 1 18 U OP1  O -33.959   7.177 24.433 . . . 1.0 . . . . . . . . . . . . A . 18 U OP1  . . . . . . . . . rr_2l5z 1 
       .  1 .   583 . 1 1 18 U OP2  O -32.827   5.320 25.790 . . . 1.0 . . . . . . . . . . . . A . 18 U OP2  . . . . . . . . . rr_2l5z 1 
       .  1 .   584 . 1 1 18 U P    P -34.022   6.140 25.488 . . . 1.0 . . . . . . . . . . . . A . 18 U P    . . . . . . . . . rr_2l5z 1 
       .  1 .   585 . 1 1 19 G C1'  C -33.976   9.770 34.430 . . . 1.0 . . . . . . . . . . . . A . 19 G C1'  . . . . . . . . . rr_2l5z 1 
       .  1 .   586 . 1 1 19 G C2   C -31.978   6.631 36.824 . . . 1.0 . . . . . . . . . . . . A . 19 G C2   . . . . . . . . . rr_2l5z 1 
       .  1 .   587 . 1 1 19 G C2'  C -33.252  11.083 34.752 . . . 1.0 . . . . . . . . . . . . A . 19 G C2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   588 . 1 1 19 G C3'  C -33.516  11.935 33.519 . . . 1.0 . . . . . . . . . . . . A . 19 G C3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   589 . 1 1 19 G C4   C -32.447   7.768 34.963 . . . 1.0 . . . . . . . . . . . . A . 19 G C4   . . . . . . . . . rr_2l5z 1 
       .  1 .   590 . 1 1 19 G C4'  C -34.865  11.422 33.044 . . . 1.0 . . . . . . . . . . . . A . 19 G C4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   591 . 1 1 19 G C5   C -31.604   7.010 34.163 . . . 1.0 . . . . . . . . . . . . A . 19 G C5   . . . . . . . . . rr_2l5z 1 
       .  1 .   592 . 1 1 19 G C5'  C -35.095  11.713 31.562 . . . 1.0 . . . . . . . . . . . . A . 19 G C5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   593 . 1 1 19 G C6   C -30.863   5.945 34.740 . . . 1.0 . . . . . . . . . . . . A . 19 G C6   . . . . . . . . . rr_2l5z 1 
       .  1 .   594 . 1 1 19 G C8   C -32.482   8.447 32.916 . . . 1.0 . . . . . . . . . . . . A . 19 G C8   . . . . . . . . . rr_2l5z 1 
       .  1 .   595 . 1 1 19 G H1   H -30.610   5.068 36.596 . . . 1.0 . . . . . . . . . . . . A . 19 G H1   . . . . . . . . . rr_2l5z 1 
       .  1 .   596 . 1 1 19 G H1'  H -34.582   9.474 35.286 . . . 1.0 . . . . . . . . . . . . A . 19 G H1'  . . . . . . . . . rr_2l5z 1 
       .  1 .   597 . 1 1 19 G H2'  H -32.179  10.901 34.858 . . . 1.0 . . . . . . . . . . . . A . 19 G H2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   598 . 1 1 19 G H21  H -31.557   5.598 38.528 . . . 1.0 . . . . . . . . . . . . A . 19 G H21  . . . . . . . . . rr_2l5z 1 
       .  1 .   599 . 1 1 19 G H22  H -32.702   6.909 38.707 . . . 1.0 . . . . . . . . . . . . A . 19 G H22  . . . . . . . . . rr_2l5z 1 
       .  1 .   600 . 1 1 19 G H3'  H -32.735  11.812 32.766 . . . 1.0 . . . . . . . . . . . . A . 19 G H3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   601 . 1 1 19 G H4'  H -35.659  11.880 33.633 . . . 1.0 . . . . . . . . . . . . A . 19 G H4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   602 . 1 1 19 G H5'  H -35.957  11.141 31.217 . . . 1.0 . . . . . . . . . . . . A . 19 G H5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   603 . 1 1 19 G H5'' H -35.300  12.776 31.435 . . . 1.0 . . . . . . . . . . . . A . 19 G H5'' . . . . . . . . . rr_2l5z 1 
       .  1 .   604 . 1 1 19 G H8   H -32.749   9.036 32.051 . . . 1.0 . . . . . . . . . . . . A . 19 G H8   . . . . . . . . . rr_2l5z 1 
       .  1 .   605 . 1 1 19 G HO2' H -34.629  11.280 36.114 . . . 1.0 . . . . . . . . . . . . A . 19 G HO2' . . . . . . . . . rr_2l5z 1 
       .  1 .   606 . 1 1 19 G N1   N -31.118   5.827 36.102 . . . 1.0 . . . . . . . . . . . . A . 19 G N1   . . . . . . . . . rr_2l5z 1 
       .  1 .   607 . 1 1 19 G N2   N -32.088   6.357 38.125 . . . 1.0 . . . . . . . . . . . . A . 19 G N2   . . . . . . . . . rr_2l5z 1 
       .  1 .   608 . 1 1 19 G N3   N -32.680   7.636 36.289 . . . 1.0 . . . . . . . . . . . . A . 19 G N3   . . . . . . . . . rr_2l5z 1 
       .  1 .   609 . 1 1 19 G N7   N -31.642   7.468 32.834 . . . 1.0 . . . . . . . . . . . . A . 19 G N7   . . . . . . . . . rr_2l5z 1 
       .  1 .   610 . 1 1 19 G N9   N -33.008   8.699 34.128 . . . 1.0 . . . . . . . . . . . . A . 19 G N9   . . . . . . . . . rr_2l5z 1 
       .  1 .   611 . 1 1 19 G O2'  O -33.782  11.695 35.933 . . . 1.0 . . . . . . . . . . . . A . 19 G O2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   612 . 1 1 19 G O3'  O -33.666  13.297 33.929 . . . 1.0 . . . . . . . . . . . . A . 19 G O3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   613 . 1 1 19 G O4'  O -34.835  10.023 33.307 . . . 1.0 . . . . . . . . . . . . A . 19 G O4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   614 . 1 1 19 G O5'  O -33.956  11.361 30.773 . . . 1.0 . . . . . . . . . . . . A . 19 G O5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   615 . 1 1 19 G O6   O -30.078   5.175 34.191 . . . 1.0 . . . . . . . . . . . . A . 19 G O6   . . . . . . . . . rr_2l5z 1 
       .  1 .   616 . 1 1 19 G OP1  O -34.467  12.584 28.649 . . . 1.0 . . . . . . . . . . . . A . 19 G OP1  . . . . . . . . . rr_2l5z 1 
       .  1 .   617 . 1 1 19 G OP2  O -32.863  10.586 28.658 . . . 1.0 . . . . . . . . . . . . A . 19 G OP2  . . . . . . . . . rr_2l5z 1 
       .  1 .   618 . 1 1 19 G P    P -34.078  11.256 29.173 . . . 1.0 . . . . . . . . . . . . A . 19 G P    . . . . . . . . . rr_2l5z 1 
       .  1 .   619 . 1 1 20 A C1'  C -30.681  11.709 38.094 . . . 1.0 . . . . . . . . . . . . A . 20 A C1'  . . . . . . . . . rr_2l5z 1 
       .  1 .   620 . 1 1 20 A C2   C -27.715   8.527 38.845 . . . 1.0 . . . . . . . . . . . . A . 20 A C2   . . . . . . . . . rr_2l5z 1 
       .  1 .   621 . 1 1 20 A C2'  C -30.035  12.969 38.686 . . . 1.0 . . . . . . . . . . . . A . 20 A C2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   622 . 1 1 20 A C3'  C -30.757  14.107 37.971 . . . 1.0 . . . . . . . . . . . . A . 20 A C3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   623 . 1 1 20 A C4   C -28.834   9.981 37.618 . . . 1.0 . . . . . . . . . . . . A . 20 A C4   . . . . . . . . . rr_2l5z 1 
       .  1 .   624 . 1 1 20 A C4'  C -32.103  13.491 37.624 . . . 1.0 . . . . . . . . . . . . A . 20 A C4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   625 . 1 1 20 A C5   C -28.175   9.630 36.462 . . . 1.0 . . . . . . . . . . . . A . 20 A C5   . . . . . . . . . rr_2l5z 1 
       .  1 .   626 . 1 1 20 A C5'  C -32.771  14.201 36.447 . . . 1.0 . . . . . . . . . . . . A . 20 A C5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   627 . 1 1 20 A C6   C -27.205   8.627 36.577 . . . 1.0 . . . . . . . . . . . . A . 20 A C6   . . . . . . . . . rr_2l5z 1 
       .  1 .   628 . 1 1 20 A C8   C -29.532  11.136 35.940 . . . 1.0 . . . . . . . . . . . . A . 20 A C8   . . . . . . . . . rr_2l5z 1 
       .  1 .   629 . 1 1 20 A H1'  H -31.024  11.067 38.905 . . . 1.0 . . . . . . . . . . . . A . 20 A H1'  . . . . . . . . . rr_2l5z 1 
       .  1 .   630 . 1 1 20 A H2   H -27.500   8.054 39.801 . . . 1.0 . . . . . . . . . . . . A . 20 A H2   . . . . . . . . . rr_2l5z 1 
       .  1 .   631 . 1 1 20 A H2'  H -28.967  12.989 38.445 . . . 1.0 . . . . . . . . . . . . A . 20 A H2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   632 . 1 1 20 A H3'  H -30.210  14.443 37.085 . . . 1.0 . . . . . . . . . . . . A . 20 A H3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   633 . 1 1 20 A H4'  H -32.758  13.530 38.493 . . . 1.0 . . . . . . . . . . . . A . 20 A H4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   634 . 1 1 20 A H5'  H -33.640  13.622 36.130 . . . 1.0 . . . . . . . . . . . . A . 20 A H5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   635 . 1 1 20 A H5'' H -33.100  15.189 36.768 . . . 1.0 . . . . . . . . . . . . A . 20 A H5'' . . . . . . . . . rr_2l5z 1 
       .  1 .   636 . 1 1 20 A H61  H -25.798   7.459 35.685 . . . 1.0 . . . . . . . . . . . . A . 20 A H61  . . . . . . . . . rr_2l5z 1 
       .  1 .   637 . 1 1 20 A H62  H -26.628   8.578 34.626 . . . 1.0 . . . . . . . . . . . . A . 20 A H62  . . . . . . . . . rr_2l5z 1 
       .  1 .   638 . 1 1 20 A H8   H -30.101  11.862 35.379 . . . 1.0 . . . . . . . . . . . . A . 20 A H8   . . . . . . . . . rr_2l5z 1 
       .  1 .   639 . 1 1 20 A HO2' H -30.750  12.266 40.355 . . . 1.0 . . . . . . . . . . . . A . 20 A HO2' . . . . . . . . . rr_2l5z 1 
       .  1 .   640 . 1 1 20 A N1   N -27.005   8.098 37.798 . . . 1.0 . . . . . . . . . . . . A . 20 A N1   . . . . . . . . . rr_2l5z 1 
       .  1 .   641 . 1 1 20 A N3   N -28.653   9.468 38.849 . . . 1.0 . . . . . . . . . . . . A . 20 A N3   . . . . . . . . . rr_2l5z 1 
       .  1 .   642 . 1 1 20 A N6   N -26.486   8.186 35.546 . . . 1.0 . . . . . . . . . . . . A . 20 A N6   . . . . . . . . . rr_2l5z 1 
       .  1 .   643 . 1 1 20 A N7   N -28.639  10.390 35.374 . . . 1.0 . . . . . . . . . . . . A . 20 A N7   . . . . . . . . . rr_2l5z 1 
       .  1 .   644 . 1 1 20 A N9   N -29.717  10.965 37.262 . . . 1.0 . . . . . . . . . . . . A . 20 A N9   . . . . . . . . . rr_2l5z 1 
       .  1 .   645 . 1 1 20 A O2'  O -30.236  13.036 40.102 . . . 1.0 . . . . . . . . . . . . A . 20 A O2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   646 . 1 1 20 A O3'  O -30.973  15.166 38.908 . . . 1.0 . . . . . . . . . . . . A . 20 A O3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   647 . 1 1 20 A O4'  O -31.812  12.133 37.319 . . . 1.0 . . . . . . . . . . . . A . 20 A O4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   648 . 1 1 20 A O5'  O -31.873  14.344 35.341 . . . 1.0 . . . . . . . . . . . . A . 20 A O5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   649 . 1 1 20 A OP1  O -32.957  15.663 33.509 . . . 1.0 . . . . . . . . . . . . A . 20 A OP1  . . . . . . . . . rr_2l5z 1 
       .  1 .   650 . 1 1 20 A OP2  O -31.389  13.711 32.967 . . . 1.0 . . . . . . . . . . . . A . 20 A OP2  . . . . . . . . . rr_2l5z 1 
       .  1 .   651 . 1 1 20 A P    P -32.426  14.320 33.829 . . . 1.0 . . . . . . . . . . . . A . 20 A P    . . . . . . . . . rr_2l5z 1 
       .  1 .   652 . 1 1 21 C C1'  C -25.127  13.377 38.428 . . . 1.0 . . . . . . . . . . . . A . 21 C C1'  . . . . . . . . . rr_2l5z 1 
       .  1 .   653 . 1 1 21 C C2   C -23.964  11.594 37.210 . . . 1.0 . . . . . . . . . . . . A . 21 C C2   . . . . . . . . . rr_2l5z 1 
       .  1 .   654 . 1 1 21 C C2'  C -24.159  14.537 38.158 . . . 1.0 . . . . . . . . . . . . A . 21 C C2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   655 . 1 1 21 C C3'  C -25.086  15.722 37.919 . . . 1.0 . . . . . . . . . . . . A . 21 C C3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   656 . 1 1 21 C C4   C -24.907  10.599 35.304 . . . 1.0 . . . . . . . . . . . . A . 21 C C4   . . . . . . . . . rr_2l5z 1 
       .  1 .   657 . 1 1 21 C C4'  C -26.318  15.355 38.727 . . . 1.0 . . . . . . . . . . . . A . 21 C C4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   658 . 1 1 21 C C5   C -26.070  11.426 35.411 . . . 1.0 . . . . . . . . . . . . A . 21 C C5   . . . . . . . . . rr_2l5z 1 
       .  1 .   659 . 1 1 21 C C5'  C -27.570  16.081 38.232 . . . 1.0 . . . . . . . . . . . . A . 21 C C5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   660 . 1 1 21 C C6   C -26.120  12.309 36.428 . . . 1.0 . . . . . . . . . . . . A . 21 C C6   . . . . . . . . . rr_2l5z 1 
       .  1 .   661 . 1 1 21 C H1'  H -24.844  12.879 39.357 . . . 1.0 . . . . . . . . . . . . A . 21 C H1'  . . . . . . . . . rr_2l5z 1 
       .  1 .   662 . 1 1 21 C H2'  H -23.573  14.332 37.257 . . . 1.0 . . . . . . . . . . . . A . 21 C H2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   663 . 1 1 21 C H3'  H -25.313  15.856 36.858 . . . 1.0 . . . . . . . . . . . . A . 21 C H3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   664 . 1 1 21 C H4'  H -26.150  15.591 39.777 . . . 1.0 . . . . . . . . . . . . A . 21 C H4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   665 . 1 1 21 C H41  H -23.996   9.128 34.233 . . . 1.0 . . . . . . . . . . . . A . 21 C H41  . . . . . . . . . rr_2l5z 1 
       .  1 .   666 . 1 1 21 C H42  H -25.563   9.629 33.639 . . . 1.0 . . . . . . . . . . . . A . 21 C H42  . . . . . . . . . rr_2l5z 1 
       .  1 .   667 . 1 1 21 C H5   H -26.879  11.344 34.701 . . . 1.0 . . . . . . . . . . . . A . 21 C H5   . . . . . . . . . rr_2l5z 1 
       .  1 .   668 . 1 1 21 C H5'  H -27.331  17.130 38.048 . . . 1.0 . . . . . . . . . . . . A . 21 C H5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   669 . 1 1 21 C H5'' H -27.903  15.623 37.301 . . . 1.0 . . . . . . . . . . . . A . 21 C H5'' . . . . . . . . . rr_2l5z 1 
       .  1 .   670 . 1 1 21 C H6   H -26.984  12.949 36.539 . . . 1.0 . . . . . . . . . . . . A . 21 C H6   . . . . . . . . . rr_2l5z 1 
       .  1 .   671 . 1 1 21 C HO2' H -23.422  14.037 39.890 . . . 1.0 . . . . . . . . . . . . A . 21 C HO2' . . . . . . . . . rr_2l5z 1 
       .  1 .   672 . 1 1 21 C N1   N -25.090  12.400 37.319 . . . 1.0 . . . . . . . . . . . . A . 21 C N1   . . . . . . . . . rr_2l5z 1 
       .  1 .   673 . 1 1 21 C N3   N -23.906  10.701 36.186 . . . 1.0 . . . . . . . . . . . . A . 21 C N3   . . . . . . . . . rr_2l5z 1 
       .  1 .   674 . 1 1 21 C N4   N -24.815   9.714 34.312 . . . 1.0 . . . . . . . . . . . . A . 21 C N4   . . . . . . . . . rr_2l5z 1 
       .  1 .   675 . 1 1 21 C O2   O -23.048  11.695 38.027 . . . 1.0 . . . . . . . . . . . . A . 21 C O2   . . . . . . . . . rr_2l5z 1 
       .  1 .   676 . 1 1 21 C O2'  O -23.299  14.768 39.280 . . . 1.0 . . . . . . . . . . . . A . 21 C O2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   677 . 1 1 21 C O3'  O -24.492  16.887 38.497 . . . 1.0 . . . . . . . . . . . . A . 21 C O3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   678 . 1 1 21 C O4'  O -26.437  13.945 38.578 . . . 1.0 . . . . . . . . . . . . A . 21 C O4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   679 . 1 1 21 C O5'  O -28.627  16.009 39.192 . . . 1.0 . . . . . . . . . . . . A . 21 C O5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   680 . 1 1 21 C OP1  O -30.564  17.432 39.894 . . . 1.0 . . . . . . . . . . . . A . 21 C OP1  . . . . . . . . . rr_2l5z 1 
       .  1 .   681 . 1 1 21 C OP2  O -30.101  16.978 37.415 . . . 1.0 . . . . . . . . . . . . A . 21 C OP2  . . . . . . . . . rr_2l5z 1 
       .  1 .   682 . 1 1 21 C P    P -30.107  16.520 38.822 . . . 1.0 . . . . . . . . . . . . A . 21 C P    . . . . . . . . . rr_2l5z 1 
       .  1 .   683 . 1 1 22 G C1'  C -19.708  14.152 39.982 . . . 1.0 . . . . . . . . . . . . A . 22 G C1'  . . . . . . . . . rr_2l5z 1 
       .  1 .   684 . 1 1 22 G C2   C -18.085  10.502 38.071 . . . 1.0 . . . . . . . . . . . . A . 22 G C2   . . . . . . . . . rr_2l5z 1 
       .  1 .   685 . 1 1 22 G C2'  C -18.516  15.103 39.889 . . . 1.0 . . . . . . . . . . . . A . 22 G C2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   686 . 1 1 22 G C3'  C -19.192  16.420 39.565 . . . 1.0 . . . . . . . . . . . . A . 22 G C3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   687 . 1 1 22 G C4   C -19.359  12.329 38.195 . . . 1.0 . . . . . . . . . . . . A . 22 G C4   . . . . . . . . . rr_2l5z 1 
       .  1 .   688 . 1 1 22 G C4'  C -20.466  16.334 40.392 . . . 1.0 . . . . . . . . . . . . A . 22 G C4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   689 . 1 1 22 G C5   C -19.909  12.158 36.933 . . . 1.0 . . . . . . . . . . . . A . 22 G C5   . . . . . . . . . rr_2l5z 1 
       .  1 .   690 . 1 1 22 G C5'  C -21.564  17.242 39.840 . . . 1.0 . . . . . . . . . . . . A . 22 G C5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   691 . 1 1 22 G C6   C -19.515  11.045 36.143 . . . 1.0 . . . . . . . . . . . . A . 22 G C6   . . . . . . . . . rr_2l5z 1 
       .  1 .   692 . 1 1 22 G C8   C -20.760  13.899 37.727 . . . 1.0 . . . . . . . . . . . . A . 22 G C8   . . . . . . . . . rr_2l5z 1 
       .  1 .   693 . 1 1 22 G H1   H -18.246   9.419 36.289 . . . 1.0 . . . . . . . . . . . . A . 22 G H1   . . . . . . . . . rr_2l5z 1 
       .  1 .   694 . 1 1 22 G H1'  H -19.525  13.410 40.758 . . . 1.0 . . . . . . . . . . . . A . 22 G H1'  . . . . . . . . . rr_2l5z 1 
       .  1 .   695 . 1 1 22 G H2'  H -17.860  14.803 39.068 . . . 1.0 . . . . . . . . . . . . A . 22 G H2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   696 . 1 1 22 G H21  H -16.919   8.836 37.969 . . . 1.0 . . . . . . . . . . . . A . 22 G H21  . . . . . . . . . rr_2l5z 1 
       .  1 .   697 . 1 1 22 G H22  H -16.795   9.750 39.455 . . . 1.0 . . . . . . . . . . . . A . 22 G H22  . . . . . . . . . rr_2l5z 1 
       .  1 .   698 . 1 1 22 G H3'  H -19.395  16.521 38.497 . . . 1.0 . . . . . . . . . . . . A . 22 G H3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   699 . 1 1 22 G H4'  H -20.250  16.610 41.423 . . . 1.0 . . . . . . . . . . . . A . 22 G H4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   700 . 1 1 22 G H5'  H -22.423  17.210 40.511 . . . 1.0 . . . . . . . . . . . . A . 22 G H5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   701 . 1 1 22 G H5'' H -21.189  18.264 39.792 . . . 1.0 . . . . . . . . . . . . A . 22 G H5'' . . . . . . . . . rr_2l5z 1 
       .  1 .   702 . 1 1 22 G H8   H -21.348  14.797 37.846 . . . 1.0 . . . . . . . . . . . . A . 22 G H8   . . . . . . . . . rr_2l5z 1 
       .  1 .   703 . 1 1 22 G HO2' H -17.416  14.303 41.282 . . . 1.0 . . . . . . . . . . . . A . 22 G HO2' . . . . . . . . . rr_2l5z 1 
       .  1 .   704 . 1 1 22 G N1   N -18.582  10.256 36.805 . . . 1.0 . . . . . . . . . . . . A . 22 G N1   . . . . . . . . . rr_2l5z 1 
       .  1 .   705 . 1 1 22 G N2   N -17.194   9.625 38.536 . . . 1.0 . . . . . . . . . . . . A . 22 G N2   . . . . . . . . . rr_2l5z 1 
       .  1 .   706 . 1 1 22 G N3   N -18.450  11.547 38.821 . . . 1.0 . . . . . . . . . . . . A . 22 G N3   . . . . . . . . . rr_2l5z 1 
       .  1 .   707 . 1 1 22 G N7   N -20.819  13.190 36.647 . . . 1.0 . . . . . . . . . . . . A . 22 G N7   . . . . . . . . . rr_2l5z 1 
       .  1 .   708 . 1 1 22 G N9   N -19.929  13.472 38.693 . . . 1.0 . . . . . . . . . . . . A . 22 G N9   . . . . . . . . . rr_2l5z 1 
       .  1 .   709 . 1 1 22 G O2'  O -17.798  15.169 41.126 . . . 1.0 . . . . . . . . . . . . A . 22 G O2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   710 . 1 1 22 G O3'  O -18.384  17.487 40.070 . . . 1.0 . . . . . . . . . . . . A . 22 G O3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   711 . 1 1 22 G O4'  O -20.847  14.956 40.345 . . . 1.0 . . . . . . . . . . . . A . 22 G O4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   712 . 1 1 22 G O5'  O -21.980  16.837 38.533 . . . 1.0 . . . . . . . . . . . . A . 22 G O5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   713 . 1 1 22 G O6   O -19.894  10.738 35.015 . . . 1.0 . . . . . . . . . . . . A . 22 G O6   . . . . . . . . . rr_2l5z 1 
       .  1 .   714 . 1 1 22 G OP1  O -23.189  19.004 38.194 . . . 1.0 . . . . . . . . . . . . A . 22 G OP1  . . . . . . . . . rr_2l5z 1 
       .  1 .   715 . 1 1 22 G OP2  O -23.199  17.200 36.375 . . . 1.0 . . . . . . . . . . . . A . 22 G OP2  . . . . . . . . . rr_2l5z 1 
       .  1 .   716 . 1 1 22 G P    P -23.211  17.576 37.806 . . . 1.0 . . . . . . . . . . . . A . 22 G P    . . . . . . . . . rr_2l5z 1 
       .  1 .   717 . 1 1 23 G C1'  C -14.888  14.294 36.962 . . . 1.0 . . . . . . . . . . . . A . 23 G C1'  . . . . . . . . . rr_2l5z 1 
       .  1 .   718 . 1 1 23 G C2   C -15.916  11.342 33.831 . . . 1.0 . . . . . . . . . . . . A . 23 G C2   . . . . . . . . . rr_2l5z 1 
       .  1 .   719 . 1 1 23 G C2'  C -13.931  15.216 36.204 . . . 1.0 . . . . . . . . . . . . A . 23 G C2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   720 . 1 1 23 G C3'  C -14.186  16.565 36.852 . . . 1.0 . . . . . . . . . . . . A . 23 G C3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   721 . 1 1 23 G C4   C -16.301  13.065 35.194 . . . 1.0 . . . . . . . . . . . . A . 23 G C4   . . . . . . . . . rr_2l5z 1 
       .  1 .   722 . 1 1 23 G C4'  C -14.492  16.181 38.289 . . . 1.0 . . . . . . . . . . . . A . 23 G C4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   723 . 1 1 23 G C5   C -17.597  13.268 34.742 . . . 1.0 . . . . . . . . . . . . A . 23 G C5   . . . . . . . . . rr_2l5z 1 
       .  1 .   724 . 1 1 23 G C5'  C -15.291  17.265 39.010 . . . 1.0 . . . . . . . . . . . . A . 23 G C5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   725 . 1 1 23 G C6   C -18.123  12.426 33.725 . . . 1.0 . . . . . . . . . . . . A . 23 G C6   . . . . . . . . . rr_2l5z 1 
       .  1 .   726 . 1 1 23 G C8   C -17.242  14.714 36.216 . . . 1.0 . . . . . . . . . . . . A . 23 G C8   . . . . . . . . . rr_2l5z 1 
       .  1 .   727 . 1 1 23 G H1   H -17.506  10.819 32.576 . . . 1.0 . . . . . . . . . . . . A . 23 G H1   . . . . . . . . . rr_2l5z 1 
       .  1 .   728 . 1 1 23 G H1'  H -14.382  13.355 37.187 . . . 1.0 . . . . . . . . . . . . A . 23 G H1'  . . . . . . . . . rr_2l5z 1 
       .  1 .   729 . 1 1 23 G H2'  H -14.206  15.249 35.147 . . . 1.0 . . . . . . . . . . . . A . 23 G H2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   730 . 1 1 23 G H21  H -15.552   9.768 32.593 . . . 1.0 . . . . . . . . . . . . A . 23 G H21  . . . . . . . . . rr_2l5z 1 
       .  1 .   731 . 1 1 23 G H22  H -14.229  10.217 33.647 . . . 1.0 . . . . . . . . . . . . A . 23 G H22  . . . . . . . . . rr_2l5z 1 
       .  1 .   732 . 1 1 23 G H3'  H -15.016  17.093 36.378 . . . 1.0 . . . . . . . . . . . . A . 23 G H3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   733 . 1 1 23 G H4'  H -13.562  15.997 38.824 . . . 1.0 . . . . . . . . . . . . A . 23 G H4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   734 . 1 1 23 G H5'  H -15.484  16.943 40.034 . . . 1.0 . . . . . . . . . . . . A . 23 G H5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   735 . 1 1 23 G H5'' H -14.704  18.184 39.032 . . . 1.0 . . . . . . . . . . . . A . 23 G H5'' . . . . . . . . . rr_2l5z 1 
       .  1 .   736 . 1 1 23 G H8   H -17.366  15.544 36.895 . . . 1.0 . . . . . . . . . . . . A . 23 G H8   . . . . . . . . . rr_2l5z 1 
       .  1 .   737 . 1 1 23 G HO2' H -12.519  14.293 37.177 . . . 1.0 . . . . . . . . . . . . A . 23 G HO2' . . . . . . . . . rr_2l5z 1 
       .  1 .   738 . 1 1 23 G N1   N -17.194  11.473 33.322 . . . 1.0 . . . . . . . . . . . . A . 23 G N1   . . . . . . . . . rr_2l5z 1 
       .  1 .   739 . 1 1 23 G N2   N -15.172  10.364 33.316 . . . 1.0 . . . . . . . . . . . . A . 23 G N2   . . . . . . . . . rr_2l5z 1 
       .  1 .   740 . 1 1 23 G N3   N -15.414  12.130 34.787 . . . 1.0 . . . . . . . . . . . . A . 23 G N3   . . . . . . . . . rr_2l5z 1 
       .  1 .   741 . 1 1 23 G N7   N -18.193  14.346 35.419 . . . 1.0 . . . . . . . . . . . . A . 23 G N7   . . . . . . . . . rr_2l5z 1 
       .  1 .   742 . 1 1 23 G N9   N -16.092  14.020 36.155 . . . 1.0 . . . . . . . . . . . . A . 23 G N9   . . . . . . . . . rr_2l5z 1 
       .  1 .   743 . 1 1 23 G O2'  O -12.569  14.805 36.366 . . . 1.0 . . . . . . . . . . . . A . 23 G O2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   744 . 1 1 23 G O3'  O -12.973  17.322 36.824 . . . 1.0 . . . . . . . . . . . . A . 23 G O3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   745 . 1 1 23 G O4'  O -15.226  14.960 38.192 . . . 1.0 . . . . . . . . . . . . A . 23 G O4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   746 . 1 1 23 G O5'  O -16.538  17.526 38.362 . . . 1.0 . . . . . . . . . . . . A . 23 G O5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   747 . 1 1 23 G O6   O -19.238  12.459 33.207 . . . 1.0 . . . . . . . . . . . . A . 23 G O6   . . . . . . . . . rr_2l5z 1 
       .  1 .   748 . 1 1 23 G OP1  O -16.913  19.504 39.854 . . . 1.0 . . . . . . . . . . . . A . 23 G OP1  . . . . . . . . . rr_2l5z 1 
       .  1 .   749 . 1 1 23 G OP2  O -18.599  18.908 38.018 . . . 1.0 . . . . . . . . . . . . A . 23 G OP2  . . . . . . . . . rr_2l5z 1 
       .  1 .   750 . 1 1 23 G P    P -17.631  18.485 39.055 . . . 1.0 . . . . . . . . . . . . A . 23 G P    . . . . . . . . . rr_2l5z 1 
       .  1 .   751 . 1 1 24 C C1'  C -12.217  15.340 31.725 . . . 1.0 . . . . . . . . . . . . A . 24 C C1'  . . . . . . . . . rr_2l5z 1 
       .  1 .   752 . 1 1 24 C C2   C -14.368  14.750 30.643 . . . 1.0 . . . . . . . . . . . . A . 24 C C2   . . . . . . . . . rr_2l5z 1 
       .  1 .   753 . 1 1 24 C C2'  C -11.581  16.365 30.786 . . . 1.0 . . . . . . . . . . . . A . 24 C C2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   754 . 1 1 24 C C3'  C -11.261  17.512 31.727 . . . 1.0 . . . . . . . . . . . . A . 24 C C3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   755 . 1 1 24 C C4   C -16.404  15.580 31.470 . . . 1.0 . . . . . . . . . . . . A . 24 C C4   . . . . . . . . . rr_2l5z 1 
       .  1 .   756 . 1 1 24 C C4'  C -10.872  16.780 33.000 . . . 1.0 . . . . . . . . . . . . A . 24 C C4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   757 . 1 1 24 C C5   C -15.728  16.281 32.517 . . . 1.0 . . . . . . . . . . . . A . 24 C C5   . . . . . . . . . rr_2l5z 1 
       .  1 .   758 . 1 1 24 C C5'  C -11.031  17.663 34.237 . . . 1.0 . . . . . . . . . . . . A . 24 C C5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   759 . 1 1 24 C C6   C -14.385  16.181 32.577 . . . 1.0 . . . . . . . . . . . . A . 24 C C6   . . . . . . . . . rr_2l5z 1 
       .  1 .   760 . 1 1 24 C H1'  H -11.884  14.335 31.450 . . . 1.0 . . . . . . . . . . . . A . 24 C H1'  . . . . . . . . . rr_2l5z 1 
       .  1 .   761 . 1 1 24 C H2'  H -12.309  16.684 30.038 . . . 1.0 . . . . . . . . . . . . A . 24 C H2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   762 . 1 1 24 C H3'  H -12.120  18.170 31.872 . . . 1.0 . . . . . . . . . . . . A . 24 C H3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   763 . 1 1 24 C H4'  H  -9.841  16.439 32.925 . . . 1.0 . . . . . . . . . . . . A . 24 C H4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   764 . 1 1 24 C H41  H -18.214  15.160 30.640 . . . 1.0 . . . . . . . . . . . . A . 24 C H41  . . . . . . . . . rr_2l5z 1 
       .  1 .   765 . 1 1 24 C H42  H -18.255  16.203 32.044 . . . 1.0 . . . . . . . . . . . . A . 24 C H42  . . . . . . . . . rr_2l5z 1 
       .  1 .   766 . 1 1 24 C H5   H -16.276  16.871 33.235 . . . 1.0 . . . . . . . . . . . . A . 24 C H5   . . . . . . . . . rr_2l5z 1 
       .  1 .   767 . 1 1 24 C H5'  H -10.645  17.129 35.106 . . . 1.0 . . . . . . . . . . . . A . 24 C H5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   768 . 1 1 24 C H5'' H -10.454  18.577 34.097 . . . 1.0 . . . . . . . . . . . . A . 24 C H5'' . . . . . . . . . rr_2l5z 1 
       .  1 .   769 . 1 1 24 C H6   H -13.843  16.712 33.348 . . . 1.0 . . . . . . . . . . . . A . 24 C H6   . . . . . . . . . rr_2l5z 1 
       .  1 .   770 . 1 1 24 C HO2' H -10.518  14.899 30.070 . . . 1.0 . . . . . . . . . . . . A . 24 C HO2' . . . . . . . . . rr_2l5z 1 
       .  1 .   771 . 1 1 24 C N1   N -13.701  15.431 31.663 . . . 1.0 . . . . . . . . . . . . A . 24 C N1   . . . . . . . . . rr_2l5z 1 
       .  1 .   772 . 1 1 24 C N3   N -15.723  14.848 30.579 . . . 1.0 . . . . . . . . . . . . A . 24 C N3   . . . . . . . . . rr_2l5z 1 
       .  1 .   773 . 1 1 24 C N4   N -17.731  15.653 31.377 . . . 1.0 . . . . . . . . . . . . A . 24 C N4   . . . . . . . . . rr_2l5z 1 
       .  1 .   774 . 1 1 24 C O2   O -13.733  14.084 29.826 . . . 1.0 . . . . . . . . . . . . A . 24 C O2   . . . . . . . . . rr_2l5z 1 
       .  1 .   775 . 1 1 24 C O2'  O -10.399  15.847 30.166 . . . 1.0 . . . . . . . . . . . . A . 24 C O2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   776 . 1 1 24 C O3'  O -10.116  18.210 31.229 . . . 1.0 . . . . . . . . . . . . A . 24 C O3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   777 . 1 1 24 C O4'  O -11.738  15.645 33.050 . . . 1.0 . . . . . . . . . . . . A . 24 C O4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   778 . 1 1 24 C O5'  O -12.398  18.007 34.473 . . . 1.0 . . . . . . . . . . . . A . 24 C O5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   779 . 1 1 24 C OP1  O -11.740  19.462 36.403 . . . 1.0 . . . . . . . . . . . . A . 24 C OP1  . . . . . . . . . rr_2l5z 1 
       .  1 .   780 . 1 1 24 C OP2  O -14.199  19.212 35.729 . . . 1.0 . . . . . . . . . . . . A . 24 C OP2  . . . . . . . . . rr_2l5z 1 
       .  1 .   781 . 1 1 24 C P    P -12.849  18.628 35.889 . . . 1.0 . . . . . . . . . . . . A . 24 C P    . . . . . . . . . rr_2l5z 1 
       .  1 .   782 . 1 1 25 U C1'  C -11.866  16.452 26.379 . . . 1.0 . . . . . . . . . . . . A . 25 U C1'  . . . . . . . . . rr_2l5z 1 
       .  1 .   783 . 1 1 25 U C2   C -14.334  16.654 26.232 . . . 1.0 . . . . . . . . . . . . A . 25 U C2   . . . . . . . . . rr_2l5z 1 
       .  1 .   784 . 1 1 25 U C2'  C -11.306  17.246 25.201 . . . 1.0 . . . . . . . . . . . . A . 25 U C2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   785 . 1 1 25 U C3'  C -10.410  18.248 25.903 . . . 1.0 . . . . . . . . . . . . A . 25 U C3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   786 . 1 1 25 U C4   C -15.578  18.184 27.714 . . . 1.0 . . . . . . . . . . . . A . 25 U C4   . . . . . . . . . rr_2l5z 1 
       .  1 .   787 . 1 1 25 U C4'  C  -9.822  17.411 27.028 . . . 1.0 . . . . . . . . . . . . A . 25 U C4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   788 . 1 1 25 U C5   C -14.304  18.537 28.300 . . . 1.0 . . . . . . . . . . . . A . 25 U C5   . . . . . . . . . rr_2l5z 1 
       .  1 .   789 . 1 1 25 U C5'  C  -9.365  18.269 28.207 . . . 1.0 . . . . . . . . . . . . A . 25 U C5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   790 . 1 1 25 U C6   C -13.153  17.972 27.860 . . . 1.0 . . . . . . . . . . . . A . 25 U C6   . . . . . . . . . rr_2l5z 1 
       .  1 .   791 . 1 1 25 U H1'  H -12.008  15.408 26.084 . . . 1.0 . . . . . . . . . . . . A . 25 U H1'  . . . . . . . . . rr_2l5z 1 
       .  1 .   792 . 1 1 25 U H2'  H -12.113  17.761 24.676 . . . 1.0 . . . . . . . . . . . . A . 25 U H2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   793 . 1 1 25 U H3   H -16.383  16.960 26.247 . . . 1.0 . . . . . . . . . . . . A . 25 U H3   . . . . . . . . . rr_2l5z 1 
       .  1 .   794 . 1 1 25 U H3'  H -10.971  19.109 26.271 . . . 1.0 . . . . . . . . . . . . A . 25 U H3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   795 . 1 1 25 U H4'  H  -8.980  16.836 26.649 . . . 1.0 . . . . . . . . . . . . A . 25 U H4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   796 . 1 1 25 U H5   H -14.269  19.262 29.100 . . . 1.0 . . . . . . . . . . . . A . 25 U H5   . . . . . . . . . rr_2l5z 1 
       .  1 .   797 . 1 1 25 U H5'  H  -8.860  17.634 28.934 . . . 1.0 . . . . . . . . . . . . A . 25 U H5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   798 . 1 1 25 U H5'' H  -8.665  19.023 27.847 . . . 1.0 . . . . . . . . . . . . A . 25 U H5'' . . . . . . . . . rr_2l5z 1 
       .  1 .   799 . 1 1 25 U H6   H -12.216  18.267 28.309 . . . 1.0 . . . . . . . . . . . . A . 25 U H6   . . . . . . . . . rr_2l5z 1 
       .  1 .   800 . 1 1 25 U HO2' H  -9.700  16.815 24.188 . . . 1.0 . . . . . . . . . . . . A . 25 U HO2' . . . . . . . . . rr_2l5z 1 
       .  1 .   801 . 1 1 25 U N1   N -13.150  17.047 26.850 . . . 1.0 . . . . . . . . . . . . A . 25 U N1   . . . . . . . . . rr_2l5z 1 
       .  1 .   802 . 1 1 25 U N3   N -15.492  17.247 26.700 . . . 1.0 . . . . . . . . . . . . A . 25 U N3   . . . . . . . . . rr_2l5z 1 
       .  1 .   803 . 1 1 25 U O2   O -14.352  15.827 25.323 . . . 1.0 . . . . . . . . . . . . A . 25 U O2   . . . . . . . . . rr_2l5z 1 
       .  1 .   804 . 1 1 25 U O2'  O -10.561  16.409 24.309 . . . 1.0 . . . . . . . . . . . . A . 25 U O2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   805 . 1 1 25 U O3'  O  -9.355  18.622 25.012 . . . 1.0 . . . . . . . . . . . . A . 25 U O3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   806 . 1 1 25 U O4   O -16.666  18.645 28.050 . . . 1.0 . . . . . . . . . . . . A . 25 U O4   . . . . . . . . . rr_2l5z 1 
       .  1 .   807 . 1 1 25 U O4'  O -10.866  16.513 27.413 . . . 1.0 . . . . . . . . . . . . A . 25 U O4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   808 . 1 1 25 U O5'  O -10.464  18.923 28.844 . . . 1.0 . . . . . . . . . . . . A . 25 U O5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   809 . 1 1 25 U OP1  O  -9.030  20.298 30.369 . . . 1.0 . . . . . . . . . . . . A . 25 U OP1  . . . . . . . . . rr_2l5z 1 
       .  1 .   810 . 1 1 25 U OP2  O -11.568  20.185 30.705 . . . 1.0 . . . . . . . . . . . . A . 25 U OP2  . . . . . . . . . rr_2l5z 1 
       .  1 .   811 . 1 1 25 U P    P -10.296  19.532 30.325 . . . 1.0 . . . . . . . . . . . . A . 25 U P    . . . . . . . . . rr_2l5z 1 
       .  1 .   812 . 1 1 26 C C1'  C -14.322  19.566 22.286 . . . 1.0 . . . . . . . . . . . . A . 26 C C1'  . . . . . . . . . rr_2l5z 1 
       .  1 .   813 . 1 1 26 C C2   C -16.271  20.516 23.436 . . . 1.0 . . . . . . . . . . . . A . 26 C C2   . . . . . . . . . rr_2l5z 1 
       .  1 .   814 . 1 1 26 C C2'  C -14.009  20.698 21.301 . . . 1.0 . . . . . . . . . . . . A . 26 C C2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   815 . 1 1 26 C C3'  C -12.492  20.825 21.381 . . . 1.0 . . . . . . . . . . . . A . 26 C C3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   816 . 1 1 26 C C4   C -16.192  21.068 25.718 . . . 1.0 . . . . . . . . . . . . A . 26 C C4   . . . . . . . . . rr_2l5z 1 
       .  1 .   817 . 1 1 26 C C4'  C -12.079  19.397 21.694 . . . 1.0 . . . . . . . . . . . . A . 26 C C4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   818 . 1 1 26 C C5   C -14.831  20.635 25.805 . . . 1.0 . . . . . . . . . . . . A . 26 C C5   . . . . . . . . . rr_2l5z 1 
       .  1 .   819 . 1 1 26 C C5'  C -10.688  19.329 22.322 . . . 1.0 . . . . . . . . . . . . A . 26 C C5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   820 . 1 1 26 C C6   C -14.252  20.159 24.686 . . . 1.0 . . . . . . . . . . . . A . 26 C C6   . . . . . . . . . rr_2l5z 1 
       .  1 .   821 . 1 1 26 C H1'  H -14.995  18.851 21.812 . . . 1.0 . . . . . . . . . . . . A . 26 C H1'  . . . . . . . . . rr_2l5z 1 
       .  1 .   822 . 1 1 26 C H2'  H -14.485  21.626 21.636 . . . 1.0 . . . . . . . . . . . . A . 26 C H2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   823 . 1 1 26 C H3'  H -12.212  21.495 22.203 . . . 1.0 . . . . . . . . . . . . A . 26 C H3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   824 . 1 1 26 C H4'  H -12.097  18.804 20.782 . . . 1.0 . . . . . . . . . . . . A . 26 C H4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   825 . 1 1 26 C H41  H -17.766  21.851 26.744 . . . 1.0 . . . . . . . . . . . . A . 26 C H41  . . . . . . . . . rr_2l5z 1 
       .  1 .   826 . 1 1 26 C H42  H -16.308  21.601 27.678 . . . 1.0 . . . . . . . . . . . . A . 26 C H42  . . . . . . . . . rr_2l5z 1 
       .  1 .   827 . 1 1 26 C H5   H -14.287  20.689 26.737 . . . 1.0 . . . . . . . . . . . . A . 26 C H5   . . . . . . . . . rr_2l5z 1 
       .  1 .   828 . 1 1 26 C H5'  H -10.482  18.301 22.620 . . . 1.0 . . . . . . . . . . . . A . 26 C H5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   829 . 1 1 26 C H5'' H  -9.949  19.640 21.584 . . . 1.0 . . . . . . . . . . . . A . 26 C H5'' . . . . . . . . . rr_2l5z 1 
       .  1 .   830 . 1 1 26 C H6   H -13.223  19.828 24.715 . . . 1.0 . . . . . . . . . . . . A . 26 C H6   . . . . . . . . . rr_2l5z 1 
       .  1 .   831 . 1 1 26 C HO2' H -13.939  20.920 19.368 . . . 1.0 . . . . . . . . . . . . A . 26 C HO2' . . . . . . . . . rr_2l5z 1 
       .  1 .   832 . 1 1 26 C HO3' H -12.074  22.222 20.090 . . . 1.0 . . . . . . . . . . . . A . 26 C HO3' . . . . . . . . . rr_2l5z 1 
       .  1 .   833 . 1 1 26 C N1   N -14.950  20.094 23.516 . . . 1.0 . . . . . . . . . . . . A . 26 C N1   . . . . . . . . . rr_2l5z 1 
       .  1 .   834 . 1 1 26 C N3   N -16.864  20.999 24.561 . . . 1.0 . . . . . . . . . . . . A . 26 C N3   . . . . . . . . . rr_2l5z 1 
       .  1 .   835 . 1 1 26 C N4   N -16.805  21.545 26.801 . . . 1.0 . . . . . . . . . . . . A . 26 C N4   . . . . . . . . . rr_2l5z 1 
       .  1 .   836 . 1 1 26 C O2   O -16.878  20.448 22.368 . . . 1.0 . . . . . . . . . . . . A . 26 C O2   . . . . . . . . . rr_2l5z 1 
       .  1 .   837 . 1 1 26 C O2'  O -14.433  20.363 19.974 . . . 1.0 . . . . . . . . . . . . A . 26 C O2'  . . . . . . . . . rr_2l5z 1 
       .  1 .   838 . 1 1 26 C O3'  O -11.936  21.273 20.139 . . . 1.0 . . . . . . . . . . . . A . 26 C O3'  . . . . . . . . . rr_2l5z 1 
       .  1 .   839 . 1 1 26 C O4'  O -13.079  18.915 22.584 . . . 1.0 . . . . . . . . . . . . A . 26 C O4'  . . . . . . . . . rr_2l5z 1 
       .  1 .   840 . 1 1 26 C O5'  O -10.585  20.176 23.469 . . . 1.0 . . . . . . . . . . . . A . 26 C O5'  . . . . . . . . . rr_2l5z 1 
       .  1 .   841 . 1 1 26 C OP1  O  -8.083  20.212 23.552 . . . 1.0 . . . . . . . . . . . . A . 26 C OP1  . . . . . . . . . rr_2l5z 1 
       .  1 .   842 . 1 1 26 C OP2  O  -9.472  21.071 25.526 . . . 1.0 . . . . . . . . . . . . A . 26 C OP2  . . . . . . . . . rr_2l5z 1 
       .  1 .   843 . 1 1 26 C P    P  -9.283  20.115 24.413 . . . 1.0 . . . . . . . . . . . . A . 26 C P    . . . . . . . . . rr_2l5z 1 
       .  2 .   844 . 1 1  1 G C1'  C -24.517  19.478 22.449 . . . 1.0 . . . . . . . . . . . . A .  1 G C1'  . . . . . . . . . rr_2l5z 1 
       .  2 .   845 . 1 1  1 G C2   C -20.315  20.854 22.636 . . . 1.0 . . . . . . . . . . . . A .  1 G C2   . . . . . . . . . rr_2l5z 1 
       .  2 .   846 . 1 1  1 G C2'  C -24.523  18.005 22.042 . . . 1.0 . . . . . . . . . . . . A .  1 G C2'  . . . . . . . . . rr_2l5z 1 
       .  2 .   847 . 1 1  1 G C3'  C -25.697  17.452 22.826 . . . 1.0 . . . . . . . . . . . . A .  1 G C3'  . . . . . . . . . rr_2l5z 1 
       .  2 .   848 . 1 1  1 G C4   C -22.255  20.149 23.480 . . . 1.0 . . . . . . . . . . . . A .  1 G C4   . . . . . . . . . rr_2l5z 1 
       .  2 .   849 . 1 1  1 G C4'  C -26.672  18.626 22.841 . . . 1.0 . . . . . . . . . . . . A .  1 G C4'  . . . . . . . . . rr_2l5z 1 
       .  2 .   850 . 1 1  1 G C5   C -21.816  20.190 24.797 . . . 1.0 . . . . . . . . . . . . A .  1 G C5   . . . . . . . . . rr_2l5z 1 
       .  2 .   851 . 1 1  1 G C5'  C -27.612  18.576 24.047 . . . 1.0 . . . . . . . . . . . . A .  1 G C5'  . . . . . . . . . rr_2l5z 1 
       .  2 .   852 . 1 1  1 G C6   C -20.487  20.604 25.079 . . . 1.0 . . . . . . . . . . . . A .  1 G C6   . . . . . . . . . rr_2l5z 1 
       .  2 .   853 . 1 1  1 G C8   C -23.804  19.531 24.848 . . . 1.0 . . . . . . . . . . . . A .  1 G C8   . . . . . . . . . rr_2l5z 1 
       .  2 .   854 . 1 1  1 G H1   H -18.813  21.238 24.041 . . . 1.0 . . . . . . . . . . . . A .  1 G H1   . . . . . . . . . rr_2l5z 1 
       .  2 .   855 . 1 1  1 G H1'  H -24.248  20.089 21.588 . . . 1.0 . . . . . . . . . . . . A .  1 G H1'  . . . . . . . . . rr_2l5z 1 
       .  2 .   856 . 1 1  1 G H2'  H -23.596  17.525 22.366 . . . 1.0 . . . . . . . . . . . . A .  1 G H2'  . . . . . . . . . rr_2l5z 1 
       .  2 .   857 . 1 1  1 G H21  H -18.549  21.497 21.854 . . . 1.0 . . . . . . . . . . . . A .  1 G H21  . . . . . . . . . rr_2l5z 1 
       .  2 .   858 . 1 1  1 G H22  H -19.812  21.172 20.689 . . . 1.0 . . . . . . . . . . . . A .  1 G H22  . . . . . . . . . rr_2l5z 1 
       .  2 .   859 . 1 1  1 G H3'  H -25.400  17.137 23.830 . . . 1.0 . . . . . . . . . . . . A .  1 G H3'  . . . . . . . . . rr_2l5z 1 
       .  2 .   860 . 1 1  1 G H4'  H -27.258  18.620 21.924 . . . 1.0 . . . . . . . . . . . . A .  1 G H4'  . . . . . . . . . rr_2l5z 1 
       .  2 .   861 . 1 1  1 G H5'  H -28.173  19.509 24.098 . . . 1.0 . . . . . . . . . . . . A .  1 G H5'  . . . . . . . . . rr_2l5z 1 
       .  2 .   862 . 1 1  1 G H5'' H -28.309  17.748 23.920 . . . 1.0 . . . . . . . . . . . . A .  1 G H5'' . . . . . . . . . rr_2l5z 1 
       .  2 .   863 . 1 1  1 G H8   H -24.767  19.187 25.196 . . . 1.0 . . . . . . . . . . . . A .  1 G H8   . . . . . . . . . rr_2l5z 1 
       .  2 .   864 . 1 1  1 G HO2' H -23.956  17.366 20.293 . . . 1.0 . . . . . . . . . . . . A .  1 G HO2' . . . . . . . . . rr_2l5z 1 
       .  2 .   865 . 1 1  1 G HO5' H -26.981  19.208 25.775 . . . 1.0 . . . . . . . . . . . . A .  1 G HO5' . . . . . . . . . rr_2l5z 1 
       .  2 .   866 . 1 1  1 G N1   N -19.796  20.923 23.915 . . . 1.0 . . . . . . . . . . . . A .  1 G N1   . . . . . . . . . rr_2l5z 1 
       .  2 .   867 . 1 1  1 G N2   N -19.492  21.203 21.646 . . . 1.0 . . . . . . . . . . . . A .  1 G N2   . . . . . . . . . rr_2l5z 1 
       .  2 .   868 . 1 1  1 G N3   N -21.564  20.465 22.362 . . . 1.0 . . . . . . . . . . . . A .  1 G N3   . . . . . . . . . rr_2l5z 1 
       .  2 .   869 . 1 1  1 G N7   N -22.839  19.784 25.670 . . . 1.0 . . . . . . . . . . . . A .  1 G N7   . . . . . . . . . rr_2l5z 1 
       .  2 .   870 . 1 1  1 G N9   N -23.554  19.717 23.539 . . . 1.0 . . . . . . . . . . . . A .  1 G N9   . . . . . . . . . rr_2l5z 1 
       .  2 .   871 . 1 1  1 G O2'  O -24.713  17.850 20.631 . . . 1.0 . . . . . . . . . . . . A .  1 G O2'  . . . . . . . . . rr_2l5z 1 
       .  2 .   872 . 1 1  1 G O3'  O -26.283  16.386 22.074 . . . 1.0 . . . . . . . . . . . . A .  1 G O3'  . . . . . . . . . rr_2l5z 1 
       .  2 .   873 . 1 1  1 G O4'  O -25.855  19.800 22.866 . . . 1.0 . . . . . . . . . . . . A .  1 G O4'  . . . . . . . . . rr_2l5z 1 
       .  2 .   874 . 1 1  1 G O5'  O -26.892  18.398 25.268 . . . 1.0 . . . . . . . . . . . . A .  1 G O5'  . . . . . . . . . rr_2l5z 1 
       .  2 .   875 . 1 1  1 G O6   O -19.931  20.697 26.172 . . . 1.0 . . . . . . . . . . . . A .  1 G O6   . . . . . . . . . rr_2l5z 1 
       .  2 .   876 . 1 1  2 A C1'  C -20.832  14.200 21.580 . . . 1.0 . . . . . . . . . . . . A .  2 A C1'  . . . . . . . . . rr_2l5z 1 
       .  2 .   877 . 1 1  2 A C2   C -17.387  15.480 24.044 . . . 1.0 . . . . . . . . . . . . A .  2 A C2   . . . . . . . . . rr_2l5z 1 
       .  2 .   878 . 1 1  2 A C2'  C -21.039  12.730 21.941 . . . 1.0 . . . . . . . . . . . . A .  2 A C2'  . . . . . . . . . rr_2l5z 1 
       .  2 .   879 . 1 1  2 A C3'  C -22.548  12.589 21.884 . . . 1.0 . . . . . . . . . . . . A .  2 A C3'  . . . . . . . . . rr_2l5z 1 
       .  2 .   880 . 1 1  2 A C4   C -19.518  15.349 23.477 . . . 1.0 . . . . . . . . . . . . A .  2 A C4   . . . . . . . . . rr_2l5z 1 
       .  2 .   881 . 1 1  2 A C4'  C -22.922  13.532 20.748 . . . 1.0 . . . . . . . . . . . . A .  2 A C4'  . . . . . . . . . rr_2l5z 1 
       .  2 .   882 . 1 1  2 A C5   C -19.926  16.127 24.536 . . . 1.0 . . . . . . . . . . . . A .  2 A C5   . . . . . . . . . rr_2l5z 1 
       .  2 .   883 . 1 1  2 A C5'  C -24.368  14.018 20.862 . . . 1.0 . . . . . . . . . . . . A .  2 A C5'  . . . . . . . . . rr_2l5z 1 
       .  2 .   884 . 1 1  2 A C6   C -18.923  16.594 25.391 . . . 1.0 . . . . . . . . . . . . A .  2 A C6   . . . . . . . . . rr_2l5z 1 
       .  2 .   885 . 1 1  2 A C8   C -21.657  15.608 23.480 . . . 1.0 . . . . . . . . . . . . A .  2 A C8   . . . . . . . . . rr_2l5z 1 
       .  2 .   886 . 1 1  2 A H1'  H -19.949  14.300 20.950 . . . 1.0 . . . . . . . . . . . . A .  2 A H1'  . . . . . . . . . rr_2l5z 1 
       .  2 .   887 . 1 1  2 A H2   H -16.338  15.234 23.876 . . . 1.0 . . . . . . . . . . . . A .  2 A H2   . . . . . . . . . rr_2l5z 1 
       .  2 .   888 . 1 1  2 A H2'  H -20.682  12.540 22.956 . . . 1.0 . . . . . . . . . . . . A .  2 A H2'  . . . . . . . . . rr_2l5z 1 
       .  2 .   889 . 1 1  2 A H3'  H -23.016  12.868 22.831 . . . 1.0 . . . . . . . . . . . . A .  2 A H3'  . . . . . . . . . rr_2l5z 1 
       .  2 .   890 . 1 1  2 A H4'  H -22.785  13.023 19.795 . . . 1.0 . . . . . . . . . . . . A .  2 A H4'  . . . . . . . . . rr_2l5z 1 
       .  2 .   891 . 1 1  2 A H5'  H -24.523  14.843 20.166 . . . 1.0 . . . . . . . . . . . . A .  2 A H5'  . . . . . . . . . rr_2l5z 1 
       .  2 .   892 . 1 1  2 A H5'' H -25.040  13.201 20.602 . . . 1.0 . . . . . . . . . . . . A .  2 A H5'' . . . . . . . . . rr_2l5z 1 
       .  2 .   893 . 1 1  2 A H61  H -18.408  17.669 27.040 . . . 1.0 . . . . . . . . . . . . A .  2 A H61  . . . . . . . . . rr_2l5z 1 
       .  2 .   894 . 1 1  2 A H62  H -20.118  17.628 26.674 . . . 1.0 . . . . . . . . . . . . A .  2 A H62  . . . . . . . . . rr_2l5z 1 
       .  2 .   895 . 1 1  2 A H8   H -22.687  15.515 23.172 . . . 1.0 . . . . . . . . . . . . A .  2 A H8   . . . . . . . . . rr_2l5z 1 
       .  2 .   896 . 1 1  2 A HO2' H -21.078  11.512 20.422 . . . 1.0 . . . . . . . . . . . . A .  2 A HO2' . . . . . . . . . rr_2l5z 1 
       .  2 .   897 . 1 1  2 A N1   N -17.655  16.243 25.106 . . . 1.0 . . . . . . . . . . . . A .  2 A N1   . . . . . . . . . rr_2l5z 1 
       .  2 .   898 . 1 1  2 A N3   N -18.258  14.984 23.170 . . . 1.0 . . . . . . . . . . . . A .  2 A N3   . . . . . . . . . rr_2l5z 1 
       .  2 .   899 . 1 1  2 A N6   N -19.170  17.358 26.454 . . . 1.0 . . . . . . . . . . . . A .  2 A N6   . . . . . . . . . rr_2l5z 1 
       .  2 .   900 . 1 1  2 A N7   N -21.322  16.290 24.526 . . . 1.0 . . . . . . . . . . . . A .  2 A N7   . . . . . . . . . rr_2l5z 1 
       .  2 .   901 . 1 1  2 A N9   N -20.661  15.018 22.796 . . . 1.0 . . . . . . . . . . . . A .  2 A N9   . . . . . . . . . rr_2l5z 1 
       .  2 .   902 . 1 1  2 A O2'  O -20.395  11.863 21.000 . . . 1.0 . . . . . . . . . . . . A .  2 A O2'  . . . . . . . . . rr_2l5z 1 
       .  2 .   903 . 1 1  2 A O3'  O -22.866  11.250 21.494 . . . 1.0 . . . . . . . . . . . . A .  2 A O3'  . . . . . . . . . rr_2l5z 1 
       .  2 .   904 . 1 1  2 A O4'  O -21.995  14.615 20.839 . . . 1.0 . . . . . . . . . . . . A .  2 A O4'  . . . . . . . . . rr_2l5z 1 
       .  2 .   905 . 1 1  2 A O5'  O -24.668  14.464 22.188 . . . 1.0 . . . . . . . . . . . . A .  2 A O5'  . . . . . . . . . rr_2l5z 1 
       .  2 .   906 . 1 1  2 A OP1  O -27.105  14.037 21.795 . . . 1.0 . . . . . . . . . . . . A .  2 A OP1  . . . . . . . . . rr_2l5z 1 
       .  2 .   907 . 1 1  2 A OP2  O -26.271  14.871 24.068 . . . 1.0 . . . . . . . . . . . . A .  2 A OP2  . . . . . . . . . rr_2l5z 1 
       .  2 .   908 . 1 1  2 A P    P -26.174  14.866 22.592 . . . 1.0 . . . . . . . . . . . . A .  2 A P    . . . . . . . . . rr_2l5z 1 
       .  2 .   909 . 1 1  3 G C1'  C -17.870  10.695 23.997 . . . 1.0 . . . . . . . . . . . . A .  3 G C1'  . . . . . . . . . rr_2l5z 1 
       .  2 .   910 . 1 1  3 G C2   C -15.713  13.048 27.054 . . . 1.0 . . . . . . . . . . . . A .  3 G C2   . . . . . . . . . rr_2l5z 1 
       .  2 .   911 . 1 1  3 G C2'  C -17.698   9.239 24.443 . . . 1.0 . . . . . . . . . . . . A .  3 G C2'  . . . . . . . . . rr_2l5z 1 
       .  2 .   912 . 1 1  3 G C3'  C -18.918   8.553 23.851 . . . 1.0 . . . . . . . . . . . . A .  3 G C3'  . . . . . . . . . rr_2l5z 1 
       .  2 .   913 . 1 1  3 G C4   C -17.518  12.234 26.029 . . . 1.0 . . . . . . . . . . . . A .  3 G C4   . . . . . . . . . rr_2l5z 1 
       .  2 .   914 . 1 1  3 G C4'  C -19.171   9.361 22.590 . . . 1.0 . . . . . . . . . . . . A .  3 G C4'  . . . . . . . . . rr_2l5z 1 
       .  2 .   915 . 1 1  3 G C5   C -18.415  12.852 26.887 . . . 1.0 . . . . . . . . . . . . A .  3 G C5   . . . . . . . . . rr_2l5z 1 
       .  2 .   916 . 1 1  3 G C5'  C -20.615   9.227 22.109 . . . 1.0 . . . . . . . . . . . . A .  3 G C5'  . . . . . . . . . rr_2l5z 1 
       .  2 .   917 . 1 1  3 G C6   C -17.924  13.657 27.949 . . . 1.0 . . . . . . . . . . . . A .  3 G C6   . . . . . . . . . rr_2l5z 1 
       .  2 .   918 . 1 1  3 G C8   C -19.558  11.781 25.496 . . . 1.0 . . . . . . . . . . . . A .  3 G C8   . . . . . . . . . rr_2l5z 1 
       .  2 .   919 . 1 1  3 G H1   H -16.099  14.273 28.706 . . . 1.0 . . . . . . . . . . . . A .  3 G H1   . . . . . . . . . rr_2l5z 1 
       .  2 .   920 . 1 1  3 G H1'  H -16.925  11.065 23.600 . . . 1.0 . . . . . . . . . . . . A .  3 G H1'  . . . . . . . . . rr_2l5z 1 
       .  2 .   921 . 1 1  3 G H2'  H -17.728   9.178 25.534 . . . 1.0 . . . . . . . . . . . . A .  3 G H2'  . . . . . . . . . rr_2l5z 1 
       .  2 .   922 . 1 1  3 G H21  H -14.058  13.782 27.982 . . . 1.0 . . . . . . . . . . . . A .  3 G H21  . . . . . . . . . rr_2l5z 1 
       .  2 .   923 . 1 1  3 G H22  H -13.751  12.755 26.600 . . . 1.0 . . . . . . . . . . . . A .  3 G H22  . . . . . . . . . rr_2l5z 1 
       .  2 .   924 . 1 1  3 G H3'  H -19.767   8.573 24.536 . . . 1.0 . . . . . . . . . . . . A .  3 G H3'  . . . . . . . . . rr_2l5z 1 
       .  2 .   925 . 1 1  3 G H4'  H -18.493   9.034 21.804 . . . 1.0 . . . . . . . . . . . . A .  3 G H4'  . . . . . . . . . rr_2l5z 1 
       .  2 .   926 . 1 1  3 G H5'  H -20.721   9.742 21.155 . . . 1.0 . . . . . . . . . . . . A .  3 G H5'  . . . . . . . . . rr_2l5z 1 
       .  2 .   927 . 1 1  3 G H5'' H -20.848   8.171 21.973 . . . 1.0 . . . . . . . . . . . . A .  3 G H5'' . . . . . . . . . rr_2l5z 1 
       .  2 .   928 . 1 1  3 G H8   H -20.390  11.351 24.960 . . . 1.0 . . . . . . . . . . . . A .  3 G H8   . . . . . . . . . rr_2l5z 1 
       .  2 .   929 . 1 1  3 G HO2' H -16.718   8.121 23.188 . . . 1.0 . . . . . . . . . . . . A .  3 G HO2' . . . . . . . . . rr_2l5z 1 
       .  2 .   930 . 1 1  3 G N1   N -16.534  13.700 27.955 . . . 1.0 . . . . . . . . . . . . A .  3 G N1   . . . . . . . . . rr_2l5z 1 
       .  2 .   931 . 1 1  3 G N2   N -14.401  13.207 27.226 . . . 1.0 . . . . . . . . . . . . A .  3 G N2   . . . . . . . . . rr_2l5z 1 
       .  2 .   932 . 1 1  3 G N3   N -16.168  12.288 26.053 . . . 1.0 . . . . . . . . . . . . A .  3 G N3   . . . . . . . . . rr_2l5z 1 
       .  2 .   933 . 1 1  3 G N7   N -19.738  12.544 26.524 . . . 1.0 . . . . . . . . . . . . A .  3 G N7   . . . . . . . . . rr_2l5z 1 
       .  2 .   934 . 1 1  3 G N9   N -18.286  11.541 25.130 . . . 1.0 . . . . . . . . . . . . A .  3 G N9   . . . . . . . . . rr_2l5z 1 
       .  2 .   935 . 1 1  3 G O2'  O -16.484   8.677 23.934 . . . 1.0 . . . . . . . . . . . . A .  3 G O2'  . . . . . . . . . rr_2l5z 1 
       .  2 .   936 . 1 1  3 G O3'  O -18.554   7.221 23.476 . . . 1.0 . . . . . . . . . . . . A .  3 G O3'  . . . . . . . . . rr_2l5z 1 
       .  2 .   937 . 1 1  3 G O4'  O -18.859  10.703 22.952 . . . 1.0 . . . . . . . . . . . . A .  3 G O4'  . . . . . . . . . rr_2l5z 1 
       .  2 .   938 . 1 1  3 G O5'  O -21.539   9.789 23.047 . . . 1.0 . . . . . . . . . . . . A .  3 G O5'  . . . . . . . . . rr_2l5z 1 
       .  2 .   939 . 1 1  3 G O6   O -18.564  14.275 28.799 . . . 1.0 . . . . . . . . . . . . A .  3 G O6   . . . . . . . . . rr_2l5z 1 
       .  2 .   940 . 1 1  3 G OP1  O -23.603   8.899 21.942 . . . 1.0 . . . . . . . . . . . . A .  3 G OP1  . . . . . . . . . rr_2l5z 1 
       .  2 .   941 . 1 1  3 G OP2  O -23.761  10.692 23.765 . . . 1.0 . . . . . . . . . . . . A .  3 G OP2  . . . . . . . . . rr_2l5z 1 
       .  2 .   942 . 1 1  3 G P    P -23.054  10.103 22.606 . . . 1.0 . . . . . . . . . . . . A .  3 G P    . . . . . . . . . rr_2l5z 1 
       .  2 .   943 . 1 1  4 C C1'  C -15.940   8.111 28.332 . . . 1.0 . . . . . . . . . . . . A .  4 C C1'  . . . . . . . . . rr_2l5z 1 
       .  2 .   944 . 1 1  4 C C2   C -16.679   9.992 29.801 . . . 1.0 . . . . . . . . . . . . A .  4 C C2   . . . . . . . . . rr_2l5z 1 
       .  2 .   945 . 1 1  4 C C2'  C -15.960   6.811 29.151 . . . 1.0 . . . . . . . . . . . . A .  4 C C2'  . . . . . . . . . rr_2l5z 1 
       .  2 .   946 . 1 1  4 C C3'  C -16.385   5.750 28.137 . . . 1.0 . . . . . . . . . . . . A .  4 C C3'  . . . . . . . . . rr_2l5z 1 
       .  2 .   947 . 1 1  4 C C4   C -18.886  10.788 29.711 . . . 1.0 . . . . . . . . . . . . A .  4 C C4   . . . . . . . . . rr_2l5z 1 
       .  2 .   948 . 1 1  4 C C4'  C -15.938   6.348 26.816 . . . 1.0 . . . . . . . . . . . . A .  4 C C4'  . . . . . . . . . rr_2l5z 1 
       .  2 .   949 . 1 1  4 C C5   C -19.223   9.836 28.699 . . . 1.0 . . . . . . . . . . . . A .  4 C C5   . . . . . . . . . rr_2l5z 1 
       .  2 .   950 . 1 1  4 C C5'  C -16.710   5.766 25.632 . . . 1.0 . . . . . . . . . . . . A .  4 C C5'  . . . . . . . . . rr_2l5z 1 
       .  2 .   951 . 1 1  4 C C6   C -18.257   8.993 28.280 . . . 1.0 . . . . . . . . . . . . A .  4 C C6   . . . . . . . . . rr_2l5z 1 
       .  2 .   952 . 1 1  4 C H1'  H -14.948   8.570 28.405 . . . 1.0 . . . . . . . . . . . . A .  4 C H1'  . . . . . . . . . rr_2l5z 1 
       .  2 .   953 . 1 1  4 C H2'  H -16.705   6.889 29.948 . . . 1.0 . . . . . . . . . . . . A .  4 C H2'  . . . . . . . . . rr_2l5z 1 
       .  2 .   954 . 1 1  4 C H3'  H -17.462   5.563 28.165 . . . 1.0 . . . . . . . . . . . . A .  4 C H3'  . . . . . . . . . rr_2l5z 1 
       .  2 .   955 . 1 1  4 C H4'  H -14.872   6.177 26.677 . . . 1.0 . . . . . . . . . . . . A .  4 C H4'  . . . . . . . . . rr_2l5z 1 
       .  2 .   956 . 1 1  4 C H41  H -19.583  12.311 30.868 . . . 1.0 . . . . . . . . . . . . A .  4 C H41  . . . . . . . . . rr_2l5z 1 
       .  2 .   957 . 1 1  4 C H42  H -20.750  11.601 29.777 . . . 1.0 . . . . . . . . . . . . A .  4 C H42  . . . . . . . . . rr_2l5z 1 
       .  2 .   958 . 1 1  4 C H5   H -20.218   9.794 28.283 . . . 1.0 . . . . . . . . . . . . A .  4 C H5   . . . . . . . . . rr_2l5z 1 
       .  2 .   959 . 1 1  4 C H5'  H -16.284   6.153 24.705 . . . 1.0 . . . . . . . . . . . . A .  4 C H5'  . . . . . . . . . rr_2l5z 1 
       .  2 .   960 . 1 1  4 C H5'' H -16.611   4.681 25.641 . . . 1.0 . . . . . . . . . . . . A .  4 C H5'' . . . . . . . . . rr_2l5z 1 
       .  2 .   961 . 1 1  4 C H6   H -18.491   8.235 27.545 . . . 1.0 . . . . . . . . . . . . A .  4 C H6   . . . . . . . . . rr_2l5z 1 
       .  2 .   962 . 1 1  4 C HO2' H -14.802   6.162 30.575 . . . 1.0 . . . . . . . . . . . . A .  4 C HO2' . . . . . . . . . rr_2l5z 1 
       .  2 .   963 . 1 1  4 C N1   N -16.998   9.055 28.808 . . . 1.0 . . . . . . . . . . . . A .  4 C N1   . . . . . . . . . rr_2l5z 1 
       .  2 .   964 . 1 1  4 C N3   N -17.652  10.841 30.225 . . . 1.0 . . . . . . . . . . . . A .  4 C N3   . . . . . . . . . rr_2l5z 1 
       .  2 .   965 . 1 1  4 C N4   N -19.815  11.636 30.154 . . . 1.0 . . . . . . . . . . . . A .  4 C N4   . . . . . . . . . rr_2l5z 1 
       .  2 .   966 . 1 1  4 C O2   O -15.543  10.029 30.272 . . . 1.0 . . . . . . . . . . . . A .  4 C O2   . . . . . . . . . rr_2l5z 1 
       .  2 .   967 . 1 1  4 C O2'  O -14.668   6.521 29.696 . . . 1.0 . . . . . . . . . . . . A .  4 C O2'  . . . . . . . . . rr_2l5z 1 
       .  2 .   968 . 1 1  4 C O3'  O -15.623   4.561 28.375 . . . 1.0 . . . . . . . . . . . . A .  4 C O3'  . . . . . . . . . rr_2l5z 1 
       .  2 .   969 . 1 1  4 C O4'  O -16.171   7.740 26.962 . . . 1.0 . . . . . . . . . . . . A .  4 C O4'  . . . . . . . . . rr_2l5z 1 
       .  2 .   970 . 1 1  4 C O5'  O -18.098   6.108 25.683 . . . 1.0 . . . . . . . . . . . . A .  4 C O5'  . . . . . . . . . rr_2l5z 1 
       .  2 .   971 . 1 1  4 C OP1  O -18.633   4.724 23.665 . . . 1.0 . . . . . . . . . . . . A .  4 C OP1  . . . . . . . . . rr_2l5z 1 
       .  2 .   972 . 1 1  4 C OP2  O -20.429   6.179 24.770 . . . 1.0 . . . . . . . . . . . . A .  4 C OP2  . . . . . . . . . rr_2l5z 1 
       .  2 .   973 . 1 1  4 C P    P -19.020   5.965 24.371 . . . 1.0 . . . . . . . . . . . . A .  4 C P    . . . . . . . . . rr_2l5z 1 
       .  2 .   974 . 1 1  5 U C1'  C -15.465   6.881 33.392 . . . 1.0 . . . . . . . . . . . . A .  5 U C1'  . . . . . . . . . rr_2l5z 1 
       .  2 .   975 . 1 1  5 U C2   C -17.496   8.152 34.049 . . . 1.0 . . . . . . . . . . . . A .  5 U C2   . . . . . . . . . rr_2l5z 1 
       .  2 .   976 . 1 1  5 U C2'  C -15.181   5.890 34.528 . . . 1.0 . . . . . . . . . . . . A .  5 U C2'  . . . . . . . . . rr_2l5z 1 
       .  2 .   977 . 1 1  5 U C3'  C -14.881   4.592 33.794 . . . 1.0 . . . . . . . . . . . . A .  5 U C3'  . . . . . . . . . rr_2l5z 1 
       .  2 .   978 . 1 1  5 U C4   C -19.701   7.617 33.081 . . . 1.0 . . . . . . . . . . . . A .  5 U C4   . . . . . . . . . rr_2l5z 1 
       .  2 .   979 . 1 1  5 U C4'  C -14.287   5.071 32.475 . . . 1.0 . . . . . . . . . . . . A .  5 U C4'  . . . . . . . . . rr_2l5z 1 
       .  2 .   980 . 1 1  5 U C5   C -19.034   6.589 32.315 . . . 1.0 . . . . . . . . . . . . A .  5 U C5   . . . . . . . . . rr_2l5z 1 
       .  2 .   981 . 1 1  5 U C5'  C -14.478   4.055 31.346 . . . 1.0 . . . . . . . . . . . . A .  5 U C5'  . . . . . . . . . rr_2l5z 1 
       .  2 .   982 . 1 1  5 U C6   C -17.699   6.388 32.430 . . . 1.0 . . . . . . . . . . . . A .  5 U C6   . . . . . . . . . rr_2l5z 1 
       .  2 .   983 . 1 1  5 U H1'  H -14.921   7.813 33.578 . . . 1.0 . . . . . . . . . . . . A .  5 U H1'  . . . . . . . . . rr_2l5z 1 
       .  2 .   984 . 1 1  5 U H2'  H -16.074   5.771 35.151 . . . 1.0 . . . . . . . . . . . . A .  5 U H2'  . . . . . . . . . rr_2l5z 1 
       .  2 .   985 . 1 1  5 U H3   H -19.298   9.073 34.504 . . . 1.0 . . . . . . . . . . . . A .  5 U H3   . . . . . . . . . rr_2l5z 1 
       .  2 .   986 . 1 1  5 U H3'  H -15.779   3.987 33.654 . . . 1.0 . . . . . . . . . . . . A .  5 U H3'  . . . . . . . . . rr_2l5z 1 
       .  2 .   987 . 1 1  5 U H4'  H -13.225   5.274 32.606 . . . 1.0 . . . . . . . . . . . . A .  5 U H4'  . . . . . . . . . rr_2l5z 1 
       .  2 .   988 . 1 1  5 U H5   H -19.614   5.949 31.665 . . . 1.0 . . . . . . . . . . . . A .  5 U H5   . . . . . . . . . rr_2l5z 1 
       .  2 .   989 . 1 1  5 U H5'  H -13.782   4.287 30.539 . . . 1.0 . . . . . . . . . . . . A .  5 U H5'  . . . . . . . . . rr_2l5z 1 
       .  2 .   990 . 1 1  5 U H5'' H -14.267   3.053 31.721 . . . 1.0 . . . . . . . . . . . . A .  5 U H5'' . . . . . . . . . rr_2l5z 1 
       .  2 .   991 . 1 1  5 U H6   H -17.231   5.609 31.846 . . . 1.0 . . . . . . . . . . . . A .  5 U H6   . . . . . . . . . rr_2l5z 1 
       .  2 .   992 . 1 1  5 U HO2' H -14.107   7.269 35.387 . . . 1.0 . . . . . . . . . . . . A .  5 U HO2' . . . . . . . . . rr_2l5z 1 
       .  2 .   993 . 1 1  5 U N1   N -16.930   7.144 33.273 . . . 1.0 . . . . . . . . . . . . A .  5 U N1   . . . . . . . . . rr_2l5z 1 
       .  2 .   994 . 1 1  5 U N3   N -18.860   8.337 33.912 . . . 1.0 . . . . . . . . . . . . A .  5 U N3   . . . . . . . . . rr_2l5z 1 
       .  2 .   995 . 1 1  5 U O2   O -16.822   8.839 34.811 . . . 1.0 . . . . . . . . . . . . A .  5 U O2   . . . . . . . . . rr_2l5z 1 
       .  2 .   996 . 1 1  5 U O2'  O -14.064   6.312 35.318 . . . 1.0 . . . . . . . . . . . . A .  5 U O2'  . . . . . . . . . rr_2l5z 1 
       .  2 .   997 . 1 1  5 U O3'  O -13.862   3.891 34.515 . . . 1.0 . . . . . . . . . . . . A .  5 U O3'  . . . . . . . . . rr_2l5z 1 
       .  2 .   998 . 1 1  5 U O4   O -20.902   7.873 33.032 . . . 1.0 . . . . . . . . . . . . A .  5 U O4   . . . . . . . . . rr_2l5z 1 
       .  2 .   999 . 1 1  5 U O4'  O -14.961   6.291 32.182 . . . 1.0 . . . . . . . . . . . . A .  5 U O4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1000 . 1 1  5 U O5'  O -15.812   4.091 30.833 . . . 1.0 . . . . . . . . . . . . A .  5 U O5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1001 . 1 1  5 U OP1  O -15.325   2.226 29.234 . . . 1.0 . . . . . . . . . . . . A .  5 U OP1  . . . . . . . . . rr_2l5z 1 
       .  2 .  1002 . 1 1  5 U OP2  O -17.626   3.353 29.272 . . . 1.0 . . . . . . . . . . . . A .  5 U OP2  . . . . . . . . . rr_2l5z 1 
       .  2 .  1003 . 1 1  5 U P    P -16.154   3.440 29.402 . . . 1.0 . . . . . . . . . . . . A .  5 U P    . . . . . . . . . rr_2l5z 1 
       .  2 .  1004 . 1 1  6 G C1'  C -18.445   5.206 37.889 . . . 1.0 . . . . . . . . . . . . A .  6 G C1'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1005 . 1 1  6 G C2   C -20.764   8.947 37.422 . . . 1.0 . . . . . . . . . . . . A .  6 G C2   . . . . . . . . . rr_2l5z 1 
       .  2 .  1006 . 1 1  6 G C2'  C -18.997   4.162 38.867 . . . 1.0 . . . . . . . . . . . . A .  6 G C2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1007 . 1 1  6 G C3'  C -18.014   2.985 38.754 . . . 1.0 . . . . . . . . . . . . A .  6 G C3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1008 . 1 1  6 G C4   C -20.158   6.862 36.910 . . . 1.0 . . . . . . . . . . . . A .  6 G C4   . . . . . . . . . rr_2l5z 1 
       .  2 .  1009 . 1 1  6 G C4'  C -16.811   3.588 38.032 . . . 1.0 . . . . . . . . . . . . A .  6 G C4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1010 . 1 1  6 G C5   C -21.057   6.749 35.859 . . . 1.0 . . . . . . . . . . . . A .  6 G C5   . . . . . . . . . rr_2l5z 1 
       .  2 .  1011 . 1 1  6 G C5'  C -16.021   2.545 37.236 . . . 1.0 . . . . . . . . . . . . A .  6 G C5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1012 . 1 1  6 G C6   C -21.906   7.843 35.544 . . . 1.0 . . . . . . . . . . . . A .  6 G C6   . . . . . . . . . rr_2l5z 1 
       .  2 .  1013 . 1 1  6 G C8   C -20.025   4.929 35.963 . . . 1.0 . . . . . . . . . . . . A .  6 G C8   . . . . . . . . . rr_2l5z 1 
       .  2 .  1014 . 1 1  6 G H1   H -22.272   9.761 36.225 . . . 1.0 . . . . . . . . . . . . A .  6 G H1   . . . . . . . . . rr_2l5z 1 
       .  2 .  1015 . 1 1  6 G H1'  H -18.066   6.059 38.450 . . . 1.0 . . . . . . . . . . . . A .  6 G H1'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1016 . 1 1  6 G H2'  H -19.999   3.856 38.549 . . . 1.0 . . . . . . . . . . . . A .  6 G H2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1017 . 1 1  6 G H21  H -21.309  10.849 37.900 . . . 1.0 . . . . . . . . . . . . A .  6 G H21  . . . . . . . . . rr_2l5z 1 
       .  2 .  1018 . 1 1  6 G H22  H -20.047  10.156 38.895 . . . 1.0 . . . . . . . . . . . . A .  6 G H22  . . . . . . . . . rr_2l5z 1 
       .  2 .  1019 . 1 1  6 G H3'  H -18.447   2.135 38.213 . . . 1.0 . . . . . . . . . . . . A .  6 G H3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1020 . 1 1  6 G H4'  H -16.153   4.064 38.757 . . . 1.0 . . . . . . . . . . . . A .  6 G H4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1021 . 1 1  6 G H5'  H -15.767   1.713 37.894 . . . 1.0 . . . . . . . . . . . . A .  6 G H5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1022 . 1 1  6 G H5'' H -16.640   2.175 36.419 . . . 1.0 . . . . . . . . . . . . A .  6 G H5'' . . . . . . . . . rr_2l5z 1 
       .  2 .  1023 . 1 1  6 G H8   H -19.692   3.922 35.765 . . . 1.0 . . . . . . . . . . . . A .  6 G H8   . . . . . . . . . rr_2l5z 1 
       .  2 .  1024 . 1 1  6 G HO2' H -18.756   5.596 40.162 . . . 1.0 . . . . . . . . . . . . A .  6 G HO2' . . . . . . . . . rr_2l5z 1 
       .  2 .  1025 . 1 1  6 G N1   N -21.687   8.919 36.394 . . . 1.0 . . . . . . . . . . . . A .  6 G N1   . . . . . . . . . rr_2l5z 1 
       .  2 .  1026 . 1 1  6 G N2   N -20.701  10.075 38.130 . . . 1.0 . . . . . . . . . . . . A .  6 G N2   . . . . . . . . . rr_2l5z 1 
       .  2 .  1027 . 1 1  6 G N3   N -19.960   7.921 37.726 . . . 1.0 . . . . . . . . . . . . A .  6 G N3   . . . . . . . . . rr_2l5z 1 
       .  2 .  1028 . 1 1  6 G N7   N -20.955   5.483 35.256 . . . 1.0 . . . . . . . . . . . . A .  6 G N7   . . . . . . . . . rr_2l5z 1 
       .  2 .  1029 . 1 1  6 G N9   N -19.497   5.662 36.959 . . . 1.0 . . . . . . . . . . . . A .  6 G N9   . . . . . . . . . rr_2l5z 1 
       .  2 .  1030 . 1 1  6 G O2'  O -19.031   4.677 40.203 . . . 1.0 . . . . . . . . . . . . A .  6 G O2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1031 . 1 1  6 G O3'  O -17.602   2.624 40.076 . . . 1.0 . . . . . . . . . . . . A .  6 G O3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1032 . 1 1  6 G O4'  O -17.365   4.585 37.188 . . . 1.0 . . . . . . . . . . . . A .  6 G O4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1033 . 1 1  6 G O5'  O -14.817   3.096 36.697 . . . 1.0 . . . . . . . . . . . . A .  6 G O5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1034 . 1 1  6 G O6   O -22.755   7.919 34.658 . . . 1.0 . . . . . . . . . . . . A .  6 G O6   . . . . . . . . . rr_2l5z 1 
       .  2 .  1035 . 1 1  6 G OP1  O -12.940   1.839 35.616 . . . 1.0 . . . . . . . . . . . . A .  6 G OP1  . . . . . . . . . rr_2l5z 1 
       .  2 .  1036 . 1 1  6 G OP2  O -15.287   1.832 34.587 . . . 1.0 . . . . . . . . . . . . A .  6 G OP2  . . . . . . . . . rr_2l5z 1 
       .  2 .  1037 . 1 1  6 G P    P -14.209   2.538 35.315 . . . 1.0 . . . . . . . . . . . . A .  6 G P    . . . . . . . . . rr_2l5z 1 
       .  2 .  1038 . 1 1  7 C C1'  C -18.417   3.953 44.787 . . . 1.0 . . . . . . . . . . . . A .  7 C C1'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1039 . 1 1  7 C C2   C -20.772   4.634 44.883 . . . 1.0 . . . . . . . . . . . . A .  7 C C2   . . . . . . . . . rr_2l5z 1 
       .  2 .  1040 . 1 1  7 C C2'  C -18.481   2.696 45.656 . . . 1.0 . . . . . . . . . . . . A .  7 C C2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1041 . 1 1  7 C C3'  C -17.775   1.659 44.799 . . . 1.0 . . . . . . . . . . . . A .  7 C C3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1042 . 1 1  7 C C4   C -22.118   4.641 42.957 . . . 1.0 . . . . . . . . . . . . A .  7 C C4   . . . . . . . . . rr_2l5z 1 
       .  2 .  1043 . 1 1  7 C C4'  C -16.736   2.491 44.059 . . . 1.0 . . . . . . . . . . . . A .  7 C C4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1044 . 1 1  7 C C5   C -21.026   4.182 42.156 . . . 1.0 . . . . . . . . . . . . A .  7 C C5   . . . . . . . . . rr_2l5z 1 
       .  2 .  1045 . 1 1  7 C C5'  C -16.310   1.835 42.743 . . . 1.0 . . . . . . . . . . . . A .  7 C C5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1046 . 1 1  7 C C6   C -19.845   3.970 42.769 . . . 1.0 . . . . . . . . . . . . A .  7 C C6   . . . . . . . . . rr_2l5z 1 
       .  2 .  1047 . 1 1  7 C H1'  H -18.178   4.813 45.415 . . . 1.0 . . . . . . . . . . . . A .  7 C H1'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1048 . 1 1  7 C H2'  H -19.523   2.403 45.813 . . . 1.0 . . . . . . . . . . . . A .  7 C H2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1049 . 1 1  7 C H3'  H -18.467   1.155 44.123 . . . 1.0 . . . . . . . . . . . . A .  7 C H3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1050 . 1 1  7 C H4'  H -15.863   2.635 44.695 . . . 1.0 . . . . . . . . . . . . A .  7 C H4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1051 . 1 1  7 C H41  H -24.079   5.186 42.953 . . . 1.0 . . . . . . . . . . . . A .  7 C H41  . . . . . . . . . rr_2l5z 1 
       .  2 .  1052 . 1 1  7 C H42  H -23.429   4.705 41.401 . . . 1.0 . . . . . . . . . . . . A .  7 C H42  . . . . . . . . . rr_2l5z 1 
       .  2 .  1053 . 1 1  7 C H5   H -21.144   4.013 41.096 . . . 1.0 . . . . . . . . . . . . A .  7 C H5   . . . . . . . . . rr_2l5z 1 
       .  2 .  1054 . 1 1  7 C H5'  H -15.925   2.603 42.072 . . . 1.0 . . . . . . . . . . . . A .  7 C H5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1055 . 1 1  7 C H5'' H -15.521   1.110 42.944 . . . 1.0 . . . . . . . . . . . . A .  7 C H5'' . . . . . . . . . rr_2l5z 1 
       .  2 .  1056 . 1 1  7 C H6   H -18.999   3.623 42.193 . . . 1.0 . . . . . . . . . . . . A .  7 C H6   . . . . . . . . . rr_2l5z 1 
       .  2 .  1057 . 1 1  7 C HO2' H -18.134   3.710 47.281 . . . 1.0 . . . . . . . . . . . . A .  7 C HO2' . . . . . . . . . rr_2l5z 1 
       .  2 .  1058 . 1 1  7 C N1   N -19.709   4.188 44.109 . . . 1.0 . . . . . . . . . . . . A .  7 C N1   . . . . . . . . . rr_2l5z 1 
       .  2 .  1059 . 1 1  7 C N3   N -21.969   4.851 44.271 . . . 1.0 . . . . . . . . . . . . A .  7 C N3   . . . . . . . . . rr_2l5z 1 
       .  2 .  1060 . 1 1  7 C N4   N -23.305   4.862 42.392 . . . 1.0 . . . . . . . . . . . . A .  7 C N4   . . . . . . . . . rr_2l5z 1 
       .  2 .  1061 . 1 1  7 C O2   O -20.622   4.823 46.089 . . . 1.0 . . . . . . . . . . . . A .  7 C O2   . . . . . . . . . rr_2l5z 1 
       .  2 .  1062 . 1 1  7 C O2'  O -17.810   2.887 46.906 . . . 1.0 . . . . . . . . . . . . A .  7 C O2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1063 . 1 1  7 C O3'  O -17.096   0.745 45.663 . . . 1.0 . . . . . . . . . . . . A .  7 C O3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1064 . 1 1  7 C O4'  O -17.361   3.754 43.832 . . . 1.0 . . . . . . . . . . . . A .  7 C O4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1065 . 1 1  7 C O5'  O -17.407   1.166 42.111 . . . 1.0 . . . . . . . . . . . . A .  7 C O5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1066 . 1 1  7 C OP1  O -16.215   0.540 39.998 . . . 1.0 . . . . . . . . . . . . A .  7 C OP1  . . . . . . . . . rr_2l5z 1 
       .  2 .  1067 . 1 1  7 C OP2  O -18.769   0.409 40.150 . . . 1.0 . . . . . . . . . . . . A .  7 C OP2  . . . . . . . . . rr_2l5z 1 
       .  2 .  1068 . 1 1  7 C P    P -17.498   1.076 40.506 . . . 1.0 . . . . . . . . . . . . A .  7 C P    . . . . . . . . . rr_2l5z 1 
       .  2 .  1069 . 1 1  8 A C1'  C -22.736   0.610 44.302 . . . 1.0 . . . . . . . . . . . . A .  8 A C1'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1070 . 1 1  8 A C2   C -25.934   3.642 43.943 . . . 1.0 . . . . . . . . . . . . A .  8 A C2   . . . . . . . . . rr_2l5z 1 
       .  2 .  1071 . 1 1  8 A C2'  C -21.487   0.876 43.483 . . . 1.0 . . . . . . . . . . . . A .  8 A C2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1072 . 1 1  8 A C3'  C -20.920  -0.523 43.304 . . . 1.0 . . . . . . . . . . . . A .  8 A C3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1073 . 1 1  8 A C4   C -24.164   2.682 44.852 . . . 1.0 . . . . . . . . . . . . A .  8 A C4   . . . . . . . . . rr_2l5z 1 
       .  2 .  1074 . 1 1  8 A C4'  C -21.371  -1.274 44.579 . . . 1.0 . . . . . . . . . . . . A .  8 A C4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1075 . 1 1  8 A C5   C -24.080   3.617 45.859 . . . 1.0 . . . . . . . . . . . . A .  8 A C5   . . . . . . . . . rr_2l5z 1 
       .  2 .  1076 . 1 1  8 A C5'  C -20.228  -1.504 45.579 . . . 1.0 . . . . . . . . . . . . A .  8 A C5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1077 . 1 1  8 A C6   C -25.042   4.633 45.850 . . . 1.0 . . . . . . . . . . . . A .  8 A C6   . . . . . . . . . rr_2l5z 1 
       .  2 .  1078 . 1 1  8 A C8   C -22.513   2.266 46.170 . . . 1.0 . . . . . . . . . . . . A .  8 A C8   . . . . . . . . . rr_2l5z 1 
       .  2 .  1079 . 1 1  8 A H1'  H -23.551   0.313 43.641 . . . 1.0 . . . . . . . . . . . . A .  8 A H1'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1080 . 1 1  8 A H2   H -26.707   3.685 43.176 . . . 1.0 . . . . . . . . . . . . A .  8 A H2   . . . . . . . . . rr_2l5z 1 
       .  2 .  1081 . 1 1  8 A H2'  H -20.789   1.495 44.051 . . . 1.0 . . . . . . . . . . . . A .  8 A H2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1082 . 1 1  8 A H3'  H -19.833  -0.505 43.166 . . . 1.0 . . . . . . . . . . . . A .  8 A H3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1083 . 1 1  8 A H4'  H -21.791  -2.237 44.294 . . . 1.0 . . . . . . . . . . . . A .  8 A H4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1084 . 1 1  8 A H5'  H -20.651  -1.680 46.569 . . . 1.0 . . . . . . . . . . . . A .  8 A H5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1085 . 1 1  8 A H5'' H -19.661  -2.384 45.274 . . . 1.0 . . . . . . . . . . . . A .  8 A H5'' . . . . . . . . . rr_2l5z 1 
       .  2 .  1086 . 1 1  8 A H61  H -25.801   6.315 46.707 . . . 1.0 . . . . . . . . . . . . A .  8 A H61  . . . . . . . . . rr_2l5z 1 
       .  2 .  1087 . 1 1  8 A H62  H -24.400   5.633 47.503 . . . 1.0 . . . . . . . . . . . . A .  8 A H62  . . . . . . . . . rr_2l5z 1 
       .  2 .  1088 . 1 1  8 A H8   H -21.649   1.767 46.582 . . . 1.0 . . . . . . . . . . . . A .  8 A H8   . . . . . . . . . rr_2l5z 1 
       .  2 .  1089 . 1 1  8 A HO2' H -21.454   0.907 41.536 . . . 1.0 . . . . . . . . . . . . A .  8 A HO2' . . . . . . . . . rr_2l5z 1 
       .  2 .  1090 . 1 1  8 A N1   N -25.959   4.607 44.866 . . . 1.0 . . . . . . . . . . . . A .  8 A N1   . . . . . . . . . rr_2l5z 1 
       .  2 .  1091 . 1 1  8 A N3   N -25.071   2.634 43.856 . . . 1.0 . . . . . . . . . . . . A .  8 A N3   . . . . . . . . . rr_2l5z 1 
       .  2 .  1092 . 1 1  8 A N6   N -25.084   5.605 46.760 . . . 1.0 . . . . . . . . . . . . A .  8 A N6   . . . . . . . . . rr_2l5z 1 
       .  2 .  1093 . 1 1  8 A N7   N -22.999   3.335 46.712 . . . 1.0 . . . . . . . . . . . . A .  8 A N7   . . . . . . . . . rr_2l5z 1 
       .  2 .  1094 . 1 1  8 A N9   N -23.134   1.806 45.069 . . . 1.0 . . . . . . . . . . . . A .  8 A N9   . . . . . . . . . rr_2l5z 1 
       .  2 .  1095 . 1 1  8 A O2'  O -21.803   1.479 42.223 . . . 1.0 . . . . . . . . . . . . A .  8 A O2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1096 . 1 1  8 A O3'  O -21.583  -1.124 42.187 . . . 1.0 . . . . . . . . . . . . A .  8 A O3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1097 . 1 1  8 A O4'  O -22.406  -0.476 45.171 . . . 1.0 . . . . . . . . . . . . A .  8 A O4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1098 . 1 1  8 A O5'  O -19.345  -0.381 45.642 . . . 1.0 . . . . . . . . . . . . A .  8 A O5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1099 . 1 1  8 A OP1  O -17.955  -0.389 47.726 . . . 1.0 . . . . . . . . . . . . A .  8 A OP1  . . . . . . . . . rr_2l5z 1 
       .  2 .  1100 . 1 1  8 A OP2  O -17.251  -1.755 45.675 . . . 1.0 . . . . . . . . . . . . A .  8 A OP2  . . . . . . . . . rr_2l5z 1 
       .  2 .  1101 . 1 1  8 A P    P -17.865  -0.540 46.256 . . . 1.0 . . . . . . . . . . . . A .  8 A P    . . . . . . . . . rr_2l5z 1 
       .  2 .  1102 . 1 1  9 G C1'  C -23.765   1.993 40.180 . . . 1.0 . . . . . . . . . . . . A .  9 G C1'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1103 . 1 1  9 G C2   C -25.000   6.232 39.886 . . . 1.0 . . . . . . . . . . . . A .  9 G C2   . . . . . . . . . rr_2l5z 1 
       .  2 .  1104 . 1 1  9 G C2'  C -25.009   1.101 40.231 . . . 1.0 . . . . . . . . . . . . A .  9 G C2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1105 . 1 1  9 G C3'  C -24.510  -0.216 39.659 . . . 1.0 . . . . . . . . . . . . A .  9 G C3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1106 . 1 1  9 G C4   C -24.274   4.276 39.100 . . . 1.0 . . . . . . . . . . . . A .  9 G C4   . . . . . . . . . rr_2l5z 1 
       .  2 .  1107 . 1 1  9 G C4'  C -23.053  -0.232 40.091 . . . 1.0 . . . . . . . . . . . . A .  9 G C4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1108 . 1 1  9 G C5   C -24.207   4.710 37.785 . . . 1.0 . . . . . . . . . . . . A .  9 G C5   . . . . . . . . . rr_2l5z 1 
       .  2 .  1109 . 1 1  9 G C5'  C -22.206  -1.144 39.203 . . . 1.0 . . . . . . . . . . . . A .  9 G C5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1110 . 1 1  9 G C6   C -24.571   6.047 37.470 . . . 1.0 . . . . . . . . . . . . A .  9 G C6   . . . . . . . . . rr_2l5z 1 
       .  2 .  1111 . 1 1  9 G C8   C -23.589   2.709 37.785 . . . 1.0 . . . . . . . . . . . . A .  9 G C8   . . . . . . . . . rr_2l5z 1 
       .  2 .  1112 . 1 1  9 G H1   H -25.253   7.736 38.454 . . . 1.0 . . . . . . . . . . . . A .  9 G H1   . . . . . . . . . rr_2l5z 1 
       .  2 .  1113 . 1 1  9 G H1'  H -23.668   2.529 41.123 . . . 1.0 . . . . . . . . . . . . A .  9 G H1'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1114 . 1 1  9 G H2'  H -25.790   1.515 39.589 . . . 1.0 . . . . . . . . . . . . A .  9 G H2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1115 . 1 1  9 G H21  H -25.655   8.015 40.618 . . . 1.0 . . . . . . . . . . . . A .  9 G H21  . . . . . . . . . rr_2l5z 1 
       .  2 .  1116 . 1 1  9 G H22  H -25.441   6.748 41.806 . . . 1.0 . . . . . . . . . . . . A .  9 G H22  . . . . . . . . . rr_2l5z 1 
       .  2 .  1117 . 1 1  9 G H3'  H -24.624  -0.256 38.574 . . . 1.0 . . . . . . . . . . . . A .  9 G H3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1118 . 1 1  9 G H4'  H -22.983  -0.562 41.126 . . . 1.0 . . . . . . . . . . . . A .  9 G H4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1119 . 1 1  9 G H5'  H -22.724  -2.093 39.071 . . . 1.0 . . . . . . . . . . . . A .  9 G H5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1120 . 1 1  9 G H5'' H -22.074  -0.672 38.229 . . . 1.0 . . . . . . . . . . . . A .  9 G H5'' . . . . . . . . . rr_2l5z 1 
       .  2 .  1121 . 1 1  9 G H8   H -23.241   1.740 37.465 . . . 1.0 . . . . . . . . . . . . A .  9 G H8   . . . . . . . . . rr_2l5z 1 
       .  2 .  1122 . 1 1  9 G HO2' H -25.844   1.788 41.850 . . . 1.0 . . . . . . . . . . . . A .  9 G HO2' . . . . . . . . . rr_2l5z 1 
       .  2 .  1123 . 1 1  9 G N1   N -24.963   6.748 38.605 . . . 1.0 . . . . . . . . . . . . A .  9 G N1   . . . . . . . . . rr_2l5z 1 
       .  2 .  1124 . 1 1  9 G N2   N -25.397   7.065 40.848 . . . 1.0 . . . . . . . . . . . . A .  9 G N2   . . . . . . . . . rr_2l5z 1 
       .  2 .  1125 . 1 1  9 G N3   N -24.658   4.975 40.190 . . . 1.0 . . . . . . . . . . . . A .  9 G N3   . . . . . . . . . rr_2l5z 1 
       .  2 .  1126 . 1 1  9 G N7   N -23.759   3.677 36.945 . . . 1.0 . . . . . . . . . . . . A .  9 G N7   . . . . . . . . . rr_2l5z 1 
       .  2 .  1127 . 1 1  9 G N9   N -23.868   2.967 39.076 . . . 1.0 . . . . . . . . . . . . A .  9 G N9   . . . . . . . . . rr_2l5z 1 
       .  2 .  1128 . 1 1  9 G O2'  O -25.484   0.942 41.573 . . . 1.0 . . . . . . . . . . . . A .  9 G O2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1129 . 1 1  9 G O3'  O -25.194  -1.286 40.318 . . . 1.0 . . . . . . . . . . . . A .  9 G O3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1130 . 1 1  9 G O4'  O -22.631   1.127 40.003 . . . 1.0 . . . . . . . . . . . . A .  9 G O4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1131 . 1 1  9 G O5'  O -20.919  -1.392 39.778 . . . 1.0 . . . . . . . . . . . . A .  9 G O5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1132 . 1 1  9 G O6   O -24.574   6.599 36.372 . . . 1.0 . . . . . . . . . . . . A .  9 G O6   . . . . . . . . . rr_2l5z 1 
       .  2 .  1133 . 1 1  9 G OP1  O -21.538  -3.400 41.142 . . . 1.0 . . . . . . . . . . . . A .  9 G OP1  . . . . . . . . . rr_2l5z 1 
       .  2 .  1134 . 1 1  9 G OP2  O -19.363  -2.124 41.600 . . . 1.0 . . . . . . . . . . . . A .  9 G OP2  . . . . . . . . . rr_2l5z 1 
       .  2 .  1135 . 1 1  9 G P    P -20.789  -2.124 41.206 . . . 1.0 . . . . . . . . . . . . A .  9 G P    . . . . . . . . . rr_2l5z 1 
       .  2 .  1136 . 1 1 10 C C1'  C -28.997   2.420 40.371 . . . 1.0 . . . . . . . . . . . . A . 10 C C1'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1137 . 1 1 10 C C2   C -29.851   3.457 38.316 . . . 1.0 . . . . . . . . . . . . A . 10 C C2   . . . . . . . . . rr_2l5z 1 
       .  2 .  1138 . 1 1 10 C C2'  C -30.302   1.887 40.962 . . . 1.0 . . . . . . . . . . . . A . 10 C C2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1139 . 1 1 10 C C3'  C -29.951   0.450 41.308 . . . 1.0 . . . . . . . . . . . . A . 10 C C3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1140 . 1 1 10 C C4   C -29.251   2.649 36.195 . . . 1.0 . . . . . . . . . . . . A . 10 C C4   . . . . . . . . . rr_2l5z 1 
       .  2 .  1141 . 1 1 10 C C4'  C -28.482   0.554 41.688 . . . 1.0 . . . . . . . . . . . . A . 10 C C4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1142 . 1 1 10 C C5   C -28.447   1.621 36.780 . . . 1.0 . . . . . . . . . . . . A . 10 C C5   . . . . . . . . . rr_2l5z 1 
       .  2 .  1143 . 1 1 10 C C5'  C -27.756  -0.782 41.534 . . . 1.0 . . . . . . . . . . . . A . 10 C C5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1144 . 1 1 10 C C6   C -28.385   1.564 38.126 . . . 1.0 . . . . . . . . . . . . A . 10 C C6   . . . . . . . . . rr_2l5z 1 
       .  2 .  1145 . 1 1 10 C H1'  H -28.805   3.426 40.751 . . . 1.0 . . . . . . . . . . . . A . 10 C H1'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1146 . 1 1 10 C H2'  H -31.091   1.907 40.206 . . . 1.0 . . . . . . . . . . . . A . 10 C H2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1147 . 1 1 10 C H3'  H -30.115  -0.222 40.462 . . . 1.0 . . . . . . . . . . . . A . 10 C H3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1148 . 1 1 10 C H4'  H -28.394   0.901 42.716 . . . 1.0 . . . . . . . . . . . . A . 10 C H4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1149 . 1 1 10 C H41  H -29.902   3.473 34.451 . . . 1.0 . . . . . . . . . . . . A . 10 C H41  . . . . . . . . . rr_2l5z 1 
       .  2 .  1150 . 1 1 10 C H42  H -28.832   2.100 34.280 . . . 1.0 . . . . . . . . . . . . A . 10 C H42  . . . . . . . . . rr_2l5z 1 
       .  2 .  1151 . 1 1 10 C H5   H -27.907   0.916 36.166 . . . 1.0 . . . . . . . . . . . . A . 10 C H5   . . . . . . . . . rr_2l5z 1 
       .  2 .  1152 . 1 1 10 C H5'  H -26.740  -0.678 41.917 . . . 1.0 . . . . . . . . . . . . A . 10 C H5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1153 . 1 1 10 C H5'' H -28.279  -1.540 42.117 . . . 1.0 . . . . . . . . . . . . A . 10 C H5'' . . . . . . . . . rr_2l5z 1 
       .  2 .  1154 . 1 1 10 C H6   H -27.793   0.793 38.602 . . . 1.0 . . . . . . . . . . . . A . 10 C H6   . . . . . . . . . rr_2l5z 1 
       .  2 .  1155 . 1 1 10 C HO2' H -31.583   2.945 41.977 . . . 1.0 . . . . . . . . . . . . A . 10 C HO2' . . . . . . . . . rr_2l5z 1 
       .  2 .  1156 . 1 1 10 C N1   N -29.070   2.463 38.892 . . . 1.0 . . . . . . . . . . . . A . 10 C N1   . . . . . . . . . rr_2l5z 1 
       .  2 .  1157 . 1 1 10 C N3   N -29.919   3.521 36.959 . . . 1.0 . . . . . . . . . . . . A . 10 C N3   . . . . . . . . . rr_2l5z 1 
       .  2 .  1158 . 1 1 10 C N4   N -29.335   2.749 34.868 . . . 1.0 . . . . . . . . . . . . A . 10 C N4   . . . . . . . . . rr_2l5z 1 
       .  2 .  1159 . 1 1 10 C O2   O -30.462   4.254 39.027 . . . 1.0 . . . . . . . . . . . . A . 10 C O2   . . . . . . . . . rr_2l5z 1 
       .  2 .  1160 . 1 1 10 C O2'  O -30.691   2.625 42.127 . . . 1.0 . . . . . . . . . . . . A . 10 C O2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1161 . 1 1 10 C O3'  O -30.698   0.065 42.465 . . . 1.0 . . . . . . . . . . . . A . 10 C O3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1162 . 1 1 10 C O4'  O -27.945   1.543 40.811 . . . 1.0 . . . . . . . . . . . . A . 10 C O4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1163 . 1 1 10 C O5'  O -27.703  -1.200 40.166 . . . 1.0 . . . . . . . . . . . . A . 10 C O5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1164 . 1 1 10 C OP1  O -26.516  -3.406 40.125 . . . 1.0 . . . . . . . . . . . . A . 10 C OP1  . . . . . . . . . rr_2l5z 1 
       .  2 .  1165 . 1 1 10 C OP2  O -26.339  -1.788 38.147 . . . 1.0 . . . . . . . . . . . . A . 10 C OP2  . . . . . . . . . rr_2l5z 1 
       .  2 .  1166 . 1 1 10 C P    P -26.436  -2.023 39.605 . . . 1.0 . . . . . . . . . . . . A . 10 C P    . . . . . . . . . rr_2l5z 1 
       .  2 .  1167 . 1 1 11 A C1'  C -35.556   2.587 40.218 . . . 1.0 . . . . . . . . . . . . A . 11 A C1'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1168 . 1 1 11 A C2   C -35.459   4.234 36.105 . . . 1.0 . . . . . . . . . . . . A . 11 A C2   . . . . . . . . . rr_2l5z 1 
       .  2 .  1169 . 1 1 11 A C2'  C -36.602   1.493 40.420 . . . 1.0 . . . . . . . . . . . . A . 11 A C2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1170 . 1 1 11 A C3'  C -35.908   0.554 41.389 . . . 1.0 . . . . . . . . . . . . A . 11 A C3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1171 . 1 1 11 A C4   C -34.824   2.918 37.765 . . . 1.0 . . . . . . . . . . . . A . 11 A C4   . . . . . . . . . rr_2l5z 1 
       .  2 .  1172 . 1 1 11 A C4'  C -35.093   1.510 42.255 . . . 1.0 . . . . . . . . . . . . A . 11 A C4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1173 . 1 1 11 A C5   C -33.859   2.297 37.005 . . . 1.0 . . . . . . . . . . . . A . 11 A C5   . . . . . . . . . rr_2l5z 1 
       .  2 .  1174 . 1 1 11 A C5'  C -33.861   0.833 42.858 . . . 1.0 . . . . . . . . . . . . A . 11 A C5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1175 . 1 1 11 A C6   C -33.734   2.729 35.681 . . . 1.0 . . . . . . . . . . . . A . 11 A C6   . . . . . . . . . rr_2l5z 1 
       .  2 .  1176 . 1 1 11 A C8   C -33.772   1.421 38.904 . . . 1.0 . . . . . . . . . . . . A . 11 A C8   . . . . . . . . . rr_2l5z 1 
       .  2 .  1177 . 1 1 11 A H1'  H -36.056   3.552 40.126 . . . 1.0 . . . . . . . . . . . . A . 11 A H1'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1178 . 1 1 11 A H2   H -36.080   5.036 35.709 . . . 1.0 . . . . . . . . . . . . A . 11 A H2   . . . . . . . . . rr_2l5z 1 
       .  2 .  1179 . 1 1 11 A H2'  H -36.795   0.981 39.476 . . . 1.0 . . . . . . . . . . . . A . 11 A H2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1180 . 1 1 11 A H3'  H -35.286  -0.177 40.867 . . . 1.0 . . . . . . . . . . . . A . 11 A H3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1181 . 1 1 11 A H4'  H -35.721   1.897 43.056 . . . 1.0 . . . . . . . . . . . . A . 11 A H4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1182 . 1 1 11 A H5'  H -33.200   1.597 43.269 . . . 1.0 . . . . . . . . . . . . A . 11 A H5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1183 . 1 1 11 A H5'' H -34.178   0.168 43.661 . . . 1.0 . . . . . . . . . . . . A . 11 A H5'' . . . . . . . . . rr_2l5z 1 
       .  2 .  1184 . 1 1 11 A H61  H -32.790   2.567 33.886 . . . 1.0 . . . . . . . . . . . . A . 11 A H61  . . . . . . . . . rr_2l5z 1 
       .  2 .  1185 . 1 1 11 A H62  H -32.216   1.489 35.138 . . . 1.0 . . . . . . . . . . . . A . 11 A H62  . . . . . . . . . rr_2l5z 1 
       .  2 .  1186 . 1 1 11 A H8   H -33.476   0.813 39.745 . . . 1.0 . . . . . . . . . . . . A . 11 A H8   . . . . . . . . . rr_2l5z 1 
       .  2 .  1187 . 1 1 11 A HO2' H -37.645   2.936 41.208 . . . 1.0 . . . . . . . . . . . . A . 11 A HO2' . . . . . . . . . rr_2l5z 1 
       .  2 .  1188 . 1 1 11 A N1   N -34.560   3.708 35.267 . . . 1.0 . . . . . . . . . . . . A . 11 A N1   . . . . . . . . . rr_2l5z 1 
       .  2 .  1189 . 1 1 11 A N3   N -35.664   3.898 37.378 . . . 1.0 . . . . . . . . . . . . A . 11 A N3   . . . . . . . . . rr_2l5z 1 
       .  2 .  1190 . 1 1 11 A N6   N -32.841   2.221 34.833 . . . 1.0 . . . . . . . . . . . . A . 11 A N6   . . . . . . . . . rr_2l5z 1 
       .  2 .  1191 . 1 1 11 A N7   N -33.180   1.324 37.757 . . . 1.0 . . . . . . . . . . . . A . 11 A N7   . . . . . . . . . rr_2l5z 1 
       .  2 .  1192 . 1 1 11 A N9   N -34.756   2.333 39.005 . . . 1.0 . . . . . . . . . . . . A . 11 A N9   . . . . . . . . . rr_2l5z 1 
       .  2 .  1193 . 1 1 11 A O2'  O -37.812   2.020 40.976 . . . 1.0 . . . . . . . . . . . . A . 11 A O2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1194 . 1 1 11 A O3'  O -36.903  -0.069 42.209 . . . 1.0 . . . . . . . . . . . . A . 11 A O3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1195 . 1 1 11 A O4'  O -34.724   2.590 41.391 . . . 1.0 . . . . . . . . . . . . A . 11 A O4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1196 . 1 1 11 A O5'  O -33.143   0.076 41.881 . . . 1.0 . . . . . . . . . . . . A . 11 A O5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1197 . 1 1 11 A OP1  O -32.285  -1.454 43.669 . . . 1.0 . . . . . . . . . . . . A . 11 A OP1  . . . . . . . . . rr_2l5z 1 
       .  2 .  1198 . 1 1 11 A OP2  O -31.699  -1.858 41.207 . . . 1.0 . . . . . . . . . . . . A . 11 A OP2  . . . . . . . . . rr_2l5z 1 
       .  2 .  1199 . 1 1 11 A P    P -31.962  -0.923 42.326 . . . 1.0 . . . . . . . . . . . . A . 11 A P    . . . . . . . . . rr_2l5z 1 
       .  2 .  1200 . 1 1 12 C C1'  C -39.329   0.193 37.158 . . . 1.0 . . . . . . . . . . . . A . 12 C C1'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1201 . 1 1 12 C C2   C -38.013   0.189 35.061 . . . 1.0 . . . . . . . . . . . . A . 12 C C2   . . . . . . . . . rr_2l5z 1 
       .  2 .  1202 . 1 1 12 C C2'  C -40.368  -0.919 36.955 . . . 1.0 . . . . . . . . . . . . A . 12 C C2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1203 . 1 1 12 C C3'  C -40.497  -1.547 38.341 . . . 1.0 . . . . . . . . . . . . A . 12 C C3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1204 . 1 1 12 C C4   C -35.813  -0.631 35.014 . . . 1.0 . . . . . . . . . . . . A . 12 C C4   . . . . . . . . . rr_2l5z 1 
       .  2 .  1205 . 1 1 12 C C4'  C -40.103  -0.411 39.268 . . . 1.0 . . . . . . . . . . . . A . 12 C C4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1206 . 1 1 12 C C5   C -35.867  -0.943 36.409 . . . 1.0 . . . . . . . . . . . . A . 12 C C5   . . . . . . . . . rr_2l5z 1 
       .  2 .  1207 . 1 1 12 C C5'  C -39.610  -0.910 40.628 . . . 1.0 . . . . . . . . . . . . A . 12 C C5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1208 . 1 1 12 C C6   C -37.009  -0.672 37.069 . . . 1.0 . . . . . . . . . . . . A . 12 C C6   . . . . . . . . . rr_2l5z 1 
       .  2 .  1209 . 1 1 12 C H1'  H -39.742   1.146 36.818 . . . 1.0 . . . . . . . . . . . . A . 12 C H1'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1210 . 1 1 12 C H2'  H -39.988  -1.658 36.242 . . . 1.0 . . . . . . . . . . . . A . 12 C H2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1211 . 1 1 12 C H3'  H -39.849  -2.418 38.459 . . . 1.0 . . . . . . . . . . . . A . 12 C H3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1212 . 1 1 12 C H4'  H -40.952   0.255 39.407 . . . 1.0 . . . . . . . . . . . . A . 12 C H4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1213 . 1 1 12 C H41  H -34.655  -0.663 33.340 . . . 1.0 . . . . . . . . . . . . A . 12 C H41  . . . . . . . . . rr_2l5z 1 
       .  2 .  1214 . 1 1 12 C H42  H -33.901  -1.291 34.787 . . . 1.0 . . . . . . . . . . . . A . 12 C H42  . . . . . . . . . rr_2l5z 1 
       .  2 .  1215 . 1 1 12 C H5   H -35.021  -1.384 36.915 . . . 1.0 . . . . . . . . . . . . A . 12 C H5   . . . . . . . . . rr_2l5z 1 
       .  2 .  1216 . 1 1 12 C H5'  H -39.657  -0.090 41.343 . . . 1.0 . . . . . . . . . . . . A . 12 C H5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1217 . 1 1 12 C H5'' H -40.256  -1.719 40.976 . . . 1.0 . . . . . . . . . . . . A . 12 C H5'' . . . . . . . . . rr_2l5z 1 
       .  2 .  1218 . 1 1 12 C H6   H -37.090  -0.914 38.120 . . . 1.0 . . . . . . . . . . . . A . 12 C H6   . . . . . . . . . rr_2l5z 1 
       .  2 .  1219 . 1 1 12 C HO2' H -42.010   0.083 37.251 . . . 1.0 . . . . . . . . . . . . A . 12 C HO2' . . . . . . . . . rr_2l5z 1 
       .  2 .  1220 . 1 1 12 C N1   N -38.073  -0.113 36.421 . . . 1.0 . . . . . . . . . . . . A . 12 C N1   . . . . . . . . . rr_2l5z 1 
       .  2 .  1221 . 1 1 12 C N3   N -36.863  -0.086 34.388 . . . 1.0 . . . . . . . . . . . . A . 12 C N3   . . . . . . . . . rr_2l5z 1 
       .  2 .  1222 . 1 1 12 C N4   N -34.700  -0.882 34.325 . . . 1.0 . . . . . . . . . . . . A . 12 C N4   . . . . . . . . . rr_2l5z 1 
       .  2 .  1223 . 1 1 12 C O2   O -38.983   0.693 34.497 . . . 1.0 . . . . . . . . . . . . A . 12 C O2   . . . . . . . . . rr_2l5z 1 
       .  2 .  1224 . 1 1 12 C O2'  O -41.619  -0.385 36.509 . . . 1.0 . . . . . . . . . . . . A . 12 C O2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1225 . 1 1 12 C O3'  O -41.873  -1.860 38.572 . . . 1.0 . . . . . . . . . . . . A . 12 C O3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1226 . 1 1 12 C O4'  O -39.079   0.281 38.569 . . . 1.0 . . . . . . . . . . . . A . 12 C O4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1227 . 1 1 12 C O5'  O -38.263  -1.385 40.557 . . . 1.0 . . . . . . . . . . . . A . 12 C O5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1228 . 1 1 12 C OP1  O -38.303  -1.995 42.986 . . . 1.0 . . . . . . . . . . . . A . 12 C OP1  . . . . . . . . . rr_2l5z 1 
       .  2 .  1229 . 1 1 12 C OP2  O -36.204  -2.388 41.571 . . . 1.0 . . . . . . . . . . . . A . 12 C OP2  . . . . . . . . . rr_2l5z 1 
       .  2 .  1230 . 1 1 12 C P    P -37.393  -1.572 41.898 . . . 1.0 . . . . . . . . . . . . A . 12 C P    . . . . . . . . . rr_2l5z 1 
       .  2 .  1231 . 1 1 13 G C1'  C -39.641  -3.395 33.258 . . . 1.0 . . . . . . . . . . . . A . 13 G C1'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1232 . 1 1 13 G C2   C -36.128  -2.952 30.599 . . . 1.0 . . . . . . . . . . . . A . 13 G C2   . . . . . . . . . rr_2l5z 1 
       .  2 .  1233 . 1 1 13 G C2'  C -40.042  -4.781 32.743 . . . 1.0 . . . . . . . . . . . . A . 13 G C2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1234 . 1 1 13 G C3'  C -40.706  -5.422 33.952 . . . 1.0 . . . . . . . . . . . . A . 13 G C3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1235 . 1 1 13 G C4   C -37.170  -3.185 32.558 . . . 1.0 . . . . . . . . . . . . A . 13 G C4   . . . . . . . . . rr_2l5z 1 
       .  2 .  1236 . 1 1 13 G C4'  C -41.294  -4.226 34.686 . . . 1.0 . . . . . . . . . . . . A . 13 G C4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1237 . 1 1 13 G C5   C -35.997  -3.192 33.299 . . . 1.0 . . . . . . . . . . . . A . 13 G C5   . . . . . . . . . rr_2l5z 1 
       .  2 .  1238 . 1 1 13 G C5'  C -41.503  -4.510 36.176 . . . 1.0 . . . . . . . . . . . . A . 13 G C5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1239 . 1 1 13 G C6   C -34.748  -3.067 32.634 . . . 1.0 . . . . . . . . . . . . A . 13 G C6   . . . . . . . . . rr_2l5z 1 
       .  2 .  1240 . 1 1 13 G C8   C -37.571  -3.398 34.666 . . . 1.0 . . . . . . . . . . . . A . 13 G C8   . . . . . . . . . rr_2l5z 1 
       .  2 .  1241 . 1 1 13 G H1   H -34.041  -2.854 30.701 . . . 1.0 . . . . . . . . . . . . A . 13 G H1   . . . . . . . . . rr_2l5z 1 
       .  2 .  1242 . 1 1 13 G H1'  H -39.939  -2.642 32.530 . . . 1.0 . . . . . . . . . . . . A . 13 G H1'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1243 . 1 1 13 G H2'  H -39.150  -5.348 32.463 . . . 1.0 . . . . . . . . . . . . A . 13 G H2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1244 . 1 1 13 G H21  H -35.186  -2.739 28.807 . . . 1.0 . . . . . . . . . . . . A . 13 G H21  . . . . . . . . . rr_2l5z 1 
       .  2 .  1245 . 1 1 13 G H22  H -36.932  -2.822 28.733 . . . 1.0 . . . . . . . . . . . . A . 13 G H22  . . . . . . . . . rr_2l5z 1 
       .  2 .  1246 . 1 1 13 G H3'  H -39.989  -5.974 34.565 . . . 1.0 . . . . . . . . . . . . A . 13 G H3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1247 . 1 1 13 G H4'  H -42.243  -3.950 34.231 . . . 1.0 . . . . . . . . . . . . A . 13 G H4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1248 . 1 1 13 G H5'  H -41.947  -5.499 36.296 . . . 1.0 . . . . . . . . . . . . A . 13 G H5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1249 . 1 1 13 G H5'' H -40.538  -4.488 36.682 . . . 1.0 . . . . . . . . . . . . A . 13 G H5'' . . . . . . . . . rr_2l5z 1 
       .  2 .  1250 . 1 1 13 G H8   H -38.132  -3.509 35.581 . . . 1.0 . . . . . . . . . . . . A . 13 G H8   . . . . . . . . . rr_2l5z 1 
       .  2 .  1251 . 1 1 13 G HO2' H -40.567  -5.178 30.911 . . . 1.0 . . . . . . . . . . . . A . 13 G HO2' . . . . . . . . . rr_2l5z 1 
       .  2 .  1252 . 1 1 13 G N1   N -34.913  -2.951 31.258 . . . 1.0 . . . . . . . . . . . . A . 13 G N1   . . . . . . . . . rr_2l5z 1 
       .  2 .  1253 . 1 1 13 G N2   N -36.078  -2.828 29.272 . . . 1.0 . . . . . . . . . . . . A . 13 G N2   . . . . . . . . . rr_2l5z 1 
       .  2 .  1254 . 1 1 13 G N3   N -37.307  -3.069 31.218 . . . 1.0 . . . . . . . . . . . . A . 13 G N3   . . . . . . . . . rr_2l5z 1 
       .  2 .  1255 . 1 1 13 G N7   N -36.280  -3.332 34.669 . . . 1.0 . . . . . . . . . . . . A . 13 G N7   . . . . . . . . . rr_2l5z 1 
       .  2 .  1256 . 1 1 13 G N9   N -38.183  -3.320 33.471 . . . 1.0 . . . . . . . . . . . . A . 13 G N9   . . . . . . . . . rr_2l5z 1 
       .  2 .  1257 . 1 1 13 G O2'  O -40.950  -4.686 31.640 . . . 1.0 . . . . . . . . . . . . A . 13 G O2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1258 . 1 1 13 G O3'  O -41.780  -6.248 33.494 . . . 1.0 . . . . . . . . . . . . A . 13 G O3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1259 . 1 1 13 G O4'  O -40.355  -3.174 34.485 . . . 1.0 . . . . . . . . . . . . A . 13 G O4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1260 . 1 1 13 G O5'  O -42.366  -3.541 36.775 . . . 1.0 . . . . . . . . . . . . A . 13 G O5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1261 . 1 1 13 G O6   O -33.621  -3.055 33.123 . . . 1.0 . . . . . . . . . . . . A . 13 G O6   . . . . . . . . . rr_2l5z 1 
       .  2 .  1262 . 1 1 13 G OP1  O -43.828  -3.409 38.804 . . . 1.0 . . . . . . . . . . . . A . 13 G OP1  . . . . . . . . . rr_2l5z 1 
       .  2 .  1263 . 1 1 13 G OP2  O -41.428  -4.293 38.972 . . . 1.0 . . . . . . . . . . . . A . 13 G OP2  . . . . . . . . . rr_2l5z 1 
       .  2 .  1264 . 1 1 13 G P    P -42.412  -3.363 38.373 . . . 1.0 . . . . . . . . . . . . A . 13 G P    . . . . . . . . . rr_2l5z 1 
       .  2 .  1265 . 1 1 14 A C1'  C -41.910  -9.071 28.383 . . . 1.0 . . . . . . . . . . . . A . 14 A C1'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1266 . 1 1 14 A C2   C -43.757  -6.208 25.561 . . . 1.0 . . . . . . . . . . . . A . 14 A C2   . . . . . . . . . rr_2l5z 1 
       .  2 .  1267 . 1 1 14 A C2'  C -40.536  -8.488 28.067 . . . 1.0 . . . . . . . . . . . . A . 14 A C2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1268 . 1 1 14 A C3'  C -39.901  -8.377 29.441 . . . 1.0 . . . . . . . . . . . . A . 14 A C3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1269 . 1 1 14 A C4   C -43.422  -7.169 27.522 . . . 1.0 . . . . . . . . . . . . A . 14 A C4   . . . . . . . . . rr_2l5z 1 
       .  2 .  1270 . 1 1 14 A C4'  C -40.482  -9.582 30.178 . . . 1.0 . . . . . . . . . . . . A . 14 A C4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1271 . 1 1 14 A C5   C -44.342  -6.366 28.158 . . . 1.0 . . . . . . . . . . . . A . 14 A C5   . . . . . . . . . rr_2l5z 1 
       .  2 .  1272 . 1 1 14 A C5'  C -40.549  -9.355 31.691 . . . 1.0 . . . . . . . . . . . . A . 14 A C5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1273 . 1 1 14 A C6   C -44.995  -5.417 27.366 . . . 1.0 . . . . . . . . . . . . A . 14 A C6   . . . . . . . . . rr_2l5z 1 
       .  2 .  1274 . 1 1 14 A C8   C -43.567  -7.652 29.616 . . . 1.0 . . . . . . . . . . . . A . 14 A C8   . . . . . . . . . rr_2l5z 1 
       .  2 .  1275 . 1 1 14 A H1'  H -42.198  -9.767 27.593 . . . 1.0 . . . . . . . . . . . . A . 14 A H1'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1276 . 1 1 14 A H2   H -43.541  -6.110 24.497 . . . 1.0 . . . . . . . . . . . . A . 14 A H2   . . . . . . . . . rr_2l5z 1 
       .  2 .  1277 . 1 1 14 A H2'  H -40.642  -7.494 27.621 . . . 1.0 . . . . . . . . . . . . A . 14 A H2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1278 . 1 1 14 A H3'  H -40.146  -7.426 29.921 . . . 1.0 . . . . . . . . . . . . A . 14 A H3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1279 . 1 1 14 A H4'  H -39.871 -10.460 29.973 . . . 1.0 . . . . . . . . . . . . A . 14 A H4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1280 . 1 1 14 A H5'  H -40.940 -10.253 32.168 . . . 1.0 . . . . . . . . . . . . A . 14 A H5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1281 . 1 1 14 A H5'' H -39.545  -9.160 32.067 . . . 1.0 . . . . . . . . . . . . A . 14 A H5'' . . . . . . . . . rr_2l5z 1 
       .  2 .  1282 . 1 1 14 A H61  H -46.352  -3.906 27.227 . . . 1.0 . . . . . . . . . . . . A . 14 A H61  . . . . . . . . . rr_2l5z 1 
       .  2 .  1283 . 1 1 14 A H62  H -46.160  -4.600 28.822 . . . 1.0 . . . . . . . . . . . . A . 14 A H62  . . . . . . . . . rr_2l5z 1 
       .  2 .  1284 . 1 1 14 A H8   H -43.375  -8.148 30.557 . . . 1.0 . . . . . . . . . . . . A . 14 A H8   . . . . . . . . . rr_2l5z 1 
       .  2 .  1285 . 1 1 14 A HO2' H -40.184  -9.314 26.339 . . . 1.0 . . . . . . . . . . . . A . 14 A HO2' . . . . . . . . . rr_2l5z 1 
       .  2 .  1286 . 1 1 14 A N1   N -44.670  -5.371 26.060 . . . 1.0 . . . . . . . . . . . . A . 14 A N1   . . . . . . . . . rr_2l5z 1 
       .  2 .  1287 . 1 1 14 A N3   N -43.079  -7.143 26.219 . . . 1.0 . . . . . . . . . . . . A . 14 A N3   . . . . . . . . . rr_2l5z 1 
       .  2 .  1288 . 1 1 14 A N6   N -45.910  -4.572 27.843 . . . 1.0 . . . . . . . . . . . . A . 14 A N6   . . . . . . . . . rr_2l5z 1 
       .  2 .  1289 . 1 1 14 A N7   N -44.428  -6.691 29.523 . . . 1.0 . . . . . . . . . . . . A . 14 A N7   . . . . . . . . . rr_2l5z 1 
       .  2 .  1290 . 1 1 14 A N9   N -42.924  -8.003 28.488 . . . 1.0 . . . . . . . . . . . . A . 14 A N9   . . . . . . . . . rr_2l5z 1 
       .  2 .  1291 . 1 1 14 A O2'  O -39.783  -9.354 27.209 . . . 1.0 . . . . . . . . . . . . A . 14 A O2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1292 . 1 1 14 A O3'  O -38.490  -8.568 29.302 . . . 1.0 . . . . . . . . . . . . A . 14 A O3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1293 . 1 1 14 A O4'  O -41.786  -9.783 29.625 . . . 1.0 . . . . . . . . . . . . A . 14 A O4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1294 . 1 1 14 A O5'  O -41.393  -8.247 32.020 . . . 1.0 . . . . . . . . . . . . A . 14 A O5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1295 . 1 1 14 A OP1  O -42.977  -8.400 33.954 . . . 1.0 . . . . . . . . . . . . A . 14 A OP1  . . . . . . . . . rr_2l5z 1 
       .  2 .  1296 . 1 1 14 A OP2  O -40.453  -8.196 34.341 . . . 1.0 . . . . . . . . . . . . A . 14 A OP2  . . . . . . . . . rr_2l5z 1 
       .  2 .  1297 . 1 1 14 A P    P -41.661  -7.853 33.558 . . . 1.0 . . . . . . . . . . . . A . 14 A P    . . . . . . . . . rr_2l5z 1 
       .  2 .  1298 . 1 1 15 A C1'  C -40.544  -5.022 25.983 . . . 1.0 . . . . . . . . . . . . A . 15 A C1'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1299 . 1 1 15 A C2   C -43.254  -1.536 26.248 . . . 1.0 . . . . . . . . . . . . A . 15 A C2   . . . . . . . . . rr_2l5z 1 
       .  2 .  1300 . 1 1 15 A C2'  C -39.470  -4.146 25.328 . . . 1.0 . . . . . . . . . . . . A . 15 A C2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1301 . 1 1 15 A C3'  C -38.161  -4.807 25.748 . . . 1.0 . . . . . . . . . . . . A . 15 A C3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1302 . 1 1 15 A C4   C -42.053  -3.216 27.033 . . . 1.0 . . . . . . . . . . . . A . 15 A C4   . . . . . . . . . rr_2l5z 1 
       .  2 .  1303 . 1 1 15 A C4'  C -38.564  -6.261 25.965 . . . 1.0 . . . . . . . . . . . . A . 15 A C4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1304 . 1 1 15 A C5   C -42.417  -2.967 28.337 . . . 1.0 . . . . . . . . . . . . A . 15 A C5   . . . . . . . . . rr_2l5z 1 
       .  2 .  1305 . 1 1 15 A C5'  C -37.628  -6.979 26.939 . . . 1.0 . . . . . . . . . . . . A . 15 A C5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1306 . 1 1 15 A C6   C -43.282  -1.889 28.548 . . . 1.0 . . . . . . . . . . . . A . 15 A C6   . . . . . . . . . rr_2l5z 1 
       .  2 .  1307 . 1 1 15 A C8   C -41.134  -4.620 28.385 . . . 1.0 . . . . . . . . . . . . A . 15 A C8   . . . . . . . . . rr_2l5z 1 
       .  2 .  1308 . 1 1 15 A H1'  H -41.283  -5.302 25.232 . . . 1.0 . . . . . . . . . . . . A . 15 A H1'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1309 . 1 1 15 A H2   H -43.599  -0.915 25.422 . . . 1.0 . . . . . . . . . . . . A . 15 A H2   . . . . . . . . . rr_2l5z 1 
       .  2 .  1310 . 1 1 15 A H2'  H -39.524  -3.129 25.730 . . . 1.0 . . . . . . . . . . . . A . 15 A H2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1311 . 1 1 15 A H3'  H -37.742  -4.348 26.648 . . . 1.0 . . . . . . . . . . . . A . 15 A H3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1312 . 1 1 15 A H4'  H -38.566  -6.785 25.010 . . . 1.0 . . . . . . . . . . . . A . 15 A H4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1313 . 1 1 15 A H5'  H -37.899  -8.034 26.981 . . . 1.0 . . . . . . . . . . . . A . 15 A H5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1314 . 1 1 15 A H5'' H -36.602  -6.890 26.578 . . . 1.0 . . . . . . . . . . . . A . 15 A H5'' . . . . . . . . . rr_2l5z 1 
       .  2 .  1315 . 1 1 15 A H61  H -44.344  -0.742 29.852 . . . 1.0 . . . . . . . . . . . . A . 15 A H61  . . . . . . . . . rr_2l5z 1 
       .  2 .  1316 . 1 1 15 A H62  H -43.426  -2.045 30.573 . . . 1.0 . . . . . . . . . . . . A . 15 A H62  . . . . . . . . . rr_2l5z 1 
       .  2 .  1317 . 1 1 15 A H8   H -40.508  -5.430 28.732 . . . 1.0 . . . . . . . . . . . . A . 15 A H8   . . . . . . . . . rr_2l5z 1 
       .  2 .  1318 . 1 1 15 A HO2' H -38.904  -4.674 23.542 . . . 1.0 . . . . . . . . . . . . A . 15 A HO2' . . . . . . . . . rr_2l5z 1 
       .  2 .  1319 . 1 1 15 A N1   N -43.680  -1.195 27.467 . . . 1.0 . . . . . . . . . . . . A . 15 A N1   . . . . . . . . . rr_2l5z 1 
       .  2 .  1320 . 1 1 15 A N3   N -42.438  -2.538 25.935 . . . 1.0 . . . . . . . . . . . . A . 15 A N3   . . . . . . . . . rr_2l5z 1 
       .  2 .  1321 . 1 1 15 A N6   N -43.720  -1.530 29.755 . . . 1.0 . . . . . . . . . . . . A . 15 A N6   . . . . . . . . . rr_2l5z 1 
       .  2 .  1322 . 1 1 15 A N7   N -41.811  -3.888 29.209 . . . 1.0 . . . . . . . . . . . . A . 15 A N7   . . . . . . . . . rr_2l5z 1 
       .  2 .  1323 . 1 1 15 A N9   N -41.216  -4.301 27.080 . . . 1.0 . . . . . . . . . . . . A . 15 A N9   . . . . . . . . . rr_2l5z 1 
       .  2 .  1324 . 1 1 15 A O2'  O -39.609  -4.132 23.903 . . . 1.0 . . . . . . . . . . . . A . 15 A O2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1325 . 1 1 15 A O3'  O -37.256  -4.752 24.642 . . . 1.0 . . . . . . . . . . . . A . 15 A O3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1326 . 1 1 15 A O4'  O -39.893  -6.206 26.470 . . . 1.0 . . . . . . . . . . . . A . 15 A O4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1327 . 1 1 15 A O5'  O -37.709  -6.421 28.253 . . . 1.0 . . . . . . . . . . . . A . 15 A O5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1328 . 1 1 15 A OP1  O -36.091  -7.875 29.497 . . . 1.0 . . . . . . . . . . . . A . 15 A OP1  . . . . . . . . . rr_2l5z 1 
       .  2 .  1329 . 1 1 15 A OP2  O -37.929  -6.597 30.743 . . . 1.0 . . . . . . . . . . . . A . 15 A OP2  . . . . . . . . . rr_2l5z 1 
       .  2 .  1330 . 1 1 15 A P    P -37.472  -7.345 29.551 . . . 1.0 . . . . . . . . . . . . A . 15 A P    . . . . . . . . . rr_2l5z 1 
       .  2 .  1331 . 1 1 16 A C1'  C -39.957  -0.519 25.142 . . . 1.0 . . . . . . . . . . . . A . 16 A C1'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1332 . 1 1 16 A C2   C -41.236   0.327 29.289 . . . 1.0 . . . . . . . . . . . . A . 16 A C2   . . . . . . . . . rr_2l5z 1 
       .  2 .  1333 . 1 1 16 A C2'  C -39.461   0.729 24.418 . . . 1.0 . . . . . . . . . . . . A . 16 A C2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1334 . 1 1 16 A C3'  C -38.313   0.190 23.583 . . . 1.0 . . . . . . . . . . . . A . 16 A C3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1335 . 1 1 16 A C4   C -39.846  -0.345 27.710 . . . 1.0 . . . . . . . . . . . . A . 16 A C4   . . . . . . . . . rr_2l5z 1 
       .  2 .  1336 . 1 1 16 A C4'  C -38.774  -1.229 23.237 . . . 1.0 . . . . . . . . . . . . A . 16 A C4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1337 . 1 1 16 A C5   C -38.856  -0.667 28.610 . . . 1.0 . . . . . . . . . . . . A . 16 A C5   . . . . . . . . . rr_2l5z 1 
       .  2 .  1338 . 1 1 16 A C5'  C -37.598  -2.195 23.059 . . . 1.0 . . . . . . . . . . . . A . 16 A C5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1339 . 1 1 16 A C6   C -39.147  -0.446 29.961 . . . 1.0 . . . . . . . . . . . . A . 16 A C6   . . . . . . . . . rr_2l5z 1 
       .  2 .  1340 . 1 1 16 A C8   C -38.099  -1.115 26.712 . . . 1.0 . . . . . . . . . . . . A . 16 A C8   . . . . . . . . . rr_2l5z 1 
       .  2 .  1341 . 1 1 16 A H1'  H -41.038  -0.465 25.253 . . . 1.0 . . . . . . . . . . . . A . 16 A H1'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1342 . 1 1 16 A H2   H -42.199   0.731 29.603 . . . 1.0 . . . . . . . . . . . . A . 16 A H2   . . . . . . . . . rr_2l5z 1 
       .  2 .  1343 . 1 1 16 A H2'  H -39.088   1.458 25.143 . . . 1.0 . . . . . . . . . . . . A . 16 A H2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1344 . 1 1 16 A H3'  H -37.370   0.211 24.138 . . . 1.0 . . . . . . . . . . . . A . 16 A H3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1345 . 1 1 16 A H4'  H -39.357  -1.202 22.318 . . . 1.0 . . . . . . . . . . . . A . 16 A H4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1346 . 1 1 16 A H5'  H -37.983  -3.178 22.791 . . . 1.0 . . . . . . . . . . . . A . 16 A H5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1347 . 1 1 16 A H5'' H -36.957  -1.832 22.255 . . . 1.0 . . . . . . . . . . . . A . 16 A H5'' . . . . . . . . . rr_2l5z 1 
       .  2 .  1348 . 1 1 16 A H61  H -38.551  -0.534 31.905 . . . 1.0 . . . . . . . . . . . . A . 16 A H61  . . . . . . . . . rr_2l5z 1 
       .  2 .  1349 . 1 1 16 A H62  H -37.378  -1.094 30.733 . . . 1.0 . . . . . . . . . . . . A . 16 A H62  . . . . . . . . . rr_2l5z 1 
       .  2 .  1350 . 1 1 16 A H8   H -37.452  -1.436 25.909 . . . 1.0 . . . . . . . . . . . . A . 16 A H8   . . . . . . . . . rr_2l5z 1 
       .  2 .  1351 . 1 1 16 A HO2' H -41.261   1.418 24.148 . . . 1.0 . . . . . . . . . . . . A . 16 A HO2' . . . . . . . . . rr_2l5z 1 
       .  2 .  1352 . 1 1 16 A N1   N -40.360   0.056 30.259 . . . 1.0 . . . . . . . . . . . . A . 16 A N1   . . . . . . . . . rr_2l5z 1 
       .  2 .  1353 . 1 1 16 A N3   N -41.066   0.157 27.981 . . . 1.0 . . . . . . . . . . . . A . 16 A N3   . . . . . . . . . rr_2l5z 1 
       .  2 .  1354 . 1 1 16 A N6   N -38.289  -0.713 30.946 . . . 1.0 . . . . . . . . . . . . A . 16 A N6   . . . . . . . . . rr_2l5z 1 
       .  2 .  1355 . 1 1 16 A N7   N -37.722  -1.167 27.948 . . . 1.0 . . . . . . . . . . . . A . 16 A N7   . . . . . . . . . rr_2l5z 1 
       .  2 .  1356 . 1 1 16 A N9   N -39.336  -0.645 26.473 . . . 1.0 . . . . . . . . . . . . A . 16 A N9   . . . . . . . . . rr_2l5z 1 
       .  2 .  1357 . 1 1 16 A O2'  O -40.484   1.300 23.596 . . . 1.0 . . . . . . . . . . . . A . 16 A O2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1358 . 1 1 16 A O3'  O -38.248   0.950 22.372 . . . 1.0 . . . . . . . . . . . . A . 16 A O3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1359 . 1 1 16 A O4'  O -39.620  -1.642 24.314 . . . 1.0 . . . . . . . . . . . . A . 16 A O4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1360 . 1 1 16 A O5'  O -36.826  -2.305 24.258 . . . 1.0 . . . . . . . . . . . . A . 16 A O5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1361 . 1 1 16 A OP1  O -35.161  -4.010 23.487 . . . 1.0 . . . . . . . . . . . . A . 16 A OP1  . . . . . . . . . rr_2l5z 1 
       .  2 .  1362 . 1 1 16 A OP2  O -35.512  -3.557 25.985 . . . 1.0 . . . . . . . . . . . . A . 16 A OP2  . . . . . . . . . rr_2l5z 1 
       .  2 .  1363 . 1 1 16 A P    P -36.059  -3.676 24.615 . . . 1.0 . . . . . . . . . . . . A . 16 A P    . . . . . . . . . rr_2l5z 1 
       .  2 .  1364 . 1 1 17 G C1'  C -37.518   2.950 26.920 . . . 1.0 . . . . . . . . . . . . A . 17 G C1'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1365 . 1 1 17 G C2   C -38.071   2.029 31.215 . . . 1.0 . . . . . . . . . . . . A . 17 G C2   . . . . . . . . . rr_2l5z 1 
       .  2 .  1366 . 1 1 17 G C2'  C -37.232   4.442 26.768 . . . 1.0 . . . . . . . . . . . . A . 17 G C2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1367 . 1 1 17 G C3'  C -36.193   4.446 25.664 . . . 1.0 . . . . . . . . . . . . A . 17 G C3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1368 . 1 1 17 G C4   C -36.948   2.117 29.290 . . . 1.0 . . . . . . . . . . . . A . 17 G C4   . . . . . . . . . rr_2l5z 1 
       .  2 .  1369 . 1 1 17 G C4'  C -36.687   3.329 24.759 . . . 1.0 . . . . . . . . . . . . A . 17 G C4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1370 . 1 1 17 G C5   C -35.794   1.552 29.817 . . . 1.0 . . . . . . . . . . . . A . 17 G C5   . . . . . . . . . rr_2l5z 1 
       .  2 .  1371 . 1 1 17 G C5'  C -35.559   2.741 23.910 . . . 1.0 . . . . . . . . . . . . A . 17 G C5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1372 . 1 1 17 G C6   C -35.761   1.182 31.188 . . . 1.0 . . . . . . . . . . . . A . 17 G C6   . . . . . . . . . rr_2l5z 1 
       .  2 .  1373 . 1 1 17 G C8   C -35.403   1.935 27.797 . . . 1.0 . . . . . . . . . . . . A . 17 G C8   . . . . . . . . . rr_2l5z 1 
       .  2 .  1374 . 1 1 17 G H1   H -37.019   1.216 32.826 . . . 1.0 . . . . . . . . . . . . A . 17 G H1   . . . . . . . . . rr_2l5z 1 
       .  2 .  1375 . 1 1 17 G H1'  H -38.567   2.803 27.177 . . . 1.0 . . . . . . . . . . . . A . 17 G H1'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1376 . 1 1 17 G H2'  H -36.805   4.839 27.692 . . . 1.0 . . . . . . . . . . . . A . 17 G H2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1377 . 1 1 17 G H21  H -39.106   1.952 32.965 . . . 1.0 . . . . . . . . . . . . A . 17 G H21  . . . . . . . . . rr_2l5z 1 
       .  2 .  1378 . 1 1 17 G H22  H -39.977   2.627 31.607 . . . 1.0 . . . . . . . . . . . . A . 17 G H22  . . . . . . . . . rr_2l5z 1 
       .  2 .  1379 . 1 1 17 G H3'  H -35.190   4.257 26.053 . . . 1.0 . . . . . . . . . . . . A . 17 G H3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1380 . 1 1 17 G H4'  H -37.471   3.713 24.109 . . . 1.0 . . . . . . . . . . . . A . 17 G H4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1381 . 1 1 17 G H5'  H -35.251   3.479 23.169 . . . 1.0 . . . . . . . . . . . . A . 17 G H5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1382 . 1 1 17 G H5'' H -34.712   2.512 24.555 . . . 1.0 . . . . . . . . . . . . A . 17 G H5'' . . . . . . . . . rr_2l5z 1 
       .  2 .  1383 . 1 1 17 G H8   H -34.912   2.004 26.839 . . . 1.0 . . . . . . . . . . . . A . 17 G H8   . . . . . . . . . rr_2l5z 1 
       .  2 .  1384 . 1 1 17 G HO2' H -38.439   5.961 26.927 . . . 1.0 . . . . . . . . . . . . A . 17 G HO2' . . . . . . . . . rr_2l5z 1 
       .  2 .  1385 . 1 1 17 G N1   N -36.966   1.463 31.820 . . . 1.0 . . . . . . . . . . . . A . 17 G N1   . . . . . . . . . rr_2l5z 1 
       .  2 .  1386 . 1 1 17 G N2   N -39.137   2.217 31.992 . . . 1.0 . . . . . . . . . . . . A . 17 G N2   . . . . . . . . . rr_2l5z 1 
       .  2 .  1387 . 1 1 17 G N3   N -38.111   2.382 29.925 . . . 1.0 . . . . . . . . . . . . A . 17 G N3   . . . . . . . . . rr_2l5z 1 
       .  2 .  1388 . 1 1 17 G N7   N -34.802   1.443 28.829 . . . 1.0 . . . . . . . . . . . . A . 17 G N7   . . . . . . . . . rr_2l5z 1 
       .  2 .  1389 . 1 1 17 G N9   N -36.668   2.358 27.970 . . . 1.0 . . . . . . . . . . . . A . 17 G N9   . . . . . . . . . rr_2l5z 1 
       .  2 .  1390 . 1 1 17 G O2'  O -38.406   5.168 26.388 . . . 1.0 . . . . . . . . . . . . A . 17 G O2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1391 . 1 1 17 G O3'  O -36.278   5.684 24.953 . . . 1.0 . . . . . . . . . . . . A . 17 G O3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1392 . 1 1 17 G O4'  O -37.248   2.350 25.641 . . . 1.0 . . . . . . . . . . . . A . 17 G O4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1393 . 1 1 17 G O5'  O -35.969   1.549 23.239 . . . 1.0 . . . . . . . . . . . . A . 17 G O5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1394 . 1 1 17 G O6   O -34.837   0.673 31.819 . . . 1.0 . . . . . . . . . . . . A . 17 G O6   . . . . . . . . . rr_2l5z 1 
       .  2 .  1395 . 1 1 17 G OP1  O -37.127   3.055 21.608 . . . 1.0 . . . . . . . . . . . . A . 17 G OP1  . . . . . . . . . rr_2l5z 1 
       .  2 .  1396 . 1 1 17 G OP2  O -36.246   0.763 20.877 . . . 1.0 . . . . . . . . . . . . A . 17 G OP2  . . . . . . . . . rr_2l5z 1 
       .  2 .  1397 . 1 1 17 G P    P -36.865   1.629 21.905 . . . 1.0 . . . . . . . . . . . . A . 17 G P    . . . . . . . . . rr_2l5z 1 
       .  2 .  1398 . 1 1 18 U C1'  C -36.534   7.092 30.341 . . . 1.0 . . . . . . . . . . . . A . 18 U C1'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1399 . 1 1 18 U C2   C -35.761   5.564 32.129 . . . 1.0 . . . . . . . . . . . . A . 18 U C2   . . . . . . . . . rr_2l5z 1 
       .  2 .  1400 . 1 1 18 U C2'  C -35.795   8.413 30.610 . . . 1.0 . . . . . . . . . . . . A . 18 U C2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1401 . 1 1 18 U C3'  C -35.528   8.966 29.211 . . . 1.0 . . . . . . . . . . . . A . 18 U C3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1402 . 1 1 18 U C4   C -34.155   3.752 31.648 . . . 1.0 . . . . . . . . . . . . A . 18 U C4   . . . . . . . . . rr_2l5z 1 
       .  2 .  1403 . 1 1 18 U C4'  C -36.637   8.340 28.389 . . . 1.0 . . . . . . . . . . . . A . 18 U C4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1404 . 1 1 18 U C5   C -34.168   4.204 30.275 . . . 1.0 . . . . . . . . . . . . A . 18 U C5   . . . . . . . . . rr_2l5z 1 
       .  2 .  1405 . 1 1 18 U C5'  C -36.297   8.302 26.901 . . . 1.0 . . . . . . . . . . . . A . 18 U C5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1406 . 1 1 18 U C6   C -34.930   5.256 29.894 . . . 1.0 . . . . . . . . . . . . A . 18 U C6   . . . . . . . . . rr_2l5z 1 
       .  2 .  1407 . 1 1 18 U H1'  H -37.495   7.103 30.859 . . . 1.0 . . . . . . . . . . . . A . 18 U H1'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1408 . 1 1 18 U H2'  H -34.851   8.212 31.121 . . . 1.0 . . . . . . . . . . . . A . 18 U H2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1409 . 1 1 18 U H3   H -35.001   4.196 33.491 . . . 1.0 . . . . . . . . . . . . A . 18 U H3   . . . . . . . . . rr_2l5z 1 
       .  2 .  1410 . 1 1 18 U H3'  H -34.536   8.692 28.846 . . . 1.0 . . . . . . . . . . . . A . 18 U H3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1411 . 1 1 18 U H4'  H -37.564   8.892 28.539 . . . 1.0 . . . . . . . . . . . . A . 18 U H4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1412 . 1 1 18 U H5   H -33.559   3.696 29.541 . . . 1.0 . . . . . . . . . . . . A . 18 U H5   . . . . . . . . . rr_2l5z 1 
       .  2 .  1413 . 1 1 18 U H5'  H -37.204   8.090 26.334 . . . 1.0 . . . . . . . . . . . . A . 18 U H5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1414 . 1 1 18 U H5'' H -35.908   9.274 26.599 . . . 1.0 . . . . . . . . . . . . A . 18 U H5'' . . . . . . . . . rr_2l5z 1 
       .  2 .  1415 . 1 1 18 U H6   H -34.910   5.577 28.863 . . . 1.0 . . . . . . . . . . . . A . 18 U H6   . . . . . . . . . rr_2l5z 1 
       .  2 .  1416 . 1 1 18 U HO2' H -36.647  10.140 30.896 . . . 1.0 . . . . . . . . . . . . A . 18 U HO2' . . . . . . . . . rr_2l5z 1 
       .  2 .  1417 . 1 1 18 U N1   N -35.716   5.932 30.788 . . . 1.0 . . . . . . . . . . . . A . 18 U N1   . . . . . . . . . rr_2l5z 1 
       .  2 .  1418 . 1 1 18 U N3   N -34.973   4.486 32.492 . . . 1.0 . . . . . . . . . . . . A . 18 U N3   . . . . . . . . . rr_2l5z 1 
       .  2 .  1419 . 1 1 18 U O2   O -36.458   6.159 32.947 . . . 1.0 . . . . . . . . . . . . A . 18 U O2   . . . . . . . . . rr_2l5z 1 
       .  2 .  1420 . 1 1 18 U O2'  O -36.604   9.312 31.378 . . . 1.0 . . . . . . . . . . . . A . 18 U O2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1421 . 1 1 18 U O3'  O -35.725  10.383 29.237 . . . 1.0 . . . . . . . . . . . . A . 18 U O3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1422 . 1 1 18 U O4   O -33.497   2.808 32.079 . . . 1.0 . . . . . . . . . . . . A . 18 U O4   . . . . . . . . . rr_2l5z 1 
       .  2 .  1423 . 1 1 18 U O4'  O -36.778   7.034 28.927 . . . 1.0 . . . . . . . . . . . . A . 18 U O4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1424 . 1 1 18 U O5'  O -35.322   7.299 26.610 . . . 1.0 . . . . . . . . . . . . A . 18 U O5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1425 . 1 1 18 U OP1  O -35.413   7.905 24.182 . . . 1.0 . . . . . . . . . . . . A . 18 U OP1  . . . . . . . . . rr_2l5z 1 
       .  2 .  1426 . 1 1 18 U OP2  O -33.807   6.093 25.022 . . . 1.0 . . . . . . . . . . . . A . 18 U OP2  . . . . . . . . . rr_2l5z 1 
       .  2 .  1427 . 1 1 18 U P    P -35.113   6.785 25.101 . . . 1.0 . . . . . . . . . . . . A . 18 U P    . . . . . . . . . rr_2l5z 1 
       .  2 .  1428 . 1 1 19 G C1'  C -34.366   9.829 34.608 . . . 1.0 . . . . . . . . . . . . A . 19 G C1'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1429 . 1 1 19 G C2   C -32.170   6.726 36.863 . . . 1.0 . . . . . . . . . . . . A . 19 G C2   . . . . . . . . . rr_2l5z 1 
       .  2 .  1430 . 1 1 19 G C2'  C -33.749  11.100 35.197 . . . 1.0 . . . . . . . . . . . . A . 19 G C2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1431 . 1 1 19 G C3'  C -33.878  12.102 34.060 . . . 1.0 . . . . . . . . . . . . A . 19 G C3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1432 . 1 1 19 G C4   C -32.702   7.918 35.055 . . . 1.0 . . . . . . . . . . . . A . 19 G C4   . . . . . . . . . rr_2l5z 1 
       .  2 .  1433 . 1 1 19 G C4'  C -35.142  11.640 33.353 . . . 1.0 . . . . . . . . . . . . A . 19 G C4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1434 . 1 1 19 G C5   C -31.810   7.254 34.225 . . . 1.0 . . . . . . . . . . . . A . 19 G C5   . . . . . . . . . rr_2l5z 1 
       .  2 .  1435 . 1 1 19 G C5'  C -35.189  12.111 31.900 . . . 1.0 . . . . . . . . . . . . A . 19 G C5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1436 . 1 1 19 G C6   C -31.003   6.212 34.757 . . . 1.0 . . . . . . . . . . . . A . 19 G C6   . . . . . . . . . rr_2l5z 1 
       .  2 .  1437 . 1 1 19 G C8   C -32.774   8.691 33.044 . . . 1.0 . . . . . . . . . . . . A . 19 G C8   . . . . . . . . . rr_2l5z 1 
       .  2 .  1438 . 1 1 19 G H1   H -30.706   5.263 36.569 . . . 1.0 . . . . . . . . . . . . A . 19 G H1   . . . . . . . . . rr_2l5z 1 
       .  2 .  1439 . 1 1 19 G H1'  H -35.045   9.385 35.337 . . . 1.0 . . . . . . . . . . . . A . 19 G H1'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1440 . 1 1 19 G H2'  H -32.694  10.930 35.429 . . . 1.0 . . . . . . . . . . . . A . 19 G H2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1441 . 1 1 19 G H21  H -31.690   5.645 38.520 . . . 1.0 . . . . . . . . . . . . A . 19 G H21  . . . . . . . . . rr_2l5z 1 
       .  2 .  1442 . 1 1 19 G H22  H -32.915   6.872 38.751 . . . 1.0 . . . . . . . . . . . . A . 19 G H22  . . . . . . . . . rr_2l5z 1 
       .  2 .  1443 . 1 1 19 G H3'  H -33.005  12.086 33.403 . . . 1.0 . . . . . . . . . . . . A . 19 G H3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1444 . 1 1 19 G H4'  H -36.015  12.014 33.887 . . . 1.0 . . . . . . . . . . . . A . 19 G H4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1445 . 1 1 19 G H5'  H -36.208  12.004 31.525 . . . 1.0 . . . . . . . . . . . . A . 19 G H5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1446 . 1 1 19 G H5'' H -34.903  13.162 31.854 . . . 1.0 . . . . . . . . . . . . A . 19 G H5'' . . . . . . . . . rr_2l5z 1 
       .  2 .  1447 . 1 1 19 G H8   H -33.077   9.302 32.207 . . . 1.0 . . . . . . . . . . . . A . 19 G H8   . . . . . . . . . rr_2l5z 1 
       .  2 .  1448 . 1 1 19 G HO2' H -35.366  11.223 36.276 . . . 1.0 . . . . . . . . . . . . A . 19 G HO2' . . . . . . . . . rr_2l5z 1 
       .  2 .  1449 . 1 1 19 G N1   N -31.257   6.013 36.108 . . . 1.0 . . . . . . . . . . . . A . 19 G N1   . . . . . . . . . rr_2l5z 1 
       .  2 .  1450 . 1 1 19 G N2   N -32.265   6.386 38.148 . . . 1.0 . . . . . . . . . . . . A . 19 G N2   . . . . . . . . . rr_2l5z 1 
       .  2 .  1451 . 1 1 19 G N3   N -32.931   7.707 36.370 . . . 1.0 . . . . . . . . . . . . A . 19 G N3   . . . . . . . . . rr_2l5z 1 
       .  2 .  1452 . 1 1 19 G N7   N -31.871   7.773 32.920 . . . 1.0 . . . . . . . . . . . . A . 19 G N7   . . . . . . . . . rr_2l5z 1 
       .  2 .  1453 . 1 1 19 G N9   N -33.320   8.849 34.263 . . . 1.0 . . . . . . . . . . . . A . 19 G N9   . . . . . . . . . rr_2l5z 1 
       .  2 .  1454 . 1 1 19 G O2'  O -34.462  11.537 36.360 . . . 1.0 . . . . . . . . . . . . A . 19 G O2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1455 . 1 1 19 G O3'  O -34.115  13.397 34.618 . . . 1.0 . . . . . . . . . . . . A . 19 G O3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1456 . 1 1 19 G O4'  O -35.113  10.218 33.443 . . . 1.0 . . . . . . . . . . . . A . 19 G O4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1457 . 1 1 19 G O5'  O -34.308  11.352 31.070 . . . 1.0 . . . . . . . . . . . . A . 19 G O5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1458 . 1 1 19 G O6   O -30.169   5.517 34.177 . . . 1.0 . . . . . . . . . . . . A . 19 G O6   . . . . . . . . . rr_2l5z 1 
       .  2 .  1459 . 1 1 19 G OP1  O -34.888  12.738 29.066 . . . 1.0 . . . . . . . . . . . . A . 19 G OP1  . . . . . . . . . rr_2l5z 1 
       .  2 .  1460 . 1 1 19 G OP2  O -33.275  10.756 28.867 . . . 1.0 . . . . . . . . . . . . A . 19 G OP2  . . . . . . . . . rr_2l5z 1 
       .  2 .  1461 . 1 1 19 G P    P -34.477  11.374 29.469 . . . 1.0 . . . . . . . . . . . . A . 19 G P    . . . . . . . . . rr_2l5z 1 
       .  2 .  1462 . 1 1 20 A C1'  C -30.874  11.365 38.530 . . . 1.0 . . . . . . . . . . . . A . 20 A C1'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1463 . 1 1 20 A C2   C -27.832   8.182 38.898 . . . 1.0 . . . . . . . . . . . . A . 20 A C2   . . . . . . . . . rr_2l5z 1 
       .  2 .  1464 . 1 1 20 A C2'  C -30.206  12.617 39.116 . . . 1.0 . . . . . . . . . . . . A . 20 A C2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1465 . 1 1 20 A C3'  C -31.031  13.765 38.538 . . . 1.0 . . . . . . . . . . . . A . 20 A C3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1466 . 1 1 20 A C4   C -29.051   9.684 37.834 . . . 1.0 . . . . . . . . . . . . A . 20 A C4   . . . . . . . . . rr_2l5z 1 
       .  2 .  1467 . 1 1 20 A C4'  C -32.381  13.116 38.276 . . . 1.0 . . . . . . . . . . . . A . 20 A C4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1468 . 1 1 20 A C5   C -28.478   9.399 36.616 . . . 1.0 . . . . . . . . . . . . A . 20 A C5   . . . . . . . . . rr_2l5z 1 
       .  2 .  1469 . 1 1 20 A C5'  C -33.179  13.865 37.208 . . . 1.0 . . . . . . . . . . . . A . 20 A C5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1470 . 1 1 20 A C6   C -27.497   8.402 36.606 . . . 1.0 . . . . . . . . . . . . A . 20 A C6   . . . . . . . . . rr_2l5z 1 
       .  2 .  1471 . 1 1 20 A C8   C -29.882  10.914 36.274 . . . 1.0 . . . . . . . . . . . . A . 20 A C8   . . . . . . . . . rr_2l5z 1 
       .  2 .  1472 . 1 1 20 A H1'  H -31.136  10.686 39.339 . . . 1.0 . . . . . . . . . . . . A . 20 A H1'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1473 . 1 1 20 A H2   H -27.543   7.665 39.810 . . . 1.0 . . . . . . . . . . . . A . 20 A H2   . . . . . . . . . rr_2l5z 1 
       .  2 .  1474 . 1 1 20 A H2'  H -29.170  12.684 38.769 . . . 1.0 . . . . . . . . . . . . A . 20 A H2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1475 . 1 1 20 A H3'  H -30.581  14.174 37.630 . . . 1.0 . . . . . . . . . . . . A . 20 A H3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1476 . 1 1 20 A H4'  H -32.955  13.079 39.201 . . . 1.0 . . . . . . . . . . . . A . 20 A H4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1477 . 1 1 20 A H5'  H -33.946  13.203 36.806 . . . 1.0 . . . . . . . . . . . . A . 20 A H5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1478 . 1 1 20 A H5'' H -33.662  14.729 37.667 . . . 1.0 . . . . . . . . . . . . A . 20 A H5'' . . . . . . . . . rr_2l5z 1 
       .  2 .  1479 . 1 1 20 A H61  H -26.154   7.295 35.549 . . . 1.0 . . . . . . . . . . . . A . 20 A H61  . . . . . . . . . rr_2l5z 1 
       .  2 .  1480 . 1 1 20 A H62  H -27.071   8.456 34.616 . . . 1.0 . . . . . . . . . . . . A . 20 A H62  . . . . . . . . . rr_2l5z 1 
       .  2 .  1481 . 1 1 20 A H8   H -30.493  11.664 35.793 . . . 1.0 . . . . . . . . . . . . A . 20 A H8   . . . . . . . . . rr_2l5z 1 
       .  2 .  1482 . 1 1 20 A HO2' H -30.930  13.246 40.811 . . . 1.0 . . . . . . . . . . . . A . 20 A HO2' . . . . . . . . . rr_2l5z 1 
       .  2 .  1483 . 1 1 20 A N1   N -27.200   7.814 37.780 . . . 1.0 . . . . . . . . . . . . A . 20 A N1   . . . . . . . . . rr_2l5z 1 
       .  2 .  1484 . 1 1 20 A N3   N -28.775   9.111 39.020 . . . 1.0 . . . . . . . . . . . . A . 20 A N3   . . . . . . . . . rr_2l5z 1 
       .  2 .  1485 . 1 1 20 A N6   N -26.855   8.020 35.501 . . . 1.0 . . . . . . . . . . . . A . 20 A N6   . . . . . . . . . rr_2l5z 1 
       .  2 .  1486 . 1 1 20 A N7   N -29.028  10.208 35.605 . . . 1.0 . . . . . . . . . . . . A . 20 A N7   . . . . . . . . . rr_2l5z 1 
       .  2 .  1487 . 1 1 20 A N9   N -29.966  10.675 37.594 . . . 1.0 . . . . . . . . . . . . A . 20 A N9   . . . . . . . . . rr_2l5z 1 
       .  2 .  1488 . 1 1 20 A O2'  O -30.259  12.610 40.547 . . . 1.0 . . . . . . . . . . . . A . 20 A O2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1489 . 1 1 20 A O3'  O -31.198  14.758 39.553 . . . 1.0 . . . . . . . . . . . . A . 20 A O3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1490 . 1 1 20 A O4'  O -32.071  11.792 37.864 . . . 1.0 . . . . . . . . . . . . A . 20 A O4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1491 . 1 1 20 A O5'  O -32.341  14.312 36.140 . . . 1.0 . . . . . . . . . . . . A . 20 A O5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1492 . 1 1 20 A OP1  O -33.555  15.839 34.570 . . . 1.0 . . . . . . . . . . . . A . 20 A OP1  . . . . . . . . . rr_2l5z 1 
       .  2 .  1493 . 1 1 20 A OP2  O -31.898  14.097 33.685 . . . 1.0 . . . . . . . . . . . . A . 20 A OP2  . . . . . . . . . rr_2l5z 1 
       .  2 .  1494 . 1 1 20 A P    P -32.939  14.496 34.658 . . . 1.0 . . . . . . . . . . . . A . 20 A P    . . . . . . . . . rr_2l5z 1 
       .  2 .  1495 . 1 1 21 C C1'  C -25.351  13.038 38.470 . . . 1.0 . . . . . . . . . . . . A . 21 C C1'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1496 . 1 1 21 C C2   C -24.234  11.283 37.164 . . . 1.0 . . . . . . . . . . . . A . 21 C C2   . . . . . . . . . rr_2l5z 1 
       .  2 .  1497 . 1 1 21 C C2'  C -24.441  14.234 38.145 . . . 1.0 . . . . . . . . . . . . A . 21 C C2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1498 . 1 1 21 C C3'  C -25.408  15.412 38.077 . . . 1.0 . . . . . . . . . . . . A . 21 C C3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1499 . 1 1 21 C C4   C -25.242  10.347 35.263 . . . 1.0 . . . . . . . . . . . . A . 21 C C4   . . . . . . . . . rr_2l5z 1 
       .  2 .  1500 . 1 1 21 C C4'  C -26.554  14.960 38.967 . . . 1.0 . . . . . . . . . . . . A . 21 C C4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1501 . 1 1 21 C C5   C -26.407  11.158 35.444 . . . 1.0 . . . . . . . . . . . . A . 21 C C5   . . . . . . . . . rr_2l5z 1 
       .  2 .  1502 . 1 1 21 C C5'  C -27.858  15.693 38.647 . . . 1.0 . . . . . . . . . . . . A . 21 C C5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1503 . 1 1 21 C C6   C -26.424  12.005 36.492 . . . 1.0 . . . . . . . . . . . . A . 21 C C6   . . . . . . . . . rr_2l5z 1 
       .  2 .  1504 . 1 1 21 C H1'  H -24.988  12.541 39.372 . . . 1.0 . . . . . . . . . . . . A . 21 C H1'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1505 . 1 1 21 C H2'  H -23.963  14.087 37.173 . . . 1.0 . . . . . . . . . . . . A . 21 C H2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1506 . 1 1 21 C H3'  H -25.738  15.614 37.054 . . . 1.0 . . . . . . . . . . . . A . 21 C H3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1507 . 1 1 21 C H4'  H -26.291  15.121 40.011 . . . 1.0 . . . . . . . . . . . . A . 21 C H4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1508 . 1 1 21 C H41  H -24.359   8.929 34.104 . . . 1.0 . . . . . . . . . . . . A . 21 C H41  . . . . . . . . . rr_2l5z 1 
       .  2 .  1509 . 1 1 21 C H42  H -25.949   9.439 33.587 . . . 1.0 . . . . . . . . . . . . A . 21 C H42  . . . . . . . . . rr_2l5z 1 
       .  2 .  1510 . 1 1 21 C H5   H -27.242  11.095 34.763 . . . 1.0 . . . . . . . . . . . . A . 21 C H5   . . . . . . . . . rr_2l5z 1 
       .  2 .  1511 . 1 1 21 C H5'  H -27.652  16.756 38.518 . . . 1.0 . . . . . . . . . . . . A . 21 C H5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1512 . 1 1 21 C H5'' H -28.272  15.295 37.721 . . . 1.0 . . . . . . . . . . . . A . 21 C H5'' . . . . . . . . . rr_2l5z 1 
       .  2 .  1513 . 1 1 21 C H6   H -27.287  12.630 36.660 . . . 1.0 . . . . . . . . . . . . A . 21 C H6   . . . . . . . . . rr_2l5z 1 
       .  2 .  1514 . 1 1 21 C HO2' H -23.615  13.768 39.846 . . . 1.0 . . . . . . . . . . . . A . 21 C HO2' . . . . . . . . . rr_2l5z 1 
       .  2 .  1515 . 1 1 21 C N1   N -25.361  12.076 37.343 . . . 1.0 . . . . . . . . . . . . A . 21 C N1   . . . . . . . . . rr_2l5z 1 
       .  2 .  1516 . 1 1 21 C N3   N -24.208  10.426 36.109 . . . 1.0 . . . . . . . . . . . . A . 21 C N3   . . . . . . . . . rr_2l5z 1 
       .  2 .  1517 . 1 1 21 C N4   N -25.179   9.503 34.235 . . . 1.0 . . . . . . . . . . . . A . 21 C N4   . . . . . . . . . rr_2l5z 1 
       .  2 .  1518 . 1 1 21 C O2   O -23.291  11.364 37.948 . . . 1.0 . . . . . . . . . . . . A . 21 C O2   . . . . . . . . . rr_2l5z 1 
       .  2 .  1519 . 1 1 21 C O2'  O -23.458  14.430 39.169 . . . 1.0 . . . . . . . . . . . . A . 21 C O2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1520 . 1 1 21 C O3'  O -24.779  16.547 38.677 . . . 1.0 . . . . . . . . . . . . A . 21 C O3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1521 . 1 1 21 C O4'  O -26.662  13.564 38.721 . . . 1.0 . . . . . . . . . . . . A . 21 C O4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1522 . 1 1 21 C O5'  O -28.817  15.531 39.696 . . . 1.0 . . . . . . . . . . . . A . 21 C O5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1523 . 1 1 21 C OP1  O -30.641  16.892 40.740 . . . 1.0 . . . . . . . . . . . . A . 21 C OP1  . . . . . . . . . rr_2l5z 1 
       .  2 .  1524 . 1 1 21 C OP2  O -30.431  16.715 38.192 . . . 1.0 . . . . . . . . . . . . A . 21 C OP2  . . . . . . . . . rr_2l5z 1 
       .  2 .  1525 . 1 1 21 C P    P -30.312  16.101 39.533 . . . 1.0 . . . . . . . . . . . . A . 21 C P    . . . . . . . . . rr_2l5z 1 
       .  2 .  1526 . 1 1 22 G C1'  C -19.895  14.227 39.898 . . . 1.0 . . . . . . . . . . . . A . 22 G C1'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1527 . 1 1 22 G C2   C -17.650  11.106 37.701 . . . 1.0 . . . . . . . . . . . . A . 22 G C2   . . . . . . . . . rr_2l5z 1 
       .  2 .  1528 . 1 1 22 G C2'  C -18.744  15.228 39.838 . . . 1.0 . . . . . . . . . . . . A . 22 G C2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1529 . 1 1 22 G C3'  C -19.474  16.514 39.510 . . . 1.0 . . . . . . . . . . . . A . 22 G C3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1530 . 1 1 22 G C4   C -19.288  12.590 38.006 . . . 1.0 . . . . . . . . . . . . A . 22 G C4   . . . . . . . . . rr_2l5z 1 
       .  2 .  1531 . 1 1 22 G C4'  C -20.744  16.368 40.331 . . . 1.0 . . . . . . . . . . . . A . 22 G C4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1532 . 1 1 22 G C5   C -19.882  12.342 36.777 . . . 1.0 . . . . . . . . . . . . A . 22 G C5   . . . . . . . . . rr_2l5z 1 
       .  2 .  1533 . 1 1 22 G C5'  C -21.873  17.246 39.793 . . . 1.0 . . . . . . . . . . . . A . 22 G C5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1534 . 1 1 22 G C6   C -19.312  11.376 35.907 . . . 1.0 . . . . . . . . . . . . A . 22 G C6   . . . . . . . . . rr_2l5z 1 
       .  2 .  1535 . 1 1 22 G C8   C -21.034  13.817 37.715 . . . 1.0 . . . . . . . . . . . . A . 22 G C8   . . . . . . . . . rr_2l5z 1 
       .  2 .  1536 . 1 1 22 G H1   H -17.687  10.107 35.865 . . . 1.0 . . . . . . . . . . . . A . 22 G H1   . . . . . . . . . rr_2l5z 1 
       .  2 .  1537 . 1 1 22 G H1'  H -19.697  13.482 40.668 . . . 1.0 . . . . . . . . . . . . A . 22 G H1'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1538 . 1 1 22 G H2'  H -18.058  14.966 39.029 . . . 1.0 . . . . . . . . . . . . A . 22 G H2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1539 . 1 1 22 G H21  H -16.151   9.757 37.430 . . . 1.0 . . . . . . . . . . . . A . 22 G H21  . . . . . . . . . rr_2l5z 1 
       .  2 .  1540 . 1 1 22 G H22  H -16.119  10.621 38.951 . . . 1.0 . . . . . . . . . . . . A . 22 G H22  . . . . . . . . . rr_2l5z 1 
       .  2 .  1541 . 1 1 22 G H3'  H -19.682  16.604 38.443 . . . 1.0 . . . . . . . . . . . . A . 22 G H3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1542 . 1 1 22 G H4'  H -20.542  16.629 41.369 . . . 1.0 . . . . . . . . . . . . A . 22 G H4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1543 . 1 1 22 G H5'  H -22.725  17.184 40.471 . . . 1.0 . . . . . . . . . . . . A . 22 G H5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1544 . 1 1 22 G H5'' H -21.529  18.280 39.749 . . . 1.0 . . . . . . . . . . . . A . 22 G H5'' . . . . . . . . . rr_2l5z 1 
       .  2 .  1545 . 1 1 22 G H8   H -21.791  14.555 37.919 . . . 1.0 . . . . . . . . . . . . A . 22 G H8   . . . . . . . . . rr_2l5z 1 
       .  2 .  1546 . 1 1 22 G HO2' H -17.123  15.434 40.897 . . . 1.0 . . . . . . . . . . . . A . 22 G HO2' . . . . . . . . . rr_2l5z 1 
       .  2 .  1547 . 1 1 22 G N1   N -18.176  10.801 36.460 . . . 1.0 . . . . . . . . . . . . A . 22 G N1   . . . . . . . . . rr_2l5z 1 
       .  2 .  1548 . 1 1 22 G N2   N -16.551  10.441 38.056 . . . 1.0 . . . . . . . . . . . . A . 22 G N2   . . . . . . . . . rr_2l5z 1 
       .  2 .  1549 . 1 1 22 G N3   N -18.182  12.014 38.528 . . . 1.0 . . . . . . . . . . . . A . 22 G N3   . . . . . . . . . rr_2l5z 1 
       .  2 .  1550 . 1 1 22 G N7   N -21.018  13.150 36.607 . . . 1.0 . . . . . . . . . . . . A . 22 G N7   . . . . . . . . . rr_2l5z 1 
       .  2 .  1551 . 1 1 22 G N9   N -20.059  13.555 38.598 . . . 1.0 . . . . . . . . . . . . A . 22 G N9   . . . . . . . . . rr_2l5z 1 
       .  2 .  1552 . 1 1 22 G O2'  O -18.055  15.317 41.091 . . . 1.0 . . . . . . . . . . . . A . 22 G O2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1553 . 1 1 22 G O3'  O -18.716  17.617 40.013 . . . 1.0 . . . . . . . . . . . . A . 22 G O3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1554 . 1 1 22 G O4'  O -21.072  14.977 40.251 . . . 1.0 . . . . . . . . . . . . A . 22 G O4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1555 . 1 1 22 G O5'  O -22.288  16.838 38.487 . . . 1.0 . . . . . . . . . . . . A . 22 G O5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1556 . 1 1 22 G O6   O -19.704  11.022 34.797 . . . 1.0 . . . . . . . . . . . . A . 22 G O6   . . . . . . . . . rr_2l5z 1 
       .  2 .  1557 . 1 1 22 G OP1  O -23.808  18.813 38.232 . . . 1.0 . . . . . . . . . . . . A . 22 G OP1  . . . . . . . . . rr_2l5z 1 
       .  2 .  1558 . 1 1 22 G OP2  O -23.730  16.979 36.444 . . . 1.0 . . . . . . . . . . . . A . 22 G OP2  . . . . . . . . . rr_2l5z 1 
       .  2 .  1559 . 1 1 22 G P    P -23.668  17.385 37.866 . . . 1.0 . . . . . . . . . . . . A . 22 G P    . . . . . . . . . rr_2l5z 1 
       .  2 .  1560 . 1 1 23 G C1'  C -15.173  14.496 37.052 . . . 1.0 . . . . . . . . . . . . A . 23 G C1'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1561 . 1 1 23 G C2   C -15.570  12.047 33.392 . . . 1.0 . . . . . . . . . . . . A . 23 G C2   . . . . . . . . . rr_2l5z 1 
       .  2 .  1562 . 1 1 23 G C2'  C -14.007  15.299 36.473 . . . 1.0 . . . . . . . . . . . . A . 23 G C2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1563 . 1 1 23 G C3'  C -14.263  16.687 37.033 . . . 1.0 . . . . . . . . . . . . A . 23 G C3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1564 . 1 1 23 G C4   C -16.248  13.516 34.927 . . . 1.0 . . . . . . . . . . . . A . 23 G C4   . . . . . . . . . rr_2l5z 1 
       .  2 .  1565 . 1 1 23 G C4'  C -14.825  16.370 38.404 . . . 1.0 . . . . . . . . . . . . A . 23 G C4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1566 . 1 1 23 G C5   C -17.484  13.727 34.333 . . . 1.0 . . . . . . . . . . . . A . 23 G C5   . . . . . . . . . rr_2l5z 1 
       .  2 .  1567 . 1 1 23 G C5'  C -15.606  17.549 38.980 . . . 1.0 . . . . . . . . . . . . A . 23 G C5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1568 . 1 1 23 G C6   C -17.812  13.030 33.138 . . . 1.0 . . . . . . . . . . . . A . 23 G C6   . . . . . . . . . rr_2l5z 1 
       .  2 .  1569 . 1 1 23 G C8   C -17.425  14.940 36.041 . . . 1.0 . . . . . . . . . . . . A . 23 G C8   . . . . . . . . . rr_2l5z 1 
       .  2 .  1570 . 1 1 23 G H1   H -16.942  11.650 31.864 . . . 1.0 . . . . . . . . . . . . A . 23 G H1   . . . . . . . . . rr_2l5z 1 
       .  2 .  1571 . 1 1 23 G H1'  H -14.821  13.517 37.376 . . . 1.0 . . . . . . . . . . . . A . 23 G H1'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1572 . 1 1 23 G H2'  H -14.068  15.315 35.383 . . . 1.0 . . . . . . . . . . . . A . 23 G H2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1573 . 1 1 23 G H21  H -14.938  10.708 31.995 . . . 1.0 . . . . . . . . . . . . A . 23 G H21  . . . . . . . . . rr_2l5z 1 
       .  2 .  1574 . 1 1 23 G H22  H -13.799  11.049 33.278 . . . 1.0 . . . . . . . . . . . . A . 23 G H22  . . . . . . . . . rr_2l5z 1 
       .  2 .  1575 . 1 1 23 G H3'  H -14.971  17.249 36.421 . . . 1.0 . . . . . . . . . . . . A . 23 G H3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1576 . 1 1 23 G H4'  H -14.014  16.102 39.080 . . . 1.0 . . . . . . . . . . . . A . 23 G H4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1577 . 1 1 23 G H5'  H -15.788  17.369 40.040 . . . 1.0 . . . . . . . . . . . . A . 23 G H5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1578 . 1 1 23 G H5'' H -15.011  18.455 38.872 . . . 1.0 . . . . . . . . . . . . A . 23 G H5'' . . . . . . . . . rr_2l5z 1 
       .  2 .  1579 . 1 1 23 G H8   H -17.692  15.648 36.812 . . . 1.0 . . . . . . . . . . . . A . 23 G H8   . . . . . . . . . rr_2l5z 1 
       .  2 .  1580 . 1 1 23 G HO2' H -12.820  13.825 36.929 . . . 1.0 . . . . . . . . . . . . A . 23 G HO2' . . . . . . . . . rr_2l5z 1 
       .  2 .  1581 . 1 1 23 G N1   N -16.775  12.196 32.734 . . . 1.0 . . . . . . . . . . . . A . 23 G N1   . . . . . . . . . rr_2l5z 1 
       .  2 .  1582 . 1 1 23 G N2   N -14.698  11.199 32.844 . . . 1.0 . . . . . . . . . . . . A . 23 G N2   . . . . . . . . . rr_2l5z 1 
       .  2 .  1583 . 1 1 23 G N3   N -15.254  12.698 34.516 . . . 1.0 . . . . . . . . . . . . A . 23 G N3   . . . . . . . . . rr_2l5z 1 
       .  2 .  1584 . 1 1 23 G N7   N -18.235  14.658 35.072 . . . 1.0 . . . . . . . . . . . . A . 23 G N7   . . . . . . . . . rr_2l5z 1 
       .  2 .  1585 . 1 1 23 G N9   N -16.233  14.317 36.041 . . . 1.0 . . . . . . . . . . . . A . 23 G N9   . . . . . . . . . rr_2l5z 1 
       .  2 .  1586 . 1 1 23 G O2'  O -12.745  14.782 36.910 . . . 1.0 . . . . . . . . . . . . A . 23 G O2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1587 . 1 1 23 G O3'  O -13.013  17.364 37.185 . . . 1.0 . . . . . . . . . . . . A . 23 G O3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1588 . 1 1 23 G O4'  O -15.658  15.229 38.193 . . . 1.0 . . . . . . . . . . . . A . 23 G O4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1589 . 1 1 23 G O5'  O -16.860  17.735 38.320 . . . 1.0 . . . . . . . . . . . . A . 23 G O5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1590 . 1 1 23 G O6   O -18.849  13.090 32.480 . . . 1.0 . . . . . . . . . . . . A . 23 G O6   . . . . . . . . . rr_2l5z 1 
       .  2 .  1591 . 1 1 23 G OP1  O -17.350  19.704 39.787 . . . 1.0 . . . . . . . . . . . . A . 23 G OP1  . . . . . . . . . rr_2l5z 1 
       .  2 .  1592 . 1 1 23 G OP2  O -18.988  19.004 37.946 . . . 1.0 . . . . . . . . . . . . A . 23 G OP2  . . . . . . . . . rr_2l5z 1 
       .  2 .  1593 . 1 1 23 G P    P -18.008  18.642 38.994 . . . 1.0 . . . . . . . . . . . . A . 23 G P    . . . . . . . . . rr_2l5z 1 
       .  2 .  1594 . 1 1 24 C C1'  C -12.388  15.299 31.954 . . . 1.0 . . . . . . . . . . . . A . 24 C C1'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1595 . 1 1 24 C C2   C -14.480  14.668 30.771 . . . 1.0 . . . . . . . . . . . . A . 24 C C2   . . . . . . . . . rr_2l5z 1 
       .  2 .  1596 . 1 1 24 C C2'  C -11.722  16.359 31.072 . . . 1.0 . . . . . . . . . . . . A . 24 C C2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1597 . 1 1 24 C C3'  C -11.283  17.414 32.073 . . . 1.0 . . . . . . . . . . . . A . 24 C C3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1598 . 1 1 24 C C4   C -16.562  15.487 31.485 . . . 1.0 . . . . . . . . . . . . A . 24 C C4   . . . . . . . . . rr_2l5z 1 
       .  2 .  1599 . 1 1 24 C C4'  C -10.979  16.583 33.304 . . . 1.0 . . . . . . . . . . . . A . 24 C C4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1600 . 1 1 24 C C5   C -15.947  16.209 32.555 . . . 1.0 . . . . . . . . . . . . A . 24 C C5   . . . . . . . . . rr_2l5z 1 
       .  2 .  1601 . 1 1 24 C C5'  C -11.013  17.422 34.581 . . . 1.0 . . . . . . . . . . . . A . 24 C C5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1602 . 1 1 24 C C6   C -14.607  16.124 32.683 . . . 1.0 . . . . . . . . . . . . A . 24 C C6   . . . . . . . . . rr_2l5z 1 
       .  2 .  1603 . 1 1 24 C H1'  H -12.022  14.307 31.671 . . . 1.0 . . . . . . . . . . . . A . 24 C H1'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1604 . 1 1 24 C H2'  H -12.456  16.781 30.384 . . . 1.0 . . . . . . . . . . . . A . 24 C H2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1605 . 1 1 24 C H3'  H -12.067  18.150 32.257 . . . 1.0 . . . . . . . . . . . . A . 24 C H3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1606 . 1 1 24 C H4'  H -10.000  16.117 33.199 . . . 1.0 . . . . . . . . . . . . A . 24 C H4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1607 . 1 1 24 C H41  H -18.322  15.036 30.569 . . . 1.0 . . . . . . . . . . . . A . 24 C H41  . . . . . . . . . rr_2l5z 1 
       .  2 .  1608 . 1 1 24 C H42  H -18.446  16.096 31.955 . . . 1.0 . . . . . . . . . . . . A . 24 C H42  . . . . . . . . . rr_2l5z 1 
       .  2 .  1609 . 1 1 24 C H5   H -16.536  16.803 33.239 . . . 1.0 . . . . . . . . . . . . A . 24 C H5   . . . . . . . . . rr_2l5z 1 
       .  2 .  1610 . 1 1 24 C H5'  H -10.712  16.798 35.423 . . . 1.0 . . . . . . . . . . . . A . 24 C H5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1611 . 1 1 24 C H5'' H -10.309  18.248 34.481 . . . 1.0 . . . . . . . . . . . . A . 24 C H5'' . . . . . . . . . rr_2l5z 1 
       .  2 .  1612 . 1 1 24 C H6   H -14.109  16.674 33.470 . . . 1.0 . . . . . . . . . . . . A . 24 C H6   . . . . . . . . . rr_2l5z 1 
       .  2 .  1613 . 1 1 24 C HO2' H -10.860  15.753 29.434 . . . 1.0 . . . . . . . . . . . . A . 24 C HO2' . . . . . . . . . rr_2l5z 1 
       .  2 .  1614 . 1 1 24 C N1   N -13.870  15.370 31.815 . . . 1.0 . . . . . . . . . . . . A . 24 C N1   . . . . . . . . . rr_2l5z 1 
       .  2 .  1615 . 1 1 24 C N3   N -15.831  14.751 30.639 . . . 1.0 . . . . . . . . . . . . A . 24 C N3   . . . . . . . . . rr_2l5z 1 
       .  2 .  1616 . 1 1 24 C N4   N -17.883  15.545 31.323 . . . 1.0 . . . . . . . . . . . . A . 24 C N4   . . . . . . . . . rr_2l5z 1 
       .  2 .  1617 . 1 1 24 C O2   O -13.798  14.000 29.996 . . . 1.0 . . . . . . . . . . . . A . 24 C O2   . . . . . . . . . rr_2l5z 1 
       .  2 .  1618 . 1 1 24 C O2'  O -10.604  15.819 30.357 . . . 1.0 . . . . . . . . . . . . A . 24 C O2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1619 . 1 1 24 C O3'  O -10.074  18.013 31.603 . . . 1.0 . . . . . . . . . . . . A . 24 C O3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1620 . 1 1 24 C O4'  O -11.982  15.573 33.309 . . . 1.0 . . . . . . . . . . . . A . 24 C O4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1621 . 1 1 24 C O5'  O -12.318  17.948 34.835 . . . 1.0 . . . . . . . . . . . . A . 24 C O5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1622 . 1 1 24 C OP1  O -11.422  19.256 36.776 . . . 1.0 . . . . . . . . . . . . A . 24 C OP1  . . . . . . . . . rr_2l5z 1 
       .  2 .  1623 . 1 1 24 C OP2  O -13.884  19.444 36.094 . . . 1.0 . . . . . . . . . . . . A . 24 C OP2  . . . . . . . . . rr_2l5z 1 
       .  2 .  1624 . 1 1 24 C P    P -12.659  18.631 36.255 . . . 1.0 . . . . . . . . . . . . A . 24 C P    . . . . . . . . . rr_2l5z 1 
       .  2 .  1625 . 1 1 25 U C1'  C -11.675  16.269 26.500 . . . 1.0 . . . . . . . . . . . . A . 25 U C1'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1626 . 1 1 25 U C2   C -14.154  16.035 26.372 . . . 1.0 . . . . . . . . . . . . A . 25 U C2   . . . . . . . . . rr_2l5z 1 
       .  2 .  1627 . 1 1 25 U C2'  C -11.209  17.245 25.418 . . . 1.0 . . . . . . . . . . . . A . 25 U C2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1628 . 1 1 25 U C3'  C -10.386  18.239 26.213 . . . 1.0 . . . . . . . . . . . . A . 25 U C3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1629 . 1 1 25 U C4   C -15.628  17.389 27.814 . . . 1.0 . . . . . . . . . . . . A . 25 U C4   . . . . . . . . . rr_2l5z 1 
       .  2 .  1630 . 1 1 25 U C4'  C  -9.724  17.343 27.240 . . . 1.0 . . . . . . . . . . . . A . 25 U C4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1631 . 1 1 25 U C5   C -14.428  17.960 28.383 . . . 1.0 . . . . . . . . . . . . A . 25 U C5   . . . . . . . . . rr_2l5z 1 
       .  2 .  1632 . 1 1 25 U C5'  C  -9.261  18.125 28.467 . . . 1.0 . . . . . . . . . . . . A . 25 U C5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1633 . 1 1 25 U C6   C -13.201  17.572 27.957 . . . 1.0 . . . . . . . . . . . . A . 25 U C6   . . . . . . . . . rr_2l5z 1 
       .  2 .  1634 . 1 1 25 U H1'  H -11.649  15.251 26.095 . . . 1.0 . . . . . . . . . . . . A . 25 U H1'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1635 . 1 1 25 U H2'  H -12.068  17.741 24.965 . . . 1.0 . . . . . . . . . . . . A . 25 U H2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1636 . 1 1 25 U H3   H -16.226  16.031 26.367 . . . 1.0 . . . . . . . . . . . . A . 25 U H3   . . . . . . . . . rr_2l5z 1 
       .  2 .  1637 . 1 1 25 U H3'  H -11.006  19.010 26.674 . . . 1.0 . . . . . . . . . . . . A . 25 U H3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1638 . 1 1 25 U H4'  H  -8.875  16.842 26.784 . . . 1.0 . . . . . . . . . . . . A . 25 U H4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1639 . 1 1 25 U H5   H -14.510  18.734 29.131 . . . 1.0 . . . . . . . . . . . . A . 25 U H5   . . . . . . . . . rr_2l5z 1 
       .  2 .  1640 . 1 1 25 U H5'  H  -8.704  17.457 29.123 . . . 1.0 . . . . . . . . . . . . A . 25 U H5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1641 . 1 1 25 U H5'' H  -8.604  18.934 28.145 . . . 1.0 . . . . . . . . . . . . A . 25 U H5'' . . . . . . . . . rr_2l5z 1 
       .  2 .  1642 . 1 1 25 U H6   H -12.325  18.024 28.399 . . . 1.0 . . . . . . . . . . . . A . 25 U H6   . . . . . . . . . rr_2l5z 1 
       .  2 .  1643 . 1 1 25 U HO2' H -10.969  16.468 23.649 . . . 1.0 . . . . . . . . . . . . A . 25 U HO2' . . . . . . . . . rr_2l5z 1 
       .  2 .  1644 . 1 1 25 U N1   N -13.046  16.632 26.974 . . . 1.0 . . . . . . . . . . . . A . 25 U N1   . . . . . . . . . rr_2l5z 1 
       .  2 .  1645 . 1 1 25 U N3   N -15.392  16.449 26.827 . . . 1.0 . . . . . . . . . . . . A . 25 U N3   . . . . . . . . . rr_2l5z 1 
       .  2 .  1646 . 1 1 25 U O2   O -14.040  15.188 25.489 . . . 1.0 . . . . . . . . . . . . A . 25 U O2   . . . . . . . . . rr_2l5z 1 
       .  2 .  1647 . 1 1 25 U O2'  O -10.415  16.585 24.423 . . . 1.0 . . . . . . . . . . . . A . 25 U O2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1648 . 1 1 25 U O3'  O  -9.374  18.786 25.362 . . . 1.0 . . . . . . . . . . . . A . 25 U O3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1649 . 1 1 25 U O4   O -16.776  17.677 28.143 . . . 1.0 . . . . . . . . . . . . A . 25 U O4   . . . . . . . . . rr_2l5z 1 
       .  2 .  1650 . 1 1 25 U O4'  O -10.717  16.372 27.574 . . . 1.0 . . . . . . . . . . . . A . 25 U O4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1651 . 1 1 25 U O5'  O -10.360  18.680 29.193 . . . 1.0 . . . . . . . . . . . . A . 25 U O5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1652 . 1 1 25 U OP1  O  -8.796  19.959 30.675 . . . 1.0 . . . . . . . . . . . . A . 25 U OP1  . . . . . . . . . rr_2l5z 1 
       .  2 .  1653 . 1 1 25 U OP2  O -11.331  20.099 31.015 . . . 1.0 . . . . . . . . . . . . A . 25 U OP2  . . . . . . . . . rr_2l5z 1 
       .  2 .  1654 . 1 1 25 U P    P -10.129  19.315 30.655 . . . 1.0 . . . . . . . . . . . . A . 25 U P    . . . . . . . . . rr_2l5z 1 
       .  2 .  1655 . 1 1 26 C C1'  C -14.323  19.527 22.584 . . . 1.0 . . . . . . . . . . . . A . 26 C C1'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1656 . 1 1 26 C C2   C -16.392  20.203 23.714 . . . 1.0 . . . . . . . . . . . . A . 26 C C2   . . . . . . . . . rr_2l5z 1 
       .  2 .  1657 . 1 1 26 C C2'  C -14.107  20.748 21.683 . . . 1.0 . . . . . . . . . . . . A . 26 C C2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1658 . 1 1 26 C C3'  C -12.612  21.018 21.806 . . . 1.0 . . . . . . . . . . . . A . 26 C C3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1659 . 1 1 26 C C4   C -16.444  20.592 26.031 . . . 1.0 . . . . . . . . . . . . A . 26 C C4   . . . . . . . . . rr_2l5z 1 
       .  2 .  1660 . 1 1 26 C C4'  C -12.064  19.622 22.048 . . . 1.0 . . . . . . . . . . . . A . 26 C C4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1661 . 1 1 26 C C5   C -15.051  20.285 26.144 . . . 1.0 . . . . . . . . . . . . A . 26 C C5   . . . . . . . . . rr_2l5z 1 
       .  2 .  1662 . 1 1 26 C C5'  C -10.683  19.655 22.703 . . . 1.0 . . . . . . . . . . . . A . 26 C C5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1663 . 1 1 26 C C6   C -14.391  19.946 25.019 . . . 1.0 . . . . . . . . . . . . A . 26 C C6   . . . . . . . . . rr_2l5z 1 
       .  2 .  1664 . 1 1 26 C H1'  H -14.903  18.778 22.043 . . . 1.0 . . . . . . . . . . . . A . 26 C H1'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1665 . 1 1 26 C H2'  H -14.679  21.600 22.066 . . . 1.0 . . . . . . . . . . . . A . 26 C H2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1666 . 1 1 26 C H3'  H -12.413  21.664 22.670 . . . 1.0 . . . . . . . . . . . . A . 26 C H3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1667 . 1 1 26 C H4'  H -12.005  19.085 21.105 . . . 1.0 . . . . . . . . . . . . A . 26 C H4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1668 . 1 1 26 C H41  H -18.121  21.145 27.044 . . . 1.0 . . . . . . . . . . . . A . 26 C H41  . . . . . . . . . rr_2l5z 1 
       .  2 .  1669 . 1 1 26 C H42  H -16.679  20.963 28.018 . . . 1.0 . . . . . . . . . . . . A . 26 C H42  . . . . . . . . . rr_2l5z 1 
       .  2 .  1670 . 1 1 26 C H5   H -14.547  20.321 27.098 . . . 1.0 . . . . . . . . . . . . A . 26 C H5   . . . . . . . . . rr_2l5z 1 
       .  2 .  1671 . 1 1 26 C H5'  H -10.355  18.633 22.892 . . . 1.0 . . . . . . . . . . . . A . 26 C H5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1672 . 1 1 26 C H5'' H  -9.979  20.135 22.024 . . . 1.0 . . . . . . . . . . . . A . 26 C H5'' . . . . . . . . . rr_2l5z 1 
       .  2 .  1673 . 1 1 26 C H6   H -13.337  19.711 25.067 . . . 1.0 . . . . . . . . . . . . A . 26 C H6   . . . . . . . . . rr_2l5z 1 
       .  2 .  1674 . 1 1 26 C HO2' H -13.691  20.124 19.885 . . . 1.0 . . . . . . . . . . . . A . 26 C HO2' . . . . . . . . . rr_2l5z 1 
       .  2 .  1675 . 1 1 26 C HO3' H -12.046  20.892 19.947 . . . 1.0 . . . . . . . . . . . . A . 26 C HO3' . . . . . . . . . rr_2l5z 1 
       .  2 .  1676 . 1 1 26 C N1   N -15.040  19.903 23.819 . . . 1.0 . . . . . . . . . . . . A . 26 C N1   . . . . . . . . . rr_2l5z 1 
       .  2 .  1677 . 1 1 26 C N3   N -17.066  20.545 24.845 . . . 1.0 . . . . . . . . . . . . A . 26 C N3   . . . . . . . . . rr_2l5z 1 
       .  2 .  1678 . 1 1 26 C N4   N -17.137  20.927 27.119 . . . 1.0 . . . . . . . . . . . . A . 26 C N4   . . . . . . . . . rr_2l5z 1 
       .  2 .  1679 . 1 1 26 C O2   O -16.953  20.158 22.620 . . . 1.0 . . . . . . . . . . . . A . 26 C O2   . . . . . . . . . rr_2l5z 1 
       .  2 .  1680 . 1 1 26 C O2'  O -14.473  20.464 20.327 . . . 1.0 . . . . . . . . . . . . A . 26 C O2'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1681 . 1 1 26 C O3'  O -12.081  21.590 20.604 . . . 1.0 . . . . . . . . . . . . A . 26 C O3'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1682 . 1 1 26 C O4'  O -13.027  18.994 22.884 . . . 1.0 . . . . . . . . . . . . A . 26 C O4'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1683 . 1 1 26 C O5'  O -10.701  20.375 23.938 . . . 1.0 . . . . . . . . . . . . A . 26 C O5'  . . . . . . . . . rr_2l5z 1 
       .  2 .  1684 . 1 1 26 C OP1  O  -8.218  20.633 24.126 . . . 1.0 . . . . . . . . . . . . A . 26 C OP1  . . . . . . . . . rr_2l5z 1 
       .  2 .  1685 . 1 1 26 C OP2  O  -9.743  21.144 26.120 . . . 1.0 . . . . . . . . . . . . A . 26 C OP2  . . . . . . . . . rr_2l5z 1 
       .  2 .  1686 . 1 1 26 C P    P  -9.428  20.334 24.923 . . . 1.0 . . . . . . . . . . . . A . 26 C P    . . . . . . . . . rr_2l5z 1 
       .  3 .  1687 . 1 1  1 G C1'  C -24.782  20.597 22.786 . . . 1.0 . . . . . . . . . . . . A .  1 G C1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1688 . 1 1  1 G C2   C -20.402  21.233 22.669 . . . 1.0 . . . . . . . . . . . . A .  1 G C2   . . . . . . . . . rr_2l5z 1 
       .  3 .  1689 . 1 1  1 G C2'  C -24.952  19.109 22.491 . . . 1.0 . . . . . . . . . . . . A .  1 G C2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1690 . 1 1  1 G C3'  C -26.128  18.733 23.372 . . . 1.0 . . . . . . . . . . . . A .  1 G C3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1691 . 1 1  1 G C4   C -22.390  21.001 23.654 . . . 1.0 . . . . . . . . . . . . A .  1 G C4   . . . . . . . . . rr_2l5z 1 
       .  3 .  1692 . 1 1  1 G C4'  C -26.983  19.997 23.350 . . . 1.0 . . . . . . . . . . . . A .  1 G C4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1693 . 1 1  1 G C5   C -21.887  21.145 24.939 . . . 1.0 . . . . . . . . . . . . A .  1 G C5   . . . . . . . . . rr_2l5z 1 
       .  3 .  1694 . 1 1  1 G C5'  C -27.849  20.128 24.604 . . . 1.0 . . . . . . . . . . . . A .  1 G C5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1695 . 1 1  1 G C6   C -20.494  21.357 25.126 . . . 1.0 . . . . . . . . . . . . A .  1 G C6   . . . . . . . . . rr_2l5z 1 
       .  3 .  1696 . 1 1  1 G C8   C -23.952  20.858 25.135 . . . 1.0 . . . . . . . . . . . . A .  1 G C8   . . . . . . . . . rr_2l5z 1 
       .  3 .  1697 . 1 1  1 G H1   H -18.789  21.536 23.966 . . . 1.0 . . . . . . . . . . . . A .  1 G H1   . . . . . . . . . rr_2l5z 1 
       .  3 .  1698 . 1 1  1 G H1'  H -24.504  21.119 21.871 . . . 1.0 . . . . . . . . . . . . A .  1 G H1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1699 . 1 1  1 G H2'  H -24.059  18.561 22.803 . . . 1.0 . . . . . . . . . . . . A .  1 G H2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1700 . 1 1  1 G H21  H -18.594  21.446 21.759 . . . 1.0 . . . . . . . . . . . . A .  1 G H21  . . . . . . . . . rr_2l5z 1 
       .  3 .  1701 . 1 1  1 G H22  H -19.951  21.191 20.684 . . . 1.0 . . . . . . . . . . . . A .  1 G H22  . . . . . . . . . rr_2l5z 1 
       .  3 .  1702 . 1 1  1 G H3'  H -25.805  18.458 24.379 . . . 1.0 . . . . . . . . . . . . A .  1 G H3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1703 . 1 1  1 G H4'  H -27.621  19.987 22.468 . . . 1.0 . . . . . . . . . . . . A .  1 G H4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1704 . 1 1  1 G H5'  H -28.508  20.990 24.493 . . . 1.0 . . . . . . . . . . . . A .  1 G H5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1705 . 1 1  1 G H5'' H -28.455  19.229 24.713 . . . 1.0 . . . . . . . . . . . . A .  1 G H5'' . . . . . . . . . rr_2l5z 1 
       .  3 .  1706 . 1 1  1 G H8   H -24.942  20.738 25.551 . . . 1.0 . . . . . . . . . . . . A .  1 G H8   . . . . . . . . . rr_2l5z 1 
       .  3 .  1707 . 1 1  1 G HO2' H -25.872  19.545 20.830 . . . 1.0 . . . . . . . . . . . . A .  1 G HO2' . . . . . . . . . rr_2l5z 1 
       .  3 .  1708 . 1 1  1 G HO5' H -26.734  19.431 26.037 . . . 1.0 . . . . . . . . . . . . A .  1 G HO5' . . . . . . . . . rr_2l5z 1 
       .  3 .  1709 . 1 1  1 G N1   N -19.817  21.387 23.912 . . . 1.0 . . . . . . . . . . . . A .  1 G N1   . . . . . . . . . rr_2l5z 1 
       .  3 .  1710 . 1 1  1 G N2   N -19.583  21.295 21.620 . . . 1.0 . . . . . . . . . . . . A .  1 G N2   . . . . . . . . . rr_2l5z 1 
       .  3 .  1711 . 1 1  1 G N3   N -21.711  21.034 22.486 . . . 1.0 . . . . . . . . . . . . A .  1 G N3   . . . . . . . . . rr_2l5z 1 
       .  3 .  1712 . 1 1  1 G N7   N -22.919  21.049 25.888 . . . 1.0 . . . . . . . . . . . . A .  1 G N7   . . . . . . . . . rr_2l5z 1 
       .  3 .  1713 . 1 1  1 G N9   N -23.739  20.814 23.807 . . . 1.0 . . . . . . . . . . . . A .  1 G N9   . . . . . . . . . rr_2l5z 1 
       .  3 .  1714 . 1 1  1 G O2'  O -25.238  18.878 21.107 . . . 1.0 . . . . . . . . . . . . A .  1 G O2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1715 . 1 1  1 G O3'  O -26.856  17.682 22.730 . . . 1.0 . . . . . . . . . . . . A .  1 G O3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1716 . 1 1  1 G O4'  O -26.057  21.082 23.242 . . . 1.0 . . . . . . . . . . . . A .  1 G O4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1717 . 1 1  1 G O5'  O -27.051  20.299 25.779 . . . 1.0 . . . . . . . . . . . . A .  1 G O5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1718 . 1 1  1 G O6   O -19.878  21.504 26.180 . . . 1.0 . . . . . . . . . . . . A .  1 G O6   . . . . . . . . . rr_2l5z 1 
       .  3 .  1719 . 1 1  2 A C1'  C -21.729  14.957 21.833 . . . 1.0 . . . . . . . . . . . . A .  2 A C1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1720 . 1 1  2 A C2   C -18.038  15.751 24.144 . . . 1.0 . . . . . . . . . . . . A .  2 A C2   . . . . . . . . . rr_2l5z 1 
       .  3 .  1721 . 1 1  2 A C2'  C -22.026  13.498 22.173 . . . 1.0 . . . . . . . . . . . . A .  2 A C2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1722 . 1 1  2 A C3'  C -23.541  13.482 22.247 . . . 1.0 . . . . . . . . . . . . A .  2 A C3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1723 . 1 1  2 A C4   C -20.193  15.893 23.681 . . . 1.0 . . . . . . . . . . . . A .  2 A C4   . . . . . . . . . rr_2l5z 1 
       .  3 .  1724 . 1 1  2 A C4'  C -23.933  14.489 21.173 . . . 1.0 . . . . . . . . . . . . A .  2 A C4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1725 . 1 1  2 A C5   C -20.455  16.686 24.776 . . . 1.0 . . . . . . . . . . . . A .  2 A C5   . . . . . . . . . rr_2l5z 1 
       .  3 .  1726 . 1 1  2 A C5'  C -25.310  15.098 21.435 . . . 1.0 . . . . . . . . . . . . A .  2 A C5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1727 . 1 1  2 A C6   C -19.363  17.003 25.590 . . . 1.0 . . . . . . . . . . . . A .  2 A C6   . . . . . . . . . rr_2l5z 1 
       .  3 .  1728 . 1 1  2 A C8   C -22.282  16.409 23.795 . . . 1.0 . . . . . . . . . . . . A .  2 A C8   . . . . . . . . . rr_2l5z 1 
       .  3 .  1729 . 1 1  2 A H1'  H -20.890  15.005 21.138 . . . 1.0 . . . . . . . . . . . . A .  2 A H1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1730 . 1 1  2 A H2   H -17.035  15.385 23.920 . . . 1.0 . . . . . . . . . . . . A .  2 A H2   . . . . . . . . . rr_2l5z 1 
       .  3 .  1731 . 1 1  2 A H2'  H -21.599  13.245 23.146 . . . 1.0 . . . . . . . . . . . . A .  2 A H2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1732 . 1 1  2 A H3'  H -23.899  13.765 23.239 . . . 1.0 . . . . . . . . . . . . A .  2 A H3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1733 . 1 1  2 A H4'  H -23.932  14.000 20.200 . . . 1.0 . . . . . . . . . . . . A .  2 A H4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1734 . 1 1  2 A H5'  H -25.489  15.899 20.718 . . . 1.0 . . . . . . . . . . . . A .  2 A H5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1735 . 1 1  2 A H5'' H -26.071  14.327 21.305 . . . 1.0 . . . . . . . . . . . . A .  2 A H5'' . . . . . . . . . rr_2l5z 1 
       .  3 .  1736 . 1 1  2 A H61  H -18.647  17.961 27.236 . . . 1.0 . . . . . . . . . . . . A .  2 A H61  . . . . . . . . . rr_2l5z 1 
       .  3 .  1737 . 1 1  2 A H62  H -20.365  18.132 26.955 . . . 1.0 . . . . . . . . . . . . A .  2 A H62  . . . . . . . . . rr_2l5z 1 
       .  3 .  1738 . 1 1  2 A H8   H -23.330  16.452 23.535 . . . 1.0 . . . . . . . . . . . . A .  2 A H8   . . . . . . . . . rr_2l5z 1 
       .  3 .  1739 . 1 1  2 A HO2' H -22.252  12.487 20.524 . . . 1.0 . . . . . . . . . . . . A .  2 A HO2' . . . . . . . . . rr_2l5z 1 
       .  3 .  1740 . 1 1  2 A N1   N -18.161  16.512 25.235 . . . 1.0 . . . . . . . . . . . . A .  2 A N1   . . . . . . . . . rr_2l5z 1 
       .  3 .  1741 . 1 1  2 A N3   N -19.003  15.387 23.304 . . . 1.0 . . . . . . . . . . . . A .  2 A N3   . . . . . . . . . rr_2l5z 1 
       .  3 .  1742 . 1 1  2 A N6   N -19.467  17.760 26.682 . . . 1.0 . . . . . . . . . . . . A .  2 A N6   . . . . . . . . . rr_2l5z 1 
       .  3 .  1743 . 1 1  2 A N7   N -21.820  17.016 24.839 . . . 1.0 . . . . . . . . . . . . A .  2 A N7   . . . . . . . . . rr_2l5z 1 
       .  3 .  1744 . 1 1  2 A N9   N -21.399  15.720 23.051 . . . 1.0 . . . . . . . . . . . . A .  2 A N9   . . . . . . . . . rr_2l5z 1 
       .  3 .  1745 . 1 1  2 A O2'  O -21.540  12.613 21.155 . . . 1.0 . . . . . . . . . . . . A .  2 A O2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1746 . 1 1  2 A O3'  O -24.002  12.187 21.851 . . . 1.0 . . . . . . . . . . . . A .  2 A O3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1747 . 1 1  2 A O4'  O -22.907  15.484 21.196 . . . 1.0 . . . . . . . . . . . . A .  2 A O4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1748 . 1 1  2 A O5'  O -25.408  15.627 22.760 . . . 1.0 . . . . . . . . . . . . A .  2 A O5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1749 . 1 1  2 A OP1  O -27.902  15.405 22.683 . . . 1.0 . . . . . . . . . . . . A .  2 A OP1  . . . . . . . . . rr_2l5z 1 
       .  3 .  1750 . 1 1  2 A OP2  O -26.727  16.265 24.792 . . . 1.0 . . . . . . . . . . . . A .  2 A OP2  . . . . . . . . . rr_2l5z 1 
       .  3 .  1751 . 1 1  2 A P    P -26.813  16.183 23.317 . . . 1.0 . . . . . . . . . . . . A .  2 A P    . . . . . . . . . rr_2l5z 1 
       .  3 .  1752 . 1 1  3 G C1'  C -18.970  11.023 23.950 . . . 1.0 . . . . . . . . . . . . A .  3 G C1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1753 . 1 1  3 G C2   C -16.414  13.100 26.902 . . . 1.0 . . . . . . . . . . . . A .  3 G C2   . . . . . . . . . rr_2l5z 1 
       .  3 .  1754 . 1 1  3 G C2'  C -18.914   9.550 24.368 . . . 1.0 . . . . . . . . . . . . A .  3 G C2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1755 . 1 1  3 G C3'  C -20.241   9.004 23.869 . . . 1.0 . . . . . . . . . . . . A .  3 G C3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1756 . 1 1  3 G C4   C -18.347  12.485 25.975 . . . 1.0 . . . . . . . . . . . . A .  3 G C4   . . . . . . . . . rr_2l5z 1 
       .  3 .  1757 . 1 1  3 G C4'  C -20.504   9.849 22.635 . . . 1.0 . . . . . . . . . . . . A .  3 G C4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1758 . 1 1  3 G C5   C -19.128  13.176 26.891 . . . 1.0 . . . . . . . . . . . . A .  3 G C5   . . . . . . . . . rr_2l5z 1 
       .  3 .  1759 . 1 1  3 G C5'  C -21.988   9.882 22.271 . . . 1.0 . . . . . . . . . . . . A .  3 G C5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1760 . 1 1  3 G C6   C -18.498  13.912 27.930 . . . 1.0 . . . . . . . . . . . . A .  3 G C6   . . . . . . . . . rr_2l5z 1 
       .  3 .  1761 . 1 1  3 G C8   C -20.450  12.247 25.558 . . . 1.0 . . . . . . . . . . . . A .  3 G C8   . . . . . . . . . rr_2l5z 1 
       .  3 .  1762 . 1 1  3 G H1   H -16.580  14.329 28.586 . . . 1.0 . . . . . . . . . . . . A .  3 G H1   . . . . . . . . . rr_2l5z 1 
       .  3 .  1763 . 1 1  3 G H1'  H -18.018  11.307 23.499 . . . 1.0 . . . . . . . . . . . . A .  3 G H1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1764 . 1 1  3 G H2'  H -18.862   9.473 25.456 . . . 1.0 . . . . . . . . . . . . A .  3 G H2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1765 . 1 1  3 G H21  H -14.643  13.652 27.739 . . . 1.0 . . . . . . . . . . . . A .  3 G H21  . . . . . . . . . rr_2l5z 1 
       .  3 .  1766 . 1 1  3 G H22  H -14.520  12.622 26.330 . . . 1.0 . . . . . . . . . . . . A .  3 G H22  . . . . . . . . . rr_2l5z 1 
       .  3 .  1767 . 1 1  3 G H3'  H -21.029   9.108 24.619 . . . 1.0 . . . . . . . . . . . . A .  3 G H3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1768 . 1 1  3 G H4'  H -19.932   9.456 21.795 . . . 1.0 . . . . . . . . . . . . A .  3 G H4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1769 . 1 1  3 G H5'  H -22.112  10.415 21.329 . . . 1.0 . . . . . . . . . . . . A .  3 G H5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1770 . 1 1  3 G H5'' H -22.347   8.860 22.151 . . . 1.0 . . . . . . . . . . . . A .  3 G H5'' . . . . . . . . . rr_2l5z 1 
       .  3 .  1771 . 1 1  3 G H8   H -21.351  11.912 25.066 . . . 1.0 . . . . . . . . . . . . A .  3 G H8   . . . . . . . . . rr_2l5z 1 
       .  3 .  1772 . 1 1  3 G HO2' H -17.147   9.539 23.551 . . . 1.0 . . . . . . . . . . . . A .  3 G HO2' . . . . . . . . . rr_2l5z 1 
       .  3 .  1773 . 1 1  3 G N1   N -17.113  13.815 27.856 . . . 1.0 . . . . . . . . . . . . A .  3 G N1   . . . . . . . . . rr_2l5z 1 
       .  3 .  1774 . 1 1  3 G N2   N -15.084  13.127 26.998 . . . 1.0 . . . . . . . . . . . . A .  3 G N2   . . . . . . . . . rr_2l5z 1 
       .  3 .  1775 . 1 1  3 G N3   N -17.000  12.404 25.921 . . . 1.0 . . . . . . . . . . . . A .  3 G N3   . . . . . . . . . rr_2l5z 1 
       .  3 .  1776 . 1 1  3 G N7   N -20.493  13.008 26.603 . . . 1.0 . . . . . . . . . . . . A .  3 G N7   . . . . . . . . . rr_2l5z 1 
       .  3 .  1777 . 1 1  3 G N9   N -19.232  11.887 25.115 . . . 1.0 . . . . . . . . . . . . A .  3 G N9   . . . . . . . . . rr_2l5z 1 
       .  3 .  1778 . 1 1  3 G O2'  O -17.809   8.875 23.756 . . . 1.0 . . . . . . . . . . . . A .  3 G O2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1779 . 1 1  3 G O3'  O -20.053   7.646 23.463 . . . 1.0 . . . . . . . . . . . . A .  3 G O3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1780 . 1 1  3 G O4'  O -20.015  11.145 22.969 . . . 1.0 . . . . . . . . . . . . A .  3 G O4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1781 . 1 1  3 G O5'  O -22.765  10.532 23.279 . . . 1.0 . . . . . . . . . . . . A .  3 G O5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1782 . 1 1  3 G O6   O -19.022  14.576 28.823 . . . 1.0 . . . . . . . . . . . . A .  3 G O6   . . . . . . . . . rr_2l5z 1 
       .  3 .  1783 . 1 1  3 G OP1  O -24.994   9.933 22.309 . . . 1.0 . . . . . . . . . . . . A .  3 G OP1  . . . . . . . . . rr_2l5z 1 
       .  3 .  1784 . 1 1  3 G OP2  O -24.804  11.683 24.171 . . . 1.0 . . . . . . . . . . . . A .  3 G OP2  . . . . . . . . . rr_2l5z 1 
       .  3 .  1785 . 1 1  3 G P    P -24.257  11.042 22.954 . . . 1.0 . . . . . . . . . . . . A .  3 G P    . . . . . . . . . rr_2l5z 1 
       .  3 .  1786 . 1 1  4 C C1'  C -17.152   8.017 28.169 . . . 1.0 . . . . . . . . . . . . A .  4 C C1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1787 . 1 1  4 C C2   C -17.630   9.995 29.617 . . . 1.0 . . . . . . . . . . . . A .  4 C C2   . . . . . . . . . rr_2l5z 1 
       .  3 .  1788 . 1 1  4 C C2'  C -17.335   6.739 29.002 . . . 1.0 . . . . . . . . . . . . A .  4 C C2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1789 . 1 1  4 C C3'  C -17.986   5.766 28.026 . . . 1.0 . . . . . . . . . . . . A .  4 C C3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1790 . 1 1  4 C C4   C -19.721  11.062 29.540 . . . 1.0 . . . . . . . . . . . . A .  4 C C4   . . . . . . . . . rr_2l5z 1 
       .  3 .  1791 . 1 1  4 C C4'  C -17.479   6.252 26.680 . . . 1.0 . . . . . . . . . . . . A .  4 C C4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1792 . 1 1  4 C C5   C -20.188  10.145 28.546 . . . 1.0 . . . . . . . . . . . . A .  4 C C5   . . . . . . . . . rr_2l5z 1 
       .  3 .  1793 . 1 1  4 C C5'  C -18.387   5.813 25.531 . . . 1.0 . . . . . . . . . . . . A .  4 C C5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1794 . 1 1  4 C C6   C -19.341   9.182 28.130 . . . 1.0 . . . . . . . . . . . . A .  4 C C6   . . . . . . . . . rr_2l5z 1 
       .  3 .  1795 . 1 1  4 C H1'  H -16.109   8.343 28.233 . . . 1.0 . . . . . . . . . . . . A .  4 C H1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1796 . 1 1  4 C H2'  H -18.008   6.935 29.840 . . . 1.0 . . . . . . . . . . . . A .  4 C H2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1797 . 1 1  4 C H3'  H -19.076   5.790 28.091 . . . 1.0 . . . . . . . . . . . . A .  4 C H3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1798 . 1 1  4 C H4'  H -16.471   5.879 26.512 . . . 1.0 . . . . . . . . . . . . A .  4 C H4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1799 . 1 1  4 C H41  H -20.206  12.677 30.679 . . . 1.0 . . . . . . . . . . . . A .  4 C H41  . . . . . . . . . rr_2l5z 1 
       .  3 .  1800 . 1 1  4 C H42  H -21.466  12.106 29.610 . . . 1.0 . . . . . . . . . . . . A .  4 C H42  . . . . . . . . . rr_2l5z 1 
       .  3 .  1801 . 1 1  4 C H5   H -21.187  10.223 28.143 . . . 1.0 . . . . . . . . . . . . A .  4 C H5   . . . . . . . . . rr_2l5z 1 
       .  3 .  1802 . 1 1  4 C H5'  H -17.928   6.100 24.586 . . . 1.0 . . . . . . . . . . . . A .  4 C H5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1803 . 1 1  4 C H5'' H -18.496   4.729 25.559 . . . 1.0 . . . . . . . . . . . . A .  4 C H5'' . . . . . . . . . rr_2l5z 1 
       .  3 .  1804 . 1 1  4 C H6   H -19.677   8.451 27.407 . . . 1.0 . . . . . . . . . . . . A .  4 C H6   . . . . . . . . . rr_2l5z 1 
       .  3 .  1805 . 1 1  4 C HO2' H -15.472   6.246 28.724 . . . 1.0 . . . . . . . . . . . . A .  4 C HO2' . . . . . . . . . rr_2l5z 1 
       .  3 .  1806 . 1 1  4 C N1   N -18.077   9.094 28.642 . . . 1.0 . . . . . . . . . . . . A .  4 C N1   . . . . . . . . . rr_2l5z 1 
       .  3 .  1807 . 1 1  4 C N3   N -18.483  10.968 30.039 . . . 1.0 . . . . . . . . . . . . A .  4 C N3   . . . . . . . . . rr_2l5z 1 
       .  3 .  1808 . 1 1  4 C N4   N -20.530  12.026 29.979 . . . 1.0 . . . . . . . . . . . . A .  4 C N4   . . . . . . . . . rr_2l5z 1 
       .  3 .  1809 . 1 1  4 C O2   O -16.492   9.898 30.071 . . . 1.0 . . . . . . . . . . . . A .  4 C O2   . . . . . . . . . rr_2l5z 1 
       .  3 .  1810 . 1 1  4 C O2'  O -16.076   6.240 29.469 . . . 1.0 . . . . . . . . . . . . A .  4 C O2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1811 . 1 1  4 C O3'  O -17.457   4.458 28.264 . . . 1.0 . . . . . . . . . . . . A .  4 C O3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1812 . 1 1  4 C O4'  O -17.440   7.667 26.803 . . . 1.0 . . . . . . . . . . . . A .  4 C O4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1813 . 1 1  4 C O5'  O -19.681   6.415 25.622 . . . 1.0 . . . . . . . . . . . . A .  4 C O5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1814 . 1 1  4 C OP1  O -20.470   5.179 23.590 . . . 1.0 . . . . . . . . . . . . A .  4 C OP1  . . . . . . . . . rr_2l5z 1 
       .  3 .  1815 . 1 1  4 C OP2  O -22.010   6.832 24.800 . . . 1.0 . . . . . . . . . . . . A .  4 C OP2  . . . . . . . . . rr_2l5z 1 
       .  3 .  1816 . 1 1  4 C P    P -20.658   6.439 24.343 . . . 1.0 . . . . . . . . . . . . A .  4 C P    . . . . . . . . . rr_2l5z 1 
       .  3 .  1817 . 1 1  5 U C1'  C -16.266   6.477 33.203 . . . 1.0 . . . . . . . . . . . . A .  5 U C1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1818 . 1 1  5 U C2   C -18.076   7.985 33.981 . . . 1.0 . . . . . . . . . . . . A .  5 U C2   . . . . . . . . . rr_2l5z 1 
       .  3 .  1819 . 1 1  5 U C2'  C -16.058   5.451 34.317 . . . 1.0 . . . . . . . . . . . . A .  5 U C2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1820 . 1 1  5 U C3'  C -16.243   4.138 33.579 . . . 1.0 . . . . . . . . . . . . A .  5 U C3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1821 . 1 1  5 U C4   C -20.379   7.752 33.129 . . . 1.0 . . . . . . . . . . . . A .  5 U C4   . . . . . . . . . rr_2l5z 1 
       .  3 .  1822 . 1 1  5 U C4'  C -15.626   4.440 32.219 . . . 1.0 . . . . . . . . . . . . A .  5 U C4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1823 . 1 1  5 U C5   C -19.890   6.662 32.313 . . . 1.0 . . . . . . . . . . . . A .  5 U C5   . . . . . . . . . rr_2l5z 1 
       .  3 .  1824 . 1 1  5 U C5'  C -16.202   3.550 31.116 . . . 1.0 . . . . . . . . . . . . A .  5 U C5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1825 . 1 1  5 U C6   C -18.587   6.294 32.350 . . . 1.0 . . . . . . . . . . . . A .  5 U C6   . . . . . . . . . rr_2l5z 1 
       .  3 .  1826 . 1 1  5 U H1'  H -15.594   7.327 33.358 . . . 1.0 . . . . . . . . . . . . A .  5 U H1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1827 . 1 1  5 U H2'  H -16.830   5.565 35.084 . . . 1.0 . . . . . . . . . . . . A .  5 U H2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1828 . 1 1  5 U H3   H -19.718   9.115 34.546 . . . 1.0 . . . . . . . . . . . . A .  5 U H3   . . . . . . . . . rr_2l5z 1 
       .  3 .  1829 . 1 1  5 U H3'  H -17.296   3.856 33.510 . . . 1.0 . . . . . . . . . . . . A .  5 U H3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1830 . 1 1  5 U H4'  H -14.548   4.300 32.271 . . . 1.0 . . . . . . . . . . . . A .  5 U H4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1831 . 1 1  5 U H5   H -20.583   6.106 31.700 . . . 1.0 . . . . . . . . . . . . A .  5 U H5   . . . . . . . . . rr_2l5z 1 
       .  3 .  1832 . 1 1  5 U H5'  H -15.545   3.591 30.247 . . . 1.0 . . . . . . . . . . . . A .  5 U H5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1833 . 1 1  5 U H5'' H -16.254   2.521 31.474 . . . 1.0 . . . . . . . . . . . . A .  5 U H5'' . . . . . . . . . rr_2l5z 1 
       .  3 .  1834 . 1 1  5 U H6   H -18.252   5.479 31.725 . . . 1.0 . . . . . . . . . . . . A .  5 U H6   . . . . . . . . . rr_2l5z 1 
       .  3 .  1835 . 1 1  5 U HO2' H -14.590   4.747 35.386 . . . 1.0 . . . . . . . . . . . . A .  5 U HO2' . . . . . . . . . rr_2l5z 1 
       .  3 .  1836 . 1 1  5 U N1   N -17.685   6.930 33.161 . . . 1.0 . . . . . . . . . . . . A .  5 U N1   . . . . . . . . . rr_2l5z 1 
       .  3 .  1837 . 1 1  5 U N3   N -19.410   8.342 33.921 . . . 1.0 . . . . . . . . . . . . A .  5 U N3   . . . . . . . . . rr_2l5z 1 
       .  3 .  1838 . 1 1  5 U O2   O -17.281   8.567 34.715 . . . 1.0 . . . . . . . . . . . . A .  5 U O2   . . . . . . . . . rr_2l5z 1 
       .  3 .  1839 . 1 1  5 U O2'  O -14.748   5.553 34.887 . . . 1.0 . . . . . . . . . . . . A .  5 U O2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1840 . 1 1  5 U O3'  O -15.452   3.134 34.223 . . . 1.0 . . . . . . . . . . . . A .  5 U O3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1841 . 1 1  5 U O4   O -21.538   8.161 33.147 . . . 1.0 . . . . . . . . . . . . A .  5 U O4   . . . . . . . . . rr_2l5z 1 
       .  3 .  1842 . 1 1  5 U O4'  O -15.907   5.819 31.973 . . . 1.0 . . . . . . . . . . . . A .  5 U O4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1843 . 1 1  5 U O5'  O -17.511   3.976 30.728 . . . 1.0 . . . . . . . . . . . . A .  5 U O5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1844 . 1 1  5 U OP1  O -17.682   2.100 29.077 . . . 1.0 . . . . . . . . . . . . A .  5 U OP1  . . . . . . . . . rr_2l5z 1 
       .  3 .  1845 . 1 1  5 U OP2  O -19.601   3.774 29.363 . . . 1.0 . . . . . . . . . . . . A .  5 U OP2  . . . . . . . . . rr_2l5z 1 
       .  3 .  1846 . 1 1  5 U P    P -18.150   3.480 29.337 . . . 1.0 . . . . . . . . . . . . A .  5 U P    . . . . . . . . . rr_2l5z 1 
       .  3 .  1847 . 1 1  6 G C1'  C -17.575   5.397 38.750 . . . 1.0 . . . . . . . . . . . . A .  6 G C1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1848 . 1 1  6 G C2   C -20.312   8.803 38.040 . . . 1.0 . . . . . . . . . . . . A .  6 G C2   . . . . . . . . . rr_2l5z 1 
       .  3 .  1849 . 1 1  6 G C2'  C -17.982   4.407 39.842 . . . 1.0 . . . . . . . . . . . . A .  6 G C2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1850 . 1 1  6 G C3'  C -17.374   3.101 39.360 . . . 1.0 . . . . . . . . . . . . A .  6 G C3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1851 . 1 1  6 G C4   C -19.482   6.763 37.686 . . . 1.0 . . . . . . . . . . . . A .  6 G C4   . . . . . . . . . rr_2l5z 1 
       .  3 .  1852 . 1 1  6 G C4'  C -16.122   3.560 38.617 . . . 1.0 . . . . . . . . . . . . A .  6 G C4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1853 . 1 1  6 G C5   C -20.361   6.470 36.653 . . . 1.0 . . . . . . . . . . . . A .  6 G C5   . . . . . . . . . rr_2l5z 1 
       .  3 .  1854 . 1 1  6 G C5'  C -15.700   2.566 37.534 . . . 1.0 . . . . . . . . . . . . A .  6 G C5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1855 . 1 1  6 G C6   C -21.324   7.438 36.260 . . . 1.0 . . . . . . . . . . . . A .  6 G C6   . . . . . . . . . rr_2l5z 1 
       .  3 .  1856 . 1 1  6 G C8   C -19.137   4.788 36.892 . . . 1.0 . . . . . . . . . . . . A .  6 G C8   . . . . . . . . . rr_2l5z 1 
       .  3 .  1857 . 1 1  6 G H1   H -21.899   9.353 36.794 . . . 1.0 . . . . . . . . . . . . A .  6 G H1   . . . . . . . . . rr_2l5z 1 
       .  3 .  1858 . 1 1  6 G H1'  H -17.273   6.337 39.212 . . . 1.0 . . . . . . . . . . . . A .  6 G H1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1859 . 1 1  6 G H2'  H -19.071   4.321 39.883 . . . 1.0 . . . . . . . . . . . . A .  6 G H2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1860 . 1 1  6 G H21  H -21.064  10.665 38.374 . . . 1.0 . . . . . . . . . . . . A .  6 G H21  . . . . . . . . . rr_2l5z 1 
       .  3 .  1861 . 1 1  6 G H22  H -19.737  10.192 39.412 . . . 1.0 . . . . . . . . . . . . A .  6 G H22  . . . . . . . . . rr_2l5z 1 
       .  3 .  1862 . 1 1  6 G H3'  H -18.066   2.543 38.723 . . . 1.0 . . . . . . . . . . . . A .  6 G H3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1863 . 1 1  6 G H4'  H -15.307   3.687 39.327 . . . 1.0 . . . . . . . . . . . . A .  6 G H4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1864 . 1 1  6 G H5'  H -14.692   2.807 37.205 . . . 1.0 . . . . . . . . . . . . A .  6 G H5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1865 . 1 1  6 G H5'' H -15.709   1.559 37.950 . . . 1.0 . . . . . . . . . . . . A .  6 G H5'' . . . . . . . . . rr_2l5z 1 
       .  3 .  1866 . 1 1  6 G H8   H -18.693   3.811 36.770 . . . 1.0 . . . . . . . . . . . . A .  6 G H8   . . . . . . . . . rr_2l5z 1 
       .  3 .  1867 . 1 1  6 G HO2' H -17.152   5.698 41.041 . . . 1.0 . . . . . . . . . . . . A .  6 G HO2' . . . . . . . . . rr_2l5z 1 
       .  3 .  1868 . 1 1  6 G N1   N -21.224   8.596 37.023 . . . 1.0 . . . . . . . . . . . . A .  6 G N1   . . . . . . . . . rr_2l5z 1 
       .  3 .  1869 . 1 1  6 G N2   N -20.376   9.982 38.659 . . . 1.0 . . . . . . . . . . . . A .  6 G N2   . . . . . . . . . rr_2l5z 1 
       .  3 .  1870 . 1 1  6 G N3   N -19.402   7.898 38.417 . . . 1.0 . . . . . . . . . . . . A .  6 G N3   . . . . . . . . . rr_2l5z 1 
       .  3 .  1871 . 1 1  6 G N7   N -20.121   5.181 36.150 . . . 1.0 . . . . . . . . . . . . A .  6 G N7   . . . . . . . . . rr_2l5z 1 
       .  3 .  1872 . 1 1  6 G N9   N -18.693   5.651 37.823 . . . 1.0 . . . . . . . . . . . . A .  6 G N9   . . . . . . . . . rr_2l5z 1 
       .  3 .  1873 . 1 1  6 G O2'  O -17.453   4.789 41.117 . . . 1.0 . . . . . . . . . . . . A .  6 G O2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1874 . 1 1  6 G O3'  O -16.963   2.347 40.504 . . . 1.0 . . . . . . . . . . . . A .  6 G O3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1875 . 1 1  6 G O4'  O -16.455   4.828 38.055 . . . 1.0 . . . . . . . . . . . . A .  6 G O4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1876 . 1 1  6 G O5'  O -16.580   2.613 36.408 . . . 1.0 . . . . . . . . . . . . A .  6 G O5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1877 . 1 1  6 G O6   O -22.170   7.355 35.373 . . . 1.0 . . . . . . . . . . . . A .  6 G O6   . . . . . . . . . rr_2l5z 1 
       .  3 .  1878 . 1 1  6 G OP1  O -15.132   0.896 35.301 . . . 1.0 . . . . . . . . . . . . A .  6 G OP1  . . . . . . . . . rr_2l5z 1 
       .  3 .  1879 . 1 1  6 G OP2  O -17.393   1.552 34.291 . . . 1.0 . . . . . . . . . . . . A .  6 G OP2  . . . . . . . . . rr_2l5z 1 
       .  3 .  1880 . 1 1  6 G P    P -16.158   1.924 35.016 . . . 1.0 . . . . . . . . . . . . A .  6 G P    . . . . . . . . . rr_2l5z 1 
       .  3 .  1881 . 1 1  7 C C1'  C -18.856   4.151 45.355 . . . 1.0 . . . . . . . . . . . . A .  7 C C1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1882 . 1 1  7 C C2   C -21.268   4.581 45.445 . . . 1.0 . . . . . . . . . . . . A .  7 C C2   . . . . . . . . . rr_2l5z 1 
       .  3 .  1883 . 1 1  7 C C2'  C -18.822   2.889 46.216 . . . 1.0 . . . . . . . . . . . . A .  7 C C2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1884 . 1 1  7 C C3'  C -18.085   1.903 45.329 . . . 1.0 . . . . . . . . . . . . A .  7 C C3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1885 . 1 1  7 C C4   C -22.587   4.544 43.501 . . . 1.0 . . . . . . . . . . . . A .  7 C C4   . . . . . . . . . rr_2l5z 1 
       .  3 .  1886 . 1 1  7 C C4'  C -17.102   2.795 44.577 . . . 1.0 . . . . . . . . . . . . A .  7 C C4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1887 . 1 1  7 C C5   C -21.445   4.237 42.696 . . . 1.0 . . . . . . . . . . . . A .  7 C C5   . . . . . . . . . rr_2l5z 1 
       .  3 .  1888 . 1 1  7 C C5'  C -16.703   2.189 43.222 . . . 1.0 . . . . . . . . . . . . A .  7 C C5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1889 . 1 1  7 C C6   C -20.256   4.115 43.317 . . . 1.0 . . . . . . . . . . . . A .  7 C C6   . . . . . . . . . rr_2l5z 1 
       .  3 .  1890 . 1 1  7 C H1'  H -18.692   5.023 45.986 . . . 1.0 . . . . . . . . . . . . A .  7 C H1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1891 . 1 1  7 C H2'  H -19.840   2.534 46.402 . . . 1.0 . . . . . . . . . . . . A .  7 C H2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1892 . 1 1  7 C H3'  H -18.769   1.374 44.663 . . . 1.0 . . . . . . . . . . . . A .  7 C H3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1893 . 1 1  7 C H4'  H -16.214   2.956 45.190 . . . 1.0 . . . . . . . . . . . . A .  7 C H4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1894 . 1 1  7 C H41  H -24.592   4.888 43.491 . . . 1.0 . . . . . . . . . . . . A .  7 C H41  . . . . . . . . . rr_2l5z 1 
       .  3 .  1895 . 1 1  7 C H42  H -23.879   4.553 41.929 . . . 1.0 . . . . . . . . . . . . A .  7 C H42  . . . . . . . . . rr_2l5z 1 
       .  3 .  1896 . 1 1  7 C H5   H -21.533   4.106 41.628 . . . 1.0 . . . . . . . . . . . . A .  7 C H5   . . . . . . . . . rr_2l5z 1 
       .  3 .  1897 . 1 1  7 C H5'  H -16.479   2.997 42.524 . . . 1.0 . . . . . . . . . . . . A .  7 C H5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1898 . 1 1  7 C H5'' H -15.815   1.567 43.346 . . . 1.0 . . . . . . . . . . . . A .  7 C H5'' . . . . . . . . . rr_2l5z 1 
       .  3 .  1899 . 1 1  7 C H6   H -19.373   3.884 42.740 . . . 1.0 . . . . . . . . . . . . A .  7 C H6   . . . . . . . . . rr_2l5z 1 
       .  3 .  1900 . 1 1  7 C HO2' H -17.559   2.351 47.596 . . . 1.0 . . . . . . . . . . . . A .  7 C HO2' . . . . . . . . . rr_2l5z 1 
       .  3 .  1901 . 1 1  7 C N1   N -20.157   4.283 44.668 . . . 1.0 . . . . . . . . . . . . A .  7 C N1   . . . . . . . . . rr_2l5z 1 
       .  3 .  1902 . 1 1  7 C N3   N -22.473   4.704 44.826 . . . 1.0 . . . . . . . . . . . . A .  7 C N3   . . . . . . . . . rr_2l5z 1 
       .  3 .  1903 . 1 1  7 C N4   N -23.782   4.672 42.928 . . . 1.0 . . . . . . . . . . . . A .  7 C N4   . . . . . . . . . rr_2l5z 1 
       .  3 .  1904 . 1 1  7 C O2   O -21.152   4.726 46.661 . . . 1.0 . . . . . . . . . . . . A .  7 C O2   . . . . . . . . . rr_2l5z 1 
       .  3 .  1905 . 1 1  7 C O2'  O -18.125   3.111 47.447 . . . 1.0 . . . . . . . . . . . . A .  7 C O2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1906 . 1 1  7 C O3'  O -17.344   1.009 46.166 . . . 1.0 . . . . . . . . . . . . A .  7 C O3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1907 . 1 1  7 C O4'  O -17.781   4.041 44.405 . . . 1.0 . . . . . . . . . . . . A .  7 C O4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1908 . 1 1  7 C O5'  O -17.758   1.387 42.684 . . . 1.0 . . . . . . . . . . . . A .  7 C O5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1909 . 1 1  7 C OP1  O -17.299  -0.123 40.740 . . . 1.0 . . . . . . . . . . . . A .  7 C OP1  . . . . . . . . . rr_2l5z 1 
       .  3 .  1910 . 1 1  7 C OP2  O -19.301   1.476 40.713 . . . 1.0 . . . . . . . . . . . . A .  7 C OP2  . . . . . . . . . rr_2l5z 1 
       .  3 .  1911 . 1 1  7 C P    P -17.901   1.181 41.094 . . . 1.0 . . . . . . . . . . . . A .  7 C P    . . . . . . . . . rr_2l5z 1 
       .  3 .  1912 . 1 1  8 A C1'  C -22.946   0.405 44.622 . . . 1.0 . . . . . . . . . . . . A .  8 A C1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1913 . 1 1  8 A C2   C -26.350   3.179 44.094 . . . 1.0 . . . . . . . . . . . . A .  8 A C2   . . . . . . . . . rr_2l5z 1 
       .  3 .  1914 . 1 1  8 A C2'  C -21.708   0.813 43.846 . . . 1.0 . . . . . . . . . . . . A .  8 A C2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1915 . 1 1  8 A C3'  C -20.985  -0.514 43.672 . . . 1.0 . . . . . . . . . . . . A .  8 A C3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1916 . 1 1  8 A C4   C -24.579   2.337 45.112 . . . 1.0 . . . . . . . . . . . . A .  8 A C4   . . . . . . . . . rr_2l5z 1 
       .  3 .  1917 . 1 1  8 A C4'  C -21.405  -1.334 44.916 . . . 1.0 . . . . . . . . . . . . A .  8 A C4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1918 . 1 1  8 A C5   C -24.650   3.240 46.149 . . . 1.0 . . . . . . . . . . . . A .  8 A C5   . . . . . . . . . rr_2l5z 1 
       .  3 .  1919 . 1 1  8 A C5'  C -20.277  -1.488 45.950 . . . 1.0 . . . . . . . . . . . . A .  8 A C5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1920 . 1 1  8 A C6   C -25.692   4.173 46.092 . . . 1.0 . . . . . . . . . . . . A .  8 A C6   . . . . . . . . . rr_2l5z 1 
       .  3 .  1921 . 1 1  8 A C8   C -23.001   2.013 46.544 . . . 1.0 . . . . . . . . . . . . A .  8 A C8   . . . . . . . . . rr_2l5z 1 
       .  3 .  1922 . 1 1  8 A H1'  H -23.702   0.029 43.931 . . . 1.0 . . . . . . . . . . . . A .  8 A H1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1923 . 1 1  8 A H2   H -27.063   3.183 43.271 . . . 1.0 . . . . . . . . . . . . A .  8 A H2   . . . . . . . . . rr_2l5z 1 
       .  3 .  1924 . 1 1  8 A H2'  H -21.102   1.498 44.443 . . . 1.0 . . . . . . . . . . . . A .  8 A H2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1925 . 1 1  8 A H3'  H -19.902  -0.376 43.583 . . . 1.0 . . . . . . . . . . . . A .  8 A H3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1926 . 1 1  8 A H4'  H -21.728  -2.322 44.595 . . . 1.0 . . . . . . . . . . . . A .  8 A H4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1927 . 1 1  8 A H5'  H -20.715  -1.717 46.921 . . . 1.0 . . . . . . . . . . . . A .  8 A H5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1928 . 1 1  8 A H5'' H -19.630  -2.311 45.649 . . . 1.0 . . . . . . . . . . . . A .  8 A H5'' . . . . . . . . . rr_2l5z 1 
       .  3 .  1929 . 1 1  8 A H61  H -26.654   5.755 46.936 . . . 1.0 . . . . . . . . . . . . A .  8 A H61  . . . . . . . . . rr_2l5z 1 
       .  3 .  1930 . 1 1  8 A H62  H -25.266   5.162 47.819 . . . 1.0 . . . . . . . . . . . . A .  8 A H62  . . . . . . . . . rr_2l5z 1 
       .  3 .  1931 . 1 1  8 A H8   H -22.131   1.575 47.006 . . . 1.0 . . . . . . . . . . . . A .  8 A H8   . . . . . . . . . rr_2l5z 1 
       .  3 .  1932 . 1 1  8 A HO2' H -21.499   0.976 41.917 . . . 1.0 . . . . . . . . . . . . A .  8 A HO2' . . . . . . . . . rr_2l5z 1 
       .  3 .  1933 . 1 1  8 A N1   N -26.526   4.106 45.038 . . . 1.0 . . . . . . . . . . . . A .  8 A N1   . . . . . . . . . rr_2l5z 1 
       .  3 .  1934 . 1 1  8 A N3   N -25.399   2.248 44.048 . . . 1.0 . . . . . . . . . . . . A .  8 A N3   . . . . . . . . . rr_2l5z 1 
       .  3 .  1935 . 1 1  8 A N6   N -25.885   5.105 47.025 . . . 1.0 . . . . . . . . . . . . A .  8 A N6   . . . . . . . . . rr_2l5z 1 
       .  3 .  1936 . 1 1  8 A N7   N -23.617   3.020 47.075 . . . 1.0 . . . . . . . . . . . . A .  8 A N7   . . . . . . . . . rr_2l5z 1 
       .  3 .  1937 . 1 1  8 A N9   N -23.496   1.542 45.385 . . . 1.0 . . . . . . . . . . . . A .  8 A N9   . . . . . . . . . rr_2l5z 1 
       .  3 .  1938 . 1 1  8 A O2'  O -22.049   1.396 42.583 . . . 1.0 . . . . . . . . . . . . A .  8 A O2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1939 . 1 1  8 A O3'  O -21.528  -1.162 42.518 . . . 1.0 . . . . . . . . . . . . A .  8 A O3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1940 . 1 1  8 A O4'  O -22.527  -0.650 45.491 . . . 1.0 . . . . . . . . . . . . A .  8 A O4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1941 . 1 1  8 A O5'  O -19.493  -0.297 46.059 . . . 1.0 . . . . . . . . . . . . A .  8 A O5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1942 . 1 1  8 A OP1  O -18.158  -0.239 48.179 . . . 1.0 . . . . . . . . . . . . A .  8 A OP1  . . . . . . . . . rr_2l5z 1 
       .  3 .  1943 . 1 1  8 A OP2  O -17.293  -1.495 46.119 . . . 1.0 . . . . . . . . . . . . A .  8 A OP2  . . . . . . . . . rr_2l5z 1 
       .  3 .  1944 . 1 1  8 A P    P -18.019  -0.348 46.710 . . . 1.0 . . . . . . . . . . . . A .  8 A P    . . . . . . . . . rr_2l5z 1 
       .  3 .  1945 . 1 1  9 G C1'  C -23.332   2.103 40.405 . . . 1.0 . . . . . . . . . . . . A .  9 G C1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1946 . 1 1  9 G C2   C -25.066   6.162 40.268 . . . 1.0 . . . . . . . . . . . . A .  9 G C2   . . . . . . . . . rr_2l5z 1 
       .  3 .  1947 . 1 1  9 G C2'  C -24.604   1.257 40.258 . . . 1.0 . . . . . . . . . . . . A .  9 G C2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1948 . 1 1  9 G C3'  C -24.085  -0.080 39.744 . . . 1.0 . . . . . . . . . . . . A .  9 G C3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1949 . 1 1  9 G C4   C -23.907   4.431 39.474 . . . 1.0 . . . . . . . . . . . . A .  9 G C4   . . . . . . . . . rr_2l5z 1 
       .  3 .  1950 . 1 1  9 G C4'  C -22.670  -0.125 40.295 . . . 1.0 . . . . . . . . . . . . A .  9 G C4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1951 . 1 1  9 G C5   C -23.626   5.039 38.260 . . . 1.0 . . . . . . . . . . . . A .  9 G C5   . . . . . . . . . rr_2l5z 1 
       .  3 .  1952 . 1 1  9 G C5'  C -21.769  -1.067 39.494 . . . 1.0 . . . . . . . . . . . . A .  9 G C5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1953 . 1 1  9 G C6   C -24.112   6.349 38.007 . . . 1.0 . . . . . . . . . . . . A .  9 G C6   . . . . . . . . . rr_2l5z 1 
       .  3 .  1954 . 1 1  9 G C8   C -22.729   3.145 38.205 . . . 1.0 . . . . . . . . . . . . A .  9 G C8   . . . . . . . . . rr_2l5z 1 
       .  3 .  1955 . 1 1  9 G H1   H -25.226   7.799 38.975 . . . 1.0 . . . . . . . . . . . . A .  9 G H1   . . . . . . . . . rr_2l5z 1 
       .  3 .  1956 . 1 1  9 G H1'  H -23.298   2.526 41.408 . . . 1.0 . . . . . . . . . . . . A .  9 G H1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1957 . 1 1  9 G H2'  H -25.270   1.711 39.519 . . . 1.0 . . . . . . . . . . . . A .  9 G H2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1958 . 1 1  9 G H21  H -26.115   7.740 41.011 . . . 1.0 . . . . . . . . . . . . A .  9 G H21  . . . . . . . . . rr_2l5z 1 
       .  3 .  1959 . 1 1  9 G H22  H -25.968   6.364 42.081 . . . 1.0 . . . . . . . . . . . . A .  9 G H22  . . . . . . . . . rr_2l5z 1 
       .  3 .  1960 . 1 1  9 G H3'  H -24.106  -0.134 38.653 . . . 1.0 . . . . . . . . . . . . A .  9 G H3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1961 . 1 1  9 G H4'  H -22.693  -0.441 41.337 . . . 1.0 . . . . . . . . . . . . A .  9 G H4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1962 . 1 1  9 G H5'  H -22.305  -1.998 39.302 . . . 1.0 . . . . . . . . . . . . A .  9 G H5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1963 . 1 1  9 G H5'' H -21.519  -0.597 38.543 . . . 1.0 . . . . . . . . . . . . A .  9 G H5'' . . . . . . . . . rr_2l5z 1 
       .  3 .  1964 . 1 1  9 G H8   H -22.171   2.278 37.884 . . . 1.0 . . . . . . . . . . . . A .  9 G H8   . . . . . . . . . rr_2l5z 1 
       .  3 .  1965 . 1 1  9 G HO2' H -24.606   0.882 42.169 . . . 1.0 . . . . . . . . . . . . A .  9 G HO2' . . . . . . . . . rr_2l5z 1 
       .  3 .  1966 . 1 1  9 G N1   N -24.835   6.842 39.087 . . . 1.0 . . . . . . . . . . . . A .  9 G N1   . . . . . . . . . rr_2l5z 1 
       .  3 .  1967 . 1 1  9 G N2   N -25.773   6.807 41.195 . . . 1.0 . . . . . . . . . . . . A .  9 G N2   . . . . . . . . . rr_2l5z 1 
       .  3 .  1968 . 1 1  9 G N3   N -24.614   4.929 40.513 . . . 1.0 . . . . . . . . . . . . A .  9 G N3   . . . . . . . . . rr_2l5z 1 
       .  3 .  1969 . 1 1  9 G N7   N -22.858   4.186 37.448 . . . 1.0 . . . . . . . . . . . . A .  9 G N7   . . . . . . . . . rr_2l5z 1 
       .  3 .  1970 . 1 1  9 G N9   N -23.316   3.197 39.416 . . . 1.0 . . . . . . . . . . . . A .  9 G N9   . . . . . . . . . rr_2l5z 1 
       .  3 .  1971 . 1 1  9 G O2'  O -25.273   1.105 41.516 . . . 1.0 . . . . . . . . . . . . A .  9 G O2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1972 . 1 1  9 G O3'  O -24.846  -1.127 40.353 . . . 1.0 . . . . . . . . . . . . A .  9 G O3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1973 . 1 1  9 G O4'  O -22.214   1.220 40.225 . . . 1.0 . . . . . . . . . . . . A .  9 G O4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1974 . 1 1  9 G O5'  O -20.563  -1.362 40.203 . . . 1.0 . . . . . . . . . . . . A .  9 G O5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1975 . 1 1  9 G O6   O -23.975   7.033 36.996 . . . 1.0 . . . . . . . . . . . . A .  9 G O6   . . . . . . . . . rr_2l5z 1 
       .  3 .  1976 . 1 1  9 G OP1  O -21.335  -3.408 41.426 . . . 1.0 . . . . . . . . . . . . A .  9 G OP1  . . . . . . . . . rr_2l5z 1 
       .  3 .  1977 . 1 1  9 G OP2  O -19.244  -2.136 42.188 . . . 1.0 . . . . . . . . . . . . A .  9 G OP2  . . . . . . . . . rr_2l5z 1 
       .  3 .  1978 . 1 1  9 G P    P -20.610  -2.131 41.617 . . . 1.0 . . . . . . . . . . . . A .  9 G P    . . . . . . . . . rr_2l5z 1 
       .  3 .  1979 . 1 1 10 C C1'  C -28.607   2.487 40.554 . . . 1.0 . . . . . . . . . . . . A . 10 C C1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1980 . 1 1 10 C C2   C -29.315   3.435 38.398 . . . 1.0 . . . . . . . . . . . . A . 10 C C2   . . . . . . . . . rr_2l5z 1 
       .  3 .  1981 . 1 1 10 C C2'  C -29.940   1.978 41.096 . . . 1.0 . . . . . . . . . . . . A . 10 C C2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1982 . 1 1 10 C C3'  C -29.639   0.518 41.378 . . . 1.0 . . . . . . . . . . . . A . 10 C C3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1983 . 1 1 10 C C4   C -28.595   2.510 36.364 . . . 1.0 . . . . . . . . . . . . A . 10 C C4   . . . . . . . . . rr_2l5z 1 
       .  3 .  1984 . 1 1 10 C C4'  C -28.182   0.558 41.827 . . . 1.0 . . . . . . . . . . . . A . 10 C C4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1985 . 1 1 10 C C5   C -27.852   1.500 37.051 . . . 1.0 . . . . . . . . . . . . A . 10 C C5   . . . . . . . . . rr_2l5z 1 
       .  3 .  1986 . 1 1 10 C C5'  C -27.458  -0.764 41.562 . . . 1.0 . . . . . . . . . . . . A . 10 C C5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1987 . 1 1 10 C C6   C -27.878   1.508 38.398 . . . 1.0 . . . . . . . . . . . . A . 10 C C6   . . . . . . . . . rr_2l5z 1 
       .  3 .  1988 . 1 1 10 C H1'  H -28.436   3.509 40.898 . . . 1.0 . . . . . . . . . . . . A . 10 C H1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1989 . 1 1 10 C H2'  H -30.714   2.061 40.329 . . . 1.0 . . . . . . . . . . . . A . 10 C H2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1990 . 1 1 10 C H3'  H -29.790  -0.104 40.492 . . . 1.0 . . . . . . . . . . . . A . 10 C H3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1991 . 1 1 10 C H4'  H -28.137   0.788 42.890 . . . 1.0 . . . . . . . . . . . . A . 10 C H4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1992 . 1 1 10 C H41  H -29.111   3.258 34.544 . . . 1.0 . . . . . . . . . . . . A . 10 C H41  . . . . . . . . . rr_2l5z 1 
       .  3 .  1993 . 1 1 10 C H42  H -28.058   1.861 34.513 . . . 1.0 . . . . . . . . . . . . A . 10 C H42  . . . . . . . . . rr_2l5z 1 
       .  3 .  1994 . 1 1 10 C H5   H -27.289   0.756 36.508 . . . 1.0 . . . . . . . . . . . . A . 10 C H5   . . . . . . . . . rr_2l5z 1 
       .  3 .  1995 . 1 1 10 C H5'  H -26.459  -0.715 41.994 . . . 1.0 . . . . . . . . . . . . A . 10 C H5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  1996 . 1 1 10 C H5'' H -28.011  -1.574 42.039 . . . 1.0 . . . . . . . . . . . . A . 10 C H5'' . . . . . . . . . rr_2l5z 1 
       .  3 .  1997 . 1 1 10 C H6   H -27.336   0.752 38.949 . . . 1.0 . . . . . . . . . . . . A . 10 C H6   . . . . . . . . . rr_2l5z 1 
       .  3 .  1998 . 1 1 10 C HO2' H -30.905   3.390 42.026 . . . 1.0 . . . . . . . . . . . . A . 10 C HO2' . . . . . . . . . rr_2l5z 1 
       .  3 .  1999 . 1 1 10 C N1   N -28.593   2.457 39.073 . . . 1.0 . . . . . . . . . . . . A . 10 C N1   . . . . . . . . . rr_2l5z 1 
       .  3 .  2000 . 1 1 10 C N3   N -29.293   3.430 37.039 . . . 1.0 . . . . . . . . . . . . A . 10 C N3   . . . . . . . . . rr_2l5z 1 
       .  3 .  2001 . 1 1 10 C N4   N -28.587   2.545 35.033 . . . 1.0 . . . . . . . . . . . . A . 10 C N4   . . . . . . . . . rr_2l5z 1 
       .  3 .  2002 . 1 1 10 C O2   O -29.957   4.276 39.028 . . . 1.0 . . . . . . . . . . . . A . 10 C O2   . . . . . . . . . rr_2l5z 1 
       .  3 .  2003 . 1 1 10 C O2'  O -30.321   2.675 42.288 . . . 1.0 . . . . . . . . . . . . A . 10 C O2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2004 . 1 1 10 C O3'  O -30.444   0.094 42.481 . . . 1.0 . . . . . . . . . . . . A . 10 C O3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2005 . 1 1 10 C O4'  O -27.585   1.630 41.093 . . . 1.0 . . . . . . . . . . . . A . 10 C O4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2006 . 1 1 10 C O5'  O -27.353  -1.034 40.160 . . . 1.0 . . . . . . . . . . . . A . 10 C O5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2007 . 1 1 10 C OP1  O -26.157  -3.229 39.978 . . . 1.0 . . . . . . . . . . . . A . 10 C OP1  . . . . . . . . . rr_2l5z 1 
       .  3 .  2008 . 1 1 10 C OP2  O -25.949  -1.467 38.130 . . . 1.0 . . . . . . . . . . . . A . 10 C OP2  . . . . . . . . . rr_2l5z 1 
       .  3 .  2009 . 1 1 10 C P    P -26.073  -1.811 39.564 . . . 1.0 . . . . . . . . . . . . A . 10 C P    . . . . . . . . . rr_2l5z 1 
       .  3 .  2010 . 1 1 11 A C1'  C -35.026   2.836 39.909 . . . 1.0 . . . . . . . . . . . . A . 11 A C1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2011 . 1 1 11 A C2   C -34.769   4.320 35.742 . . . 1.0 . . . . . . . . . . . . A . 11 A C2   . . . . . . . . . rr_2l5z 1 
       .  3 .  2012 . 1 1 11 A C2'  C -36.146   1.825 40.139 . . . 1.0 . . . . . . . . . . . . A . 11 A C2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2013 . 1 1 11 A C3'  C -35.533   0.883 41.158 . . . 1.0 . . . . . . . . . . . . A . 11 A C3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2014 . 1 1 11 A C4   C -34.247   3.024 37.456 . . . 1.0 . . . . . . . . . . . . A . 11 A C4   . . . . . . . . . rr_2l5z 1 
       .  3 .  2015 . 1 1 11 A C4'  C -34.667   1.818 41.996 . . . 1.0 . . . . . . . . . . . . A . 11 A C4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2016 . 1 1 11 A C5   C -33.324   2.307 36.729 . . . 1.0 . . . . . . . . . . . . A . 11 A C5   . . . . . . . . . rr_2l5z 1 
       .  3 .  2017 . 1 1 11 A C5'  C -33.496   1.083 42.651 . . . 1.0 . . . . . . . . . . . . A . 11 A C5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2018 . 1 1 11 A C6   C -33.157   2.679 35.392 . . . 1.0 . . . . . . . . . . . . A . 11 A C6   . . . . . . . . . rr_2l5z 1 
       .  3 .  2019 . 1 1 11 A C8   C -33.318   1.497 38.659 . . . 1.0 . . . . . . . . . . . . A . 11 A C8   . . . . . . . . . rr_2l5z 1 
       .  3 .  2020 . 1 1 11 A H1'  H -35.458   3.828 39.774 . . . 1.0 . . . . . . . . . . . . A . 11 A H1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2021 . 1 1 11 A H2   H -35.324   5.153 35.311 . . . 1.0 . . . . . . . . . . . . A . 11 A H2   . . . . . . . . . rr_2l5z 1 
       .  3 .  2022 . 1 1 11 A H2'  H -36.362   1.288 39.213 . . . 1.0 . . . . . . . . . . . . A . 11 A H2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2023 . 1 1 11 A H3'  H -34.957   0.089 40.678 . . . 1.0 . . . . . . . . . . . . A . 11 A H3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2024 . 1 1 11 A H4'  H -35.278   2.283 42.769 . . . 1.0 . . . . . . . . . . . . A . 11 A H4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2025 . 1 1 11 A H5'  H -32.777   1.815 43.021 . . . 1.0 . . . . . . . . . . . . A . 11 A H5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2026 . 1 1 11 A H5'' H -33.868   0.496 43.491 . . . 1.0 . . . . . . . . . . . . A . 11 A H5'' . . . . . . . . . rr_2l5z 1 
       .  3 .  2027 . 1 1 11 A H61  H -32.215   2.381 33.613 . . . 1.0 . . . . . . . . . . . . A . 11 A H61  . . . . . . . . . rr_2l5z 1 
       .  3 .  2028 . 1 1 11 A H62  H -31.733   1.308 34.909 . . . 1.0 . . . . . . . . . . . . A . 11 A H62  . . . . . . . . . rr_2l5z 1 
       .  3 .  2029 . 1 1 11 A H8   H -33.078   0.895 39.522 . . . 1.0 . . . . . . . . . . . . A . 11 A H8   . . . . . . . . . rr_2l5z 1 
       .  3 .  2030 . 1 1 11 A HO2' H -38.028   1.801 40.640 . . . 1.0 . . . . . . . . . . . . A . 11 A HO2' . . . . . . . . . rr_2l5z 1 
       .  3 .  2031 . 1 1 11 A N1   N -33.905   3.699 34.934 . . . 1.0 . . . . . . . . . . . . A . 11 A N1   . . . . . . . . . rr_2l5z 1 
       .  3 .  2032 . 1 1 11 A N3   N -35.009   4.048 37.024 . . . 1.0 . . . . . . . . . . . . A . 11 A N3   . . . . . . . . . rr_2l5z 1 
       .  3 .  2033 . 1 1 11 A N6   N -32.298   2.074 34.572 . . . 1.0 . . . . . . . . . . . . A . 11 A N6   . . . . . . . . . rr_2l5z 1 
       .  3 .  2034 . 1 1 11 A N7   N -32.726   1.315 37.524 . . . 1.0 . . . . . . . . . . . . A . 11 A N7   . . . . . . . . . rr_2l5z 1 
       .  3 .  2035 . 1 1 11 A N9   N -34.233   2.481 38.716 . . . 1.0 . . . . . . . . . . . . A . 11 A N9   . . . . . . . . . rr_2l5z 1 
       .  3 .  2036 . 1 1 11 A O2'  O -37.326   2.455 40.651 . . . 1.0 . . . . . . . . . . . . A . 11 A O2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2037 . 1 1 11 A O3'  O -36.580   0.366 41.987 . . . 1.0 . . . . . . . . . . . . A . 11 A O3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2038 . 1 1 11 A O4'  O -34.209   2.828 41.092 . . . 1.0 . . . . . . . . . . . . A . 11 A O4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2039 . 1 1 11 A O5'  O -32.839   0.210 41.729 . . . 1.0 . . . . . . . . . . . . A . 11 A O5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2040 . 1 1 11 A OP1  O -32.171  -1.370 43.553 . . . 1.0 . . . . . . . . . . . . A . 11 A OP1  . . . . . . . . . rr_2l5z 1 
       .  3 .  2041 . 1 1 11 A OP2  O -31.429  -1.773 41.134 . . . 1.0 . . . . . . . . . . . . A . 11 A OP2  . . . . . . . . . rr_2l5z 1 
       .  3 .  2042 . 1 1 11 A P    P -31.732  -0.841 42.242 . . . 1.0 . . . . . . . . . . . . A . 11 A P    . . . . . . . . . rr_2l5z 1 
       .  3 .  2043 . 1 1 12 C C1'  C -38.967   0.595 36.934 . . . 1.0 . . . . . . . . . . . . A . 12 C C1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2044 . 1 1 12 C C2   C -37.621   0.409 34.862 . . . 1.0 . . . . . . . . . . . . A . 12 C C2   . . . . . . . . . rr_2l5z 1 
       .  3 .  2045 . 1 1 12 C C2'  C -40.082  -0.447 36.767 . . . 1.0 . . . . . . . . . . . . A . 12 C C2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2046 . 1 1 12 C C3'  C -40.257  -1.012 38.173 . . . 1.0 . . . . . . . . . . . . A . 12 C C3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2047 . 1 1 12 C C4   C -35.488  -0.573 34.888 . . . 1.0 . . . . . . . . . . . . A . 12 C C4   . . . . . . . . . rr_2l5z 1 
       .  3 .  2048 . 1 1 12 C C4'  C -39.794   0.132 39.059 . . . 1.0 . . . . . . . . . . . . A . 12 C C4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2049 . 1 1 12 C C5   C -35.590  -0.832 36.290 . . . 1.0 . . . . . . . . . . . . A . 12 C C5   . . . . . . . . . rr_2l5z 1 
       .  3 .  2050 . 1 1 12 C C5'  C -39.335  -0.348 40.438 . . . 1.0 . . . . . . . . . . . . A . 12 C C5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2051 . 1 1 12 C C6   C -36.720  -0.450 36.919 . . . 1.0 . . . . . . . . . . . . A . 12 C C6   . . . . . . . . . rr_2l5z 1 
       .  3 .  2052 . 1 1 12 C H1'  H -39.306   1.559 36.543 . . . 1.0 . . . . . . . . . . . . A . 12 C H1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2053 . 1 1 12 C H2'  H -39.756  -1.236 36.083 . . . 1.0 . . . . . . . . . . . . A . 12 C H2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2054 . 1 1 12 C H3'  H -39.667  -1.919 38.327 . . . 1.0 . . . . . . . . . . . . A . 12 C H3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2055 . 1 1 12 C H4'  H -40.599   0.854 39.171 . . . 1.0 . . . . . . . . . . . . A . 12 C H4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2056 . 1 1 12 C H41  H -34.308  -0.754 33.238 . . . 1.0 . . . . . . . . . . . . A . 12 C H41  . . . . . . . . . rr_2l5z 1 
       .  3 .  2057 . 1 1 12 C H42  H -33.629  -1.387 34.721 . . . 1.0 . . . . . . . . . . . . A . 12 C H42  . . . . . . . . . rr_2l5z 1 
       .  3 .  2058 . 1 1 12 C H5   H -34.788  -1.315 36.829 . . . 1.0 . . . . . . . . . . . . A . 12 C H5   . . . . . . . . . rr_2l5z 1 
       .  3 .  2059 . 1 1 12 C H5'  H -39.322   0.501 41.122 . . . 1.0 . . . . . . . . . . . . A . 12 C H5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2060 . 1 1 12 C H5'' H -40.036  -1.095 40.815 . . . 1.0 . . . . . . . . . . . . A . 12 C H5'' . . . . . . . . . rr_2l5z 1 
       .  3 .  2061 . 1 1 12 C H6   H -36.837  -0.649 37.975 . . . 1.0 . . . . . . . . . . . . A . 12 C H6   . . . . . . . . . rr_2l5z 1 
       .  3 .  2062 . 1 1 12 C HO2' H -41.119   1.097 36.186 . . . 1.0 . . . . . . . . . . . . A . 12 C HO2' . . . . . . . . . rr_2l5z 1 
       .  3 .  2063 . 1 1 12 C N1   N -37.727   0.164 36.231 . . . 1.0 . . . . . . . . . . . . A . 12 C N1   . . . . . . . . . rr_2l5z 1 
       .  3 .  2064 . 1 1 12 C N3   N -36.483   0.025 34.222 . . . 1.0 . . . . . . . . . . . . A . 12 C N3   . . . . . . . . . rr_2l5z 1 
       .  3 .  2065 . 1 1 12 C N4   N -34.385  -0.933 34.229 . . . 1.0 . . . . . . . . . . . . A . 12 C N4   . . . . . . . . . rr_2l5z 1 
       .  3 .  2066 . 1 1 12 C O2   O -38.540   0.962 34.261 . . . 1.0 . . . . . . . . . . . . A . 12 C O2   . . . . . . . . . rr_2l5z 1 
       .  3 .  2067 . 1 1 12 C O2'  O -41.293   0.160 36.298 . . . 1.0 . . . . . . . . . . . . A . 12 C O2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2068 . 1 1 12 C O3'  O -41.651  -1.227 38.407 . . . 1.0 . . . . . . . . . . . . A . 12 C O3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2069 . 1 1 12 C O4'  O -38.727   0.731 38.342 . . . 1.0 . . . . . . . . . . . . A . 12 C O4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2070 . 1 1 12 C O5'  O -38.025  -0.920 40.386 . . . 1.0 . . . . . . . . . . . . A . 12 C O5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2071 . 1 1 12 C OP1  O -38.098  -1.440 42.834 . . . 1.0 . . . . . . . . . . . . A . 12 C OP1  . . . . . . . . . rr_2l5z 1 
       .  3 .  2072 . 1 1 12 C OP2  O -36.032  -2.016 41.431 . . . 1.0 . . . . . . . . . . . . A . 12 C OP2  . . . . . . . . . rr_2l5z 1 
       .  3 .  2073 . 1 1 12 C P    P -37.165  -1.114 41.731 . . . 1.0 . . . . . . . . . . . . A . 12 C P    . . . . . . . . . rr_2l5z 1 
       .  3 .  2074 . 1 1 13 G C1'  C -39.405  -3.138 33.204 . . . 1.0 . . . . . . . . . . . . A . 13 G C1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2075 . 1 1 13 G C2   C -35.825  -3.080 30.599 . . . 1.0 . . . . . . . . . . . . A . 13 G C2   . . . . . . . . . rr_2l5z 1 
       .  3 .  2076 . 1 1 13 G C2'  C -39.901  -4.509 32.729 . . . 1.0 . . . . . . . . . . . . A . 13 G C2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2077 . 1 1 13 G C3'  C -40.655  -5.045 33.937 . . . 1.0 . . . . . . . . . . . . A . 13 G C3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2078 . 1 1 13 G C4   C -36.914  -3.147 32.544 . . . 1.0 . . . . . . . . . . . . A . 13 G C4   . . . . . . . . . rr_2l5z 1 
       .  3 .  2079 . 1 1 13 G C4'  C -41.156  -3.778 34.613 . . . 1.0 . . . . . . . . . . . . A . 13 G C4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2080 . 1 1 13 G C5   C -35.758  -3.209 33.309 . . . 1.0 . . . . . . . . . . . . A . 13 G C5   . . . . . . . . . rr_2l5z 1 
       .  3 .  2081 . 1 1 13 G C5'  C -41.434  -3.990 36.102 . . . 1.0 . . . . . . . . . . . . A . 13 G C5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2082 . 1 1 13 G C6   C -34.493  -3.209 32.664 . . . 1.0 . . . . . . . . . . . . A . 13 G C6   . . . . . . . . . rr_2l5z 1 
       .  3 .  2083 . 1 1 13 G C8   C -37.366  -3.235 34.652 . . . 1.0 . . . . . . . . . . . . A . 13 G C8   . . . . . . . . . rr_2l5z 1 
       .  3 .  2084 . 1 1 13 G H1   H -33.739  -3.137 30.737 . . . 1.0 . . . . . . . . . . . . A . 13 G H1   . . . . . . . . . rr_2l5z 1 
       .  3 .  2085 . 1 1 13 G H1'  H -39.634  -2.393 32.444 . . . 1.0 . . . . . . . . . . . . A . 13 G H1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2086 . 1 1 13 G H2'  H -39.047  -5.155 32.504 . . . 1.0 . . . . . . . . . . . . A . 13 G H2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2087 . 1 1 13 G H21  H -34.841  -3.022 28.817 . . . 1.0 . . . . . . . . . . . . A . 13 G H21  . . . . . . . . . rr_2l5z 1 
       .  3 .  2088 . 1 1 13 G H22  H -36.588  -2.977 28.714 . . . 1.0 . . . . . . . . . . . . A . 13 G H22  . . . . . . . . . rr_2l5z 1 
       .  3 .  2089 . 1 1 13 G H3'  H -40.010  -5.638 34.590 . . . 1.0 . . . . . . . . . . . . A . 13 G H3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2090 . 1 1 13 G H4'  H -42.063  -3.434 34.119 . . . 1.0 . . . . . . . . . . . . A . 13 G H4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2091 . 1 1 13 G H5'  H -41.973  -4.928 36.237 . . . 1.0 . . . . . . . . . . . . A . 13 G H5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2092 . 1 1 13 G H5'' H -40.486  -4.045 36.638 . . . 1.0 . . . . . . . . . . . . A . 13 G H5'' . . . . . . . . . rr_2l5z 1 
       .  3 .  2093 . 1 1 13 G H8   H -37.949  -3.264 35.559 . . . 1.0 . . . . . . . . . . . . A . 13 G H8   . . . . . . . . . rr_2l5z 1 
       .  3 .  2094 . 1 1 13 G HO2' H -40.790  -5.246 31.163 . . . 1.0 . . . . . . . . . . . . A . 13 G HO2' . . . . . . . . . rr_2l5z 1 
       .  3 .  2095 . 1 1 13 G N1   N -34.626  -3.141 31.282 . . . 1.0 . . . . . . . . . . . . A . 13 G N1   . . . . . . . . . rr_2l5z 1 
       .  3 .  2096 . 1 1 13 G N2   N -35.745  -3.022 29.269 . . . 1.0 . . . . . . . . . . . . A . 13 G N2   . . . . . . . . . rr_2l5z 1 
       .  3 .  2097 . 1 1 13 G N3   N -37.020  -3.081 31.198 . . . 1.0 . . . . . . . . . . . . A . 13 G N3   . . . . . . . . . rr_2l5z 1 
       .  3 .  2098 . 1 1 13 G N7   N -36.073  -3.267 34.677 . . . 1.0 . . . . . . . . . . . . A . 13 G N7   . . . . . . . . . rr_2l5z 1 
       .  3 .  2099 . 1 1 13 G N9   N -37.950  -3.164 33.443 . . . 1.0 . . . . . . . . . . . . A . 13 G N9   . . . . . . . . . rr_2l5z 1 
       .  3 .  2100 . 1 1 13 G O2'  O -40.760  -4.386 31.591 . . . 1.0 . . . . . . . . . . . . A . 13 G O2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2101 . 1 1 13 G O3'  O -41.785  -5.788 33.472 . . . 1.0 . . . . . . . . . . . . A . 13 G O3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2102 . 1 1 13 G O4'  O -40.121  -2.821 34.409 . . . 1.0 . . . . . . . . . . . . A . 13 G O4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2103 . 1 1 13 G O5'  O -42.216  -2.924 36.646 . . . 1.0 . . . . . . . . . . . . A . 13 G O5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2104 . 1 1 13 G O6   O -33.376  -3.259 33.175 . . . 1.0 . . . . . . . . . . . . A . 13 G O6   . . . . . . . . . rr_2l5z 1 
       .  3 .  2105 . 1 1 13 G OP1  O -43.717  -2.626 38.629 . . . 1.0 . . . . . . . . . . . . A . 13 G OP1  . . . . . . . . . rr_2l5z 1 
       .  3 .  2106 . 1 1 13 G OP2  O -41.390  -3.671 38.889 . . . 1.0 . . . . . . . . . . . . A . 13 G OP2  . . . . . . . . . rr_2l5z 1 
       .  3 .  2107 . 1 1 13 G P    P -42.290  -2.694 38.237 . . . 1.0 . . . . . . . . . . . . A . 13 G P    . . . . . . . . . rr_2l5z 1 
       .  3 .  2108 . 1 1 14 A C1'  C -42.134  -8.818 28.565 . . . 1.0 . . . . . . . . . . . . A . 14 A C1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2109 . 1 1 14 A C2   C -43.699  -5.878 25.655 . . . 1.0 . . . . . . . . . . . . A . 14 A C2   . . . . . . . . . rr_2l5z 1 
       .  3 .  2110 . 1 1 14 A C2'  C -40.713  -8.364 28.243 . . . 1.0 . . . . . . . . . . . . A . 14 A C2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2111 . 1 1 14 A C3'  C -40.089  -8.244 29.621 . . . 1.0 . . . . . . . . . . . . A . 14 A C3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2112 . 1 1 14 A C4   C -43.468  -6.816 27.641 . . . 1.0 . . . . . . . . . . . . A . 14 A C4   . . . . . . . . . rr_2l5z 1 
       .  3 .  2113 . 1 1 14 A C4'  C -40.770  -9.370 30.399 . . . 1.0 . . . . . . . . . . . . A . 14 A C4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2114 . 1 1 14 A C5   C -44.321  -5.920 28.249 . . . 1.0 . . . . . . . . . . . . A . 14 A C5   . . . . . . . . . rr_2l5z 1 
       .  3 .  2115 . 1 1 14 A C5'  C -40.847  -9.069 31.899 . . . 1.0 . . . . . . . . . . . . A . 14 A C5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2116 . 1 1 14 A C6   C -44.881  -4.939 27.425 . . . 1.0 . . . . . . . . . . . . A . 14 A C6   . . . . . . . . . rr_2l5z 1 
       .  3 .  2117 . 1 1 14 A C8   C -43.673  -7.231 29.746 . . . 1.0 . . . . . . . . . . . . A . 14 A C8   . . . . . . . . . rr_2l5z 1 
       .  3 .  2118 . 1 1 14 A H1'  H -42.477  -9.510 27.794 . . . 1.0 . . . . . . . . . . . . A . 14 A H1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2119 . 1 1 14 A H2   H -43.463  -5.825 24.592 . . . 1.0 . . . . . . . . . . . . A . 14 A H2   . . . . . . . . . rr_2l5z 1 
       .  3 .  2120 . 1 1 14 A H2'  H -40.734  -7.386 27.754 . . . 1.0 . . . . . . . . . . . . A . 14 A H2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2121 . 1 1 14 A H3'  H -40.266  -7.258 30.057 . . . 1.0 . . . . . . . . . . . . A . 14 A H3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2122 . 1 1 14 A H4'  H -40.220 -10.297 30.247 . . . 1.0 . . . . . . . . . . . . A . 14 A H4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2123 . 1 1 14 A H5'  H -41.259  -9.936 32.414 . . . 1.0 . . . . . . . . . . . . A . 14 A H5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2124 . 1 1 14 A H5'' H -39.843  -8.875 32.275 . . . 1.0 . . . . . . . . . . . . A . 14 A H5'' . . . . . . . . . rr_2l5z 1 
       .  3 .  2125 . 1 1 14 A H61  H -46.100  -3.319 27.236 . . . 1.0 . . . . . . . . . . . . A . 14 A H61  . . . . . . . . . rr_2l5z 1 
       .  3 .  2126 . 1 1 14 A H62  H -45.983  -3.988 28.848 . . . 1.0 . . . . . . . . . . . . A . 14 A H62  . . . . . . . . . rr_2l5z 1 
       .  3 .  2127 . 1 1 14 A H8   H -43.528  -7.714 30.703 . . . 1.0 . . . . . . . . . . . . A . 14 A H8   . . . . . . . . . rr_2l5z 1 
       .  3 .  2128 . 1 1 14 A HO2' H -39.617  -9.959 28.032 . . . 1.0 . . . . . . . . . . . . A . 14 A HO2' . . . . . . . . . rr_2l5z 1 
       .  3 .  2129 . 1 1 14 A N1   N -44.541  -4.953 26.123 . . . 1.0 . . . . . . . . . . . . A . 14 A N1   . . . . . . . . . rr_2l5z 1 
       .  3 .  2130 . 1 1 14 A N3   N -43.111  -6.853 26.343 . . . 1.0 . . . . . . . . . . . . A . 14 A N3   . . . . . . . . . rr_2l5z 1 
       .  3 .  2131 . 1 1 14 A N6   N -45.723  -4.006 27.872 . . . 1.0 . . . . . . . . . . . . A . 14 A N6   . . . . . . . . . rr_2l5z 1 
       .  3 .  2132 . 1 1 14 A N7   N -44.447  -6.201 29.620 . . . 1.0 . . . . . . . . . . . . A . 14 A N7   . . . . . . . . . rr_2l5z 1 
       .  3 .  2133 . 1 1 14 A N9   N -43.052  -7.665 28.634 . . . 1.0 . . . . . . . . . . . . A . 14 A N9   . . . . . . . . . rr_2l5z 1 
       .  3 .  2134 . 1 1 14 A O2'  O -40.025  -9.327 27.436 . . . 1.0 . . . . . . . . . . . . A . 14 A O2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2135 . 1 1 14 A O3'  O -38.695  -8.547 29.511 . . . 1.0 . . . . . . . . . . . . A . 14 A O3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2136 . 1 1 14 A O4'  O -42.075  -9.502 29.829 . . . 1.0 . . . . . . . . . . . . A . 14 A O4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2137 . 1 1 14 A O5'  O -41.673  -7.933 32.164 . . . 1.0 . . . . . . . . . . . . A . 14 A O5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2138 . 1 1 14 A OP1  O -43.210  -7.739 34.133 . . . 1.0 . . . . . . . . . . . . A . 14 A OP1  . . . . . . . . . rr_2l5z 1 
       .  3 .  2139 . 1 1 14 A OP2  O -40.670  -7.803 34.456 . . . 1.0 . . . . . . . . . . . . A . 14 A OP2  . . . . . . . . . rr_2l5z 1 
       .  3 .  2140 . 1 1 14 A P    P -41.850  -7.384 33.668 . . . 1.0 . . . . . . . . . . . . A . 14 A P    . . . . . . . . . rr_2l5z 1 
       .  3 .  2141 . 1 1 15 A C1'  C -40.403  -5.006 26.017 . . . 1.0 . . . . . . . . . . . . A . 15 A C1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2142 . 1 1 15 A C2   C -42.840  -1.315 26.068 . . . 1.0 . . . . . . . . . . . . A . 15 A C2   . . . . . . . . . rr_2l5z 1 
       .  3 .  2143 . 1 1 15 A C2'  C -39.254  -4.240 25.350 . . . 1.0 . . . . . . . . . . . . A . 15 A C2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2144 . 1 1 15 A C3'  C -38.006  -4.981 25.821 . . . 1.0 . . . . . . . . . . . . A . 15 A C3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2145 . 1 1 15 A C4   C -41.791  -3.046 26.953 . . . 1.0 . . . . . . . . . . . . A . 15 A C4   . . . . . . . . . rr_2l5z 1 
       .  3 .  2146 . 1 1 15 A C4'  C -38.523  -6.389 26.092 . . . 1.0 . . . . . . . . . . . . A . 15 A C4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2147 . 1 1 15 A C5   C -42.161  -2.712 28.237 . . . 1.0 . . . . . . . . . . . . A . 15 A C5   . . . . . . . . . rr_2l5z 1 
       .  3 .  2148 . 1 1 15 A C5'  C -37.659  -7.134 27.112 . . . 1.0 . . . . . . . . . . . . A . 15 A C5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2149 . 1 1 15 A C6   C -42.945  -1.563 28.380 . . . 1.0 . . . . . . . . . . . . A . 15 A C6   . . . . . . . . . rr_2l5z 1 
       .  3 .  2150 . 1 1 15 A C8   C -41.011  -4.454 28.386 . . . 1.0 . . . . . . . . . . . . A . 15 A C8   . . . . . . . . . rr_2l5z 1 
       .  3 .  2151 . 1 1 15 A H1'  H -41.146  -5.264 25.263 . . . 1.0 . . . . . . . . . . . . A . 15 A H1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2152 . 1 1 15 A H2   H -43.118  -0.706 25.209 . . . 1.0 . . . . . . . . . . . . A . 15 A H2   . . . . . . . . . rr_2l5z 1 
       .  3 .  2153 . 1 1 15 A H2'  H -39.238  -3.207 25.710 . . . 1.0 . . . . . . . . . . . . A . 15 A H2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2154 . 1 1 15 A H3'  H -37.567  -4.516 26.708 . . . 1.0 . . . . . . . . . . . . A . 15 A H3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2155 . 1 1 15 A H4'  H -38.553  -6.952 25.160 . . . 1.0 . . . . . . . . . . . . A . 15 A H4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2156 . 1 1 15 A H5'  H -38.011  -8.162 27.192 . . . 1.0 . . . . . . . . . . . . A . 15 A H5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2157 . 1 1 15 A H5'' H -36.625  -7.138 26.766 . . . 1.0 . . . . . . . . . . . . A . 15 A H5'' . . . . . . . . . rr_2l5z 1 
       .  3 .  2158 . 1 1 15 A H61  H -43.941  -0.281 29.607 . . . 1.0 . . . . . . . . . . . . A . 15 A H61  . . . . . . . . . rr_2l5z 1 
       .  3 .  2159 . 1 1 15 A H62  H -43.141  -1.617 30.405 . . . 1.0 . . . . . . . . . . . . A . 15 A H62  . . . . . . . . . rr_2l5z 1 
       .  3 .  2160 . 1 1 15 A H8   H -40.457  -5.294 28.783 . . . 1.0 . . . . . . . . . . . . A . 15 A H8   . . . . . . . . . rr_2l5z 1 
       .  3 .  2161 . 1 1 15 A HO2' H -39.958  -5.000 23.702 . . . 1.0 . . . . . . . . . . . . A . 15 A HO2' . . . . . . . . . rr_2l5z 1 
       .  3 .  2162 . 1 1 15 A N1   N -43.265  -0.889 27.260 . . . 1.0 . . . . . . . . . . . . A . 15 A N1   . . . . . . . . . rr_2l5z 1 
       .  3 .  2163 . 1 1 15 A N3   N -42.097  -2.390 25.818 . . . 1.0 . . . . . . . . . . . . A . 15 A N3   . . . . . . . . . rr_2l5z 1 
       .  3 .  2164 . 1 1 15 A N6   N -43.378  -1.118 29.559 . . . 1.0 . . . . . . . . . . . . A . 15 A N6   . . . . . . . . . rr_2l5z 1 
       .  3 .  2165 . 1 1 15 A N7   N -41.648  -3.638 29.161 . . . 1.0 . . . . . . . . . . . . A . 15 A N7   . . . . . . . . . rr_2l5z 1 
       .  3 .  2166 . 1 1 15 A N9   N -41.041  -4.189 27.066 . . . 1.0 . . . . . . . . . . . . A . 15 A N9   . . . . . . . . . rr_2l5z 1 
       .  3 .  2167 . 1 1 15 A O2'  O -39.370  -4.274 23.922 . . . 1.0 . . . . . . . . . . . . A . 15 A O2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2168 . 1 1 15 A O3'  O -37.085  -5.044 24.728 . . . 1.0 . . . . . . . . . . . . A . 15 A O3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2169 . 1 1 15 A O4'  O -39.851  -6.210 26.570 . . . 1.0 . . . . . . . . . . . . A . 15 A O4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2170 . 1 1 15 A O5'  O -37.716  -6.515 28.401 . . . 1.0 . . . . . . . . . . . . A . 15 A O5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2171 . 1 1 15 A OP1  O -36.254  -8.038 29.750 . . . 1.0 . . . . . . . . . . . . A . 15 A OP1  . . . . . . . . . rr_2l5z 1 
       .  3 .  2172 . 1 1 15 A OP2  O -38.017  -6.566 30.888 . . . 1.0 . . . . . . . . . . . . A . 15 A OP2  . . . . . . . . . rr_2l5z 1 
       .  3 .  2173 . 1 1 15 A P    P -37.589  -7.399 29.742 . . . 1.0 . . . . . . . . . . . . A . 15 A P    . . . . . . . . . rr_2l5z 1 
       .  3 .  2174 . 1 1 16 A C1'  C -39.437  -0.626 24.971 . . . 1.0 . . . . . . . . . . . . A . 16 A C1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2175 . 1 1 16 A C2   C -40.663   0.508 29.065 . . . 1.0 . . . . . . . . . . . . A . 16 A C2   . . . . . . . . . rr_2l5z 1 
       .  3 .  2176 . 1 1 16 A C2'  C -38.870   0.562 24.202 . . . 1.0 . . . . . . . . . . . . A . 16 A C2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2177 . 1 1 16 A C3'  C -37.738  -0.069 23.412 . . . 1.0 . . . . . . . . . . . . A . 16 A C3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2178 . 1 1 16 A C4   C -39.321  -0.338 27.528 . . . 1.0 . . . . . . . . . . . . A . 16 A C4   . . . . . . . . . rr_2l5z 1 
       .  3 .  2179 . 1 1 16 A C4'  C -38.263  -1.478 23.119 . . . 1.0 . . . . . . . . . . . . A . 16 A C4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2180 . 1 1 16 A C5   C -38.361  -0.690 28.450 . . . 1.0 . . . . . . . . . . . . A . 16 A C5   . . . . . . . . . rr_2l5z 1 
       .  3 .  2181 . 1 1 16 A C5'  C -37.137  -2.511 23.018 . . . 1.0 . . . . . . . . . . . . A . 16 A C5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2182 . 1 1 16 A C6   C -38.640  -0.387 29.787 . . . 1.0 . . . . . . . . . . . . A . 16 A C6   . . . . . . . . . rr_2l5z 1 
       .  3 .  2183 . 1 1 16 A C8   C -37.632  -1.280 26.580 . . . 1.0 . . . . . . . . . . . . A . 16 A C8   . . . . . . . . . rr_2l5z 1 
       .  3 .  2184 . 1 1 16 A H1'  H -40.515  -0.510 25.073 . . . 1.0 . . . . . . . . . . . . A . 16 A H1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2185 . 1 1 16 A H2   H -41.593   0.998 29.355 . . . 1.0 . . . . . . . . . . . . A . 16 A H2   . . . . . . . . . rr_2l5z 1 
       .  3 .  2186 . 1 1 16 A H2'  H -38.473   1.305 24.899 . . . 1.0 . . . . . . . . . . . . A . 16 A H2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2187 . 1 1 16 A H3'  H -36.803  -0.070 23.983 . . . 1.0 . . . . . . . . . . . . A . 16 A H3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2188 . 1 1 16 A H4'  H -38.823  -1.465 22.185 . . . 1.0 . . . . . . . . . . . . A . 16 A H4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2189 . 1 1 16 A H5'  H -37.561  -3.474 22.730 . . . 1.0 . . . . . . . . . . . . A . 16 A H5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2190 . 1 1 16 A H5'' H -36.428  -2.192 22.253 . . . 1.0 . . . . . . . . . . . . A . 16 A H5'' . . . . . . . . . rr_2l5z 1 
       .  3 .  2191 . 1 1 16 A H61  H -38.058  -0.430 31.737 . . . 1.0 . . . . . . . . . . . . A . 16 A H61  . . . . . . . . . rr_2l5z 1 
       .  3 .  2192 . 1 1 16 A H62  H -36.928  -1.131 30.599 . . . 1.0 . . . . . . . . . . . . A . 16 A H62  . . . . . . . . . rr_2l5z 1 
       .  3 .  2193 . 1 1 16 A H8   H -37.006  -1.684 25.797 . . . 1.0 . . . . . . . . . . . . A . 16 A H8   . . . . . . . . . rr_2l5z 1 
       .  3 .  2194 . 1 1 16 A HO2' H -40.394   1.727 23.874 . . . 1.0 . . . . . . . . . . . . A . 16 A HO2' . . . . . . . . . rr_2l5z 1 
       .  3 .  2195 . 1 1 16 A N1   N -39.812   0.218 30.052 . . . 1.0 . . . . . . . . . . . . A . 16 A N1   . . . . . . . . . rr_2l5z 1 
       .  3 .  2196 . 1 1 16 A N3   N -40.501   0.266 27.768 . . . 1.0 . . . . . . . . . . . . A . 16 A N3   . . . . . . . . . rr_2l5z 1 
       .  3 .  2197 . 1 1 16 A N6   N -37.808  -0.671 30.789 . . . 1.0 . . . . . . . . . . . . A . 16 A N6   . . . . . . . . . rr_2l5z 1 
       .  3 .  2198 . 1 1 16 A N7   N -37.264  -1.303 27.819 . . . 1.0 . . . . . . . . . . . . A . 16 A N7   . . . . . . . . . rr_2l5z 1 
       .  3 .  2199 . 1 1 16 A N9   N -38.830  -0.731 26.311 . . . 1.0 . . . . . . . . . . . . A . 16 A N9   . . . . . . . . . rr_2l5z 1 
       .  3 .  2200 . 1 1 16 A O2'  O -39.852   1.144 23.338 . . . 1.0 . . . . . . . . . . . . A . 16 A O2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2201 . 1 1 16 A O3'  O -37.614   0.631 22.170 . . . 1.0 . . . . . . . . . . . . A . 16 A O3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2202 . 1 1 16 A O4'  O -39.157  -1.797 24.190 . . . 1.0 . . . . . . . . . . . . A . 16 A O4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2203 . 1 1 16 A O5'  O -36.447  -2.657 24.262 . . . 1.0 . . . . . . . . . . . . A . 16 A O5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2204 . 1 1 16 A OP1  O -34.919  -4.523 23.584 . . . 1.0 . . . . . . . . . . . . A . 16 A OP1  . . . . . . . . . rr_2l5z 1 
       .  3 .  2205 . 1 1 16 A OP2  O -35.265  -3.946 26.055 . . . 1.0 . . . . . . . . . . . . A . 16 A OP2  . . . . . . . . . rr_2l5z 1 
       .  3 .  2206 . 1 1 16 A P    P -35.802  -4.072 24.682 . . . 1.0 . . . . . . . . . . . . A . 16 A P    . . . . . . . . . rr_2l5z 1 
       .  3 .  2207 . 1 1 17 G C1'  C -36.821   2.738 26.623 . . . 1.0 . . . . . . . . . . . . A . 17 G C1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2208 . 1 1 17 G C2   C -37.482   2.080 30.944 . . . 1.0 . . . . . . . . . . . . A . 17 G C2   . . . . . . . . . rr_2l5z 1 
       .  3 .  2209 . 1 1 17 G C2'  C -36.457   4.205 26.409 . . . 1.0 . . . . . . . . . . . . A . 17 G C2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2210 . 1 1 17 G C3'  C -35.399   4.105 25.328 . . . 1.0 . . . . . . . . . . . . A . 17 G C3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2211 . 1 1 17 G C4   C -36.330   1.996 29.038 . . . 1.0 . . . . . . . . . . . . A . 17 G C4   . . . . . . . . . rr_2l5z 1 
       .  3 .  2212 . 1 1 17 G C4'  C -35.939   2.977 24.462 . . . 1.0 . . . . . . . . . . . . A . 17 G C4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2213 . 1 1 17 G C5   C -35.224   1.384 29.610 . . . 1.0 . . . . . . . . . . . . A . 17 G C5   . . . . . . . . . rr_2l5z 1 
       .  3 .  2214 . 1 1 17 G C5'  C -34.831   2.294 23.660 . . . 1.0 . . . . . . . . . . . . A . 17 G C5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2215 . 1 1 17 G C6   C -35.234   1.080 30.998 . . . 1.0 . . . . . . . . . . . . A . 17 G C6   . . . . . . . . . rr_2l5z 1 
       .  3 .  2216 . 1 1 17 G C8   C -34.783   1.639 27.579 . . . 1.0 . . . . . . . . . . . . A . 17 G C8   . . . . . . . . . rr_2l5z 1 
       .  3 .  2217 . 1 1 17 G H1   H -36.516   1.268 32.608 . . . 1.0 . . . . . . . . . . . . A . 17 G H1   . . . . . . . . . rr_2l5z 1 
       .  3 .  2218 . 1 1 17 G H1'  H -37.880   2.654 26.867 . . . 1.0 . . . . . . . . . . . . A . 17 G H1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2219 . 1 1 17 G H2'  H -36.028   4.623 27.322 . . . 1.0 . . . . . . . . . . . . A . 17 G H2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2220 . 1 1 17 G H21  H -38.543   2.160 32.679 . . . 1.0 . . . . . . . . . . . . A . 17 G H21  . . . . . . . . . rr_2l5z 1 
       .  3 .  2221 . 1 1 17 G H22  H -39.347   2.826 31.276 . . . 1.0 . . . . . . . . . . . . A . 17 G H22  . . . . . . . . . rr_2l5z 1 
       .  3 .  2222 . 1 1 17 G H3'  H -34.416   3.878 25.745 . . . 1.0 . . . . . . . . . . . . A . 17 G H3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2223 . 1 1 17 G H4'  H -36.692   3.372 23.784 . . . 1.0 . . . . . . . . . . . . A . 17 G H4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2224 . 1 1 17 G H5'  H -34.467   2.984 22.899 . . . 1.0 . . . . . . . . . . . . A . 17 G H5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2225 . 1 1 17 G H5'' H -34.013   2.038 24.330 . . . 1.0 . . . . . . . . . . . . A . 17 G H5'' . . . . . . . . . rr_2l5z 1 
       .  3 .  2226 . 1 1 17 G H8   H -34.277   1.628 26.627 . . . 1.0 . . . . . . . . . . . . A . 17 G H8   . . . . . . . . . rr_2l5z 1 
       .  3 .  2227 . 1 1 17 G HO2' H -38.337   4.702 26.507 . . . 1.0 . . . . . . . . . . . . A . 17 G HO2' . . . . . . . . . rr_2l5z 1 
       .  3 .  2228 . 1 1 17 G N1   N -36.427   1.471 31.595 . . . 1.0 . . . . . . . . . . . . A . 17 G N1   . . . . . . . . . rr_2l5z 1 
       .  3 .  2229 . 1 1 17 G N2   N -38.543   2.379 31.694 . . . 1.0 . . . . . . . . . . . . A . 17 G N2   . . . . . . . . . rr_2l5z 1 
       .  3 .  2230 . 1 1 17 G N3   N -37.481   2.369 29.640 . . . 1.0 . . . . . . . . . . . . A . 17 G N3   . . . . . . . . . rr_2l5z 1 
       .  3 .  2231 . 1 1 17 G N7   N -34.229   1.160 28.645 . . . 1.0 . . . . . . . . . . . . A . 17 G N7   . . . . . . . . . rr_2l5z 1 
       .  3 .  2232 . 1 1 17 G N9   N -36.019   2.152 27.714 . . . 1.0 . . . . . . . . . . . . A . 17 G N9   . . . . . . . . . rr_2l5z 1 
       .  3 .  2233 . 1 1 17 G O2'  O -37.586   4.970 25.972 . . . 1.0 . . . . . . . . . . . . A . 17 G O2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2234 . 1 1 17 G O3'  O -35.403   5.313 24.562 . . . 1.0 . . . . . . . . . . . . A . 17 G O3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2235 . 1 1 17 G O4'  O -36.563   2.068 25.376 . . . 1.0 . . . . . . . . . . . . A . 17 G O4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2236 . 1 1 17 G O5'  O -35.299   1.102 23.023 . . . 1.0 . . . . . . . . . . . . A . 17 G O5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2237 . 1 1 17 G O6   O -34.354   0.544 31.669 . . . 1.0 . . . . . . . . . . . . A . 17 G O6   . . . . . . . . . rr_2l5z 1 
       .  3 .  2238 . 1 1 17 G OP1  O -36.340   2.614 21.318 . . . 1.0 . . . . . . . . . . . . A . 17 G OP1  . . . . . . . . . rr_2l5z 1 
       .  3 .  2239 . 1 1 17 G OP2  O -35.626   0.231 20.698 . . . 1.0 . . . . . . . . . . . . A . 17 G OP2  . . . . . . . . . rr_2l5z 1 
       .  3 .  2240 . 1 1 17 G P    P -36.184   1.187 21.681 . . . 1.0 . . . . . . . . . . . . A . 17 G P    . . . . . . . . . rr_2l5z 1 
       .  3 .  2241 . 1 1 18 U C1'  C -35.663   6.942 29.886 . . . 1.0 . . . . . . . . . . . . A . 18 U C1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2242 . 1 1 18 U C2   C -34.988   5.425 31.725 . . . 1.0 . . . . . . . . . . . . A . 18 U C2   . . . . . . . . . rr_2l5z 1 
       .  3 .  2243 . 1 1 18 U C2'  C -34.861   8.232 30.116 . . . 1.0 . . . . . . . . . . . . A . 18 U C2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2244 . 1 1 18 U C3'  C -34.538   8.710 28.703 . . . 1.0 . . . . . . . . . . . . A . 18 U C3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2245 . 1 1 18 U C4   C -33.476   3.519 31.310 . . . 1.0 . . . . . . . . . . . . A . 18 U C4   . . . . . . . . . rr_2l5z 1 
       .  3 .  2246 . 1 1 18 U C4'  C -35.671   8.122 27.888 . . . 1.0 . . . . . . . . . . . . A . 18 U C4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2247 . 1 1 18 U C5   C -33.449   3.935 29.926 . . . 1.0 . . . . . . . . . . . . A . 18 U C5   . . . . . . . . . rr_2l5z 1 
       .  3 .  2248 . 1 1 18 U C5'  C -35.312   8.005 26.407 . . . 1.0 . . . . . . . . . . . . A . 18 U C5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2249 . 1 1 18 U C6   C -34.150   5.017 29.509 . . . 1.0 . . . . . . . . . . . . A . 18 U C6   . . . . . . . . . rr_2l5z 1 
       .  3 .  2250 . 1 1 18 U H1'  H -36.627   7.020 30.396 . . . 1.0 . . . . . . . . . . . . A . 18 U H1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2251 . 1 1 18 U H2'  H -33.938   8.003 30.656 . . . 1.0 . . . . . . . . . . . . A . 18 U H2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2252 . 1 1 18 U H3   H -34.321   4.053 33.128 . . . 1.0 . . . . . . . . . . . . A . 18 U H3   . . . . . . . . . rr_2l5z 1 
       .  3 .  2253 . 1 1 18 U H3'  H -33.560   8.358 28.367 . . . 1.0 . . . . . . . . . . . . A . 18 U H3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2254 . 1 1 18 U H4'  H -36.562   8.736 28.001 . . . 1.0 . . . . . . . . . . . . A . 18 U H4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2255 . 1 1 18 U H5   H -32.868   3.371 29.211 . . . 1.0 . . . . . . . . . . . . A . 18 U H5   . . . . . . . . . rr_2l5z 1 
       .  3 .  2256 . 1 1 18 U H5'  H -36.220   7.818 25.835 . . . 1.0 . . . . . . . . . . . . A . 18 U H5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2257 . 1 1 18 U H5'' H -34.867   8.942 26.075 . . . 1.0 . . . . . . . . . . . . A . 18 U H5'' . . . . . . . . . rr_2l5z 1 
       .  3 .  2258 . 1 1 18 U H6   H -34.100   5.310 28.473 . . . 1.0 . . . . . . . . . . . . A . 18 U H6   . . . . . . . . . rr_2l5z 1 
       .  3 .  2259 . 1 1 18 U HO2' H -36.560   8.967 30.722 . . . 1.0 . . . . . . . . . . . . A . 18 U HO2' . . . . . . . . . rr_2l5z 1 
       .  3 .  2260 . 1 1 18 U N1   N -34.909   5.756 30.375 . . . 1.0 . . . . . . . . . . . . A . 18 U N1   . . . . . . . . . rr_2l5z 1 
       .  3 .  2261 . 1 1 18 U N3   N -34.264   4.316 32.124 . . . 1.0 . . . . . . . . . . . . A . 18 U N3   . . . . . . . . . rr_2l5z 1 
       .  3 .  2262 . 1 1 18 U O2   O -35.663   6.078 32.518 . . . 1.0 . . . . . . . . . . . . A . 18 U O2   . . . . . . . . . rr_2l5z 1 
       .  3 .  2263 . 1 1 18 U O2'  O -35.635   9.205 30.828 . . . 1.0 . . . . . . . . . . . . A . 18 U O2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2264 . 1 1 18 U O3'  O -34.642  10.135 28.666 . . . 1.0 . . . . . . . . . . . . A . 18 U O3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2265 . 1 1 18 U O4   O -32.874   2.554 31.773 . . . 1.0 . . . . . . . . . . . . A . 18 U O4   . . . . . . . . . rr_2l5z 1 
       .  3 .  2266 . 1 1 18 U O4'  O -35.902   6.849 28.472 . . . 1.0 . . . . . . . . . . . . A . 18 U O4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2267 . 1 1 18 U O5'  O -34.388   6.941 26.174 . . . 1.0 . . . . . . . . . . . . A . 18 U O5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2268 . 1 1 18 U OP1  O -34.408   7.453 23.723 . . . 1.0 . . . . . . . . . . . . A . 18 U OP1  . . . . . . . . . rr_2l5z 1 
       .  3 .  2269 . 1 1 18 U OP2  O -32.915   5.594 24.662 . . . 1.0 . . . . . . . . . . . . A . 18 U OP2  . . . . . . . . . rr_2l5z 1 
       .  3 .  2270 . 1 1 18 U P    P -34.184   6.356 24.690 . . . 1.0 . . . . . . . . . . . . A . 18 U P    . . . . . . . . . rr_2l5z 1 
       .  3 .  2271 . 1 1 19 G C1'  C -33.625   9.613 34.128 . . . 1.0 . . . . . . . . . . . . A . 19 G C1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2272 . 1 1 19 G C2   C -31.680   6.517 36.620 . . . 1.0 . . . . . . . . . . . . A . 19 G C2   . . . . . . . . . rr_2l5z 1 
       .  3 .  2273 . 1 1 19 G C2'  C -33.015  10.935 34.604 . . . 1.0 . . . . . . . . . . . . A . 19 G C2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2274 . 1 1 19 G C3'  C -33.165  11.843 33.392 . . . 1.0 . . . . . . . . . . . . A . 19 G C3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2275 . 1 1 19 G C4   C -32.043   7.678 34.751 . . . 1.0 . . . . . . . . . . . . A . 19 G C4   . . . . . . . . . rr_2l5z 1 
       .  3 .  2276 . 1 1 19 G C4'  C -34.417  11.301 32.723 . . . 1.0 . . . . . . . . . . . . A . 19 G C4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2277 . 1 1 19 G C5   C -31.106   6.975 34.006 . . . 1.0 . . . . . . . . . . . . A . 19 G C5   . . . . . . . . . rr_2l5z 1 
       .  3 .  2278 . 1 1 19 G C5'  C -34.471  11.659 31.239 . . . 1.0 . . . . . . . . . . . . A . 19 G C5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2279 . 1 1 19 G C6   C -30.369   5.927 34.622 . . . 1.0 . . . . . . . . . . . . A . 19 G C6   . . . . . . . . . rr_2l5z 1 
       .  3 .  2280 . 1 1 19 G C8   C -31.942   8.403 32.721 . . . 1.0 . . . . . . . . . . . . A . 19 G C8   . . . . . . . . . rr_2l5z 1 
       .  3 .  2281 . 1 1 19 G H1   H -30.252   5.000 36.466 . . . 1.0 . . . . . . . . . . . . A . 19 G H1   . . . . . . . . . rr_2l5z 1 
       .  3 .  2282 . 1 1 19 G H1'  H -34.315   9.241 34.885 . . . 1.0 . . . . . . . . . . . . A . 19 G H1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2283 . 1 1 19 G H2'  H -31.956  10.794 34.838 . . . 1.0 . . . . . . . . . . . . A . 19 G H2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2284 . 1 1 19 G H21  H -31.351   5.463 38.330 . . . 1.0 . . . . . . . . . . . . A . 19 G H21  . . . . . . . . . rr_2l5z 1 
       .  3 .  2285 . 1 1 19 G H22  H -32.559   6.724 38.444 . . . 1.0 . . . . . . . . . . . . A . 19 G H22  . . . . . . . . . rr_2l5z 1 
       .  3 .  2286 . 1 1 19 G H3'  H -32.290  11.797 32.740 . . . 1.0 . . . . . . . . . . . . A . 19 G H3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2287 . 1 1 19 G H4'  H -35.299  11.694 33.226 . . . 1.0 . . . . . . . . . . . . A . 19 G H4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2288 . 1 1 19 G H5'  H -35.371  11.226 30.802 . . . 1.0 . . . . . . . . . . . . A . 19 G H5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2289 . 1 1 19 G H5'' H -34.512  12.744 31.136 . . . 1.0 . . . . . . . . . . . . A . 19 G H5'' . . . . . . . . . rr_2l5z 1 
       .  3 .  2290 . 1 1 19 G H8   H -32.171   8.993 31.847 . . . 1.0 . . . . . . . . . . . . A . 19 G H8   . . . . . . . . . rr_2l5z 1 
       .  3 .  2291 . 1 1 19 G HO2' H -34.555  11.806 35.417 . . . 1.0 . . . . . . . . . . . . A . 19 G HO2' . . . . . . . . . rr_2l5z 1 
       .  3 .  2292 . 1 1 19 G N1   N -30.732   5.766 35.954 . . . 1.0 . . . . . . . . . . . . A . 19 G N1   . . . . . . . . . rr_2l5z 1 
       .  3 .  2293 . 1 1 19 G N2   N -31.879   6.210 37.902 . . . 1.0 . . . . . . . . . . . . A . 19 G N2   . . . . . . . . . rr_2l5z 1 
       .  3 .  2294 . 1 1 19 G N3   N -32.377   7.505 36.049 . . . 1.0 . . . . . . . . . . . . A . 19 G N3   . . . . . . . . . rr_2l5z 1 
       .  3 .  2295 . 1 1 19 G N7   N -31.055   7.462 32.689 . . . 1.0 . . . . . . . . . . . . A . 19 G N7   . . . . . . . . . rr_2l5z 1 
       .  3 .  2296 . 1 1 19 G N9   N -32.576   8.604 33.891 . . . 1.0 . . . . . . . . . . . . A . 19 G N9   . . . . . . . . . rr_2l5z 1 
       .  3 .  2297 . 1 1 19 G O2'  O -33.720  11.457 35.736 . . . 1.0 . . . . . . . . . . . . A . 19 G O2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2298 . 1 1 19 G O3'  O -33.433  13.172 33.847 . . . 1.0 . . . . . . . . . . . . A . 19 G O3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2299 . 1 1 19 G O4'  O -34.355   9.892 32.921 . . . 1.0 . . . . . . . . . . . . A . 19 G O4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2300 . 1 1 19 G O5'  O -33.328  11.168 30.537 . . . 1.0 . . . . . . . . . . . . A . 19 G O5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2301 . 1 1 19 G O6   O -29.508   5.203 34.124 . . . 1.0 . . . . . . . . . . . . A . 19 G O6   . . . . . . . . . rr_2l5z 1 
       .  3 .  2302 . 1 1 19 G OP1  O -33.612  12.400 28.376 . . . 1.0 . . . . . . . . . . . . A . 19 G OP1  . . . . . . . . . rr_2l5z 1 
       .  3 .  2303 . 1 1 19 G OP2  O -32.148  10.300 28.505 . . . 1.0 . . . . . . . . . . . . A . 19 G OP2  . . . . . . . . . rr_2l5z 1 
       .  3 .  2304 . 1 1 19 G P    P -33.348  11.054 28.932 . . . 1.0 . . . . . . . . . . . . A . 19 G P    . . . . . . . . . rr_2l5z 1 
       .  3 .  2305 . 1 1 20 A C1'  C -30.706  11.479 38.174 . . . 1.0 . . . . . . . . . . . . A . 20 A C1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2306 . 1 1 20 A C2   C -27.843   8.233 39.038 . . . 1.0 . . . . . . . . . . . . A . 20 A C2   . . . . . . . . . rr_2l5z 1 
       .  3 .  2307 . 1 1 20 A C2'  C -30.115  12.747 38.809 . . . 1.0 . . . . . . . . . . . . A . 20 A C2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2308 . 1 1 20 A C3'  C -30.857  13.881 38.104 . . . 1.0 . . . . . . . . . . . . A . 20 A C3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2309 . 1 1 20 A C4   C -28.846   9.745 37.783 . . . 1.0 . . . . . . . . . . . . A . 20 A C4   . . . . . . . . . rr_2l5z 1 
       .  3 .  2310 . 1 1 20 A C4'  C -32.157  13.223 37.664 . . . 1.0 . . . . . . . . . . . . A . 20 A C4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2311 . 1 1 20 A C5   C -28.104   9.427 36.670 . . . 1.0 . . . . . . . . . . . . A . 20 A C5   . . . . . . . . . rr_2l5z 1 
       .  3 .  2312 . 1 1 20 A C5'  C -32.791  13.944 36.473 . . . 1.0 . . . . . . . . . . . . A . 20 A C5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2313 . 1 1 20 A C6   C -27.159   8.406 36.822 . . . 1.0 . . . . . . . . . . . . A . 20 A C6   . . . . . . . . . rr_2l5z 1 
       .  3 .  2314 . 1 1 20 A C8   C -29.400  10.970 36.101 . . . 1.0 . . . . . . . . . . . . A . 20 A C8   . . . . . . . . . rr_2l5z 1 
       .  3 .  2315 . 1 1 20 A H1'  H -31.087  10.829 38.961 . . . 1.0 . . . . . . . . . . . . A . 20 A H1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2316 . 1 1 20 A H2   H -27.710   7.722 39.990 . . . 1.0 . . . . . . . . . . . . A . 20 A H2   . . . . . . . . . rr_2l5z 1 
       .  3 .  2317 . 1 1 20 A H2'  H -29.040  12.804 38.594 . . . 1.0 . . . . . . . . . . . . A . 20 A H2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2318 . 1 1 20 A H3'  H -30.284  14.282 37.263 . . . 1.0 . . . . . . . . . . . . A . 20 A H3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2319 . 1 1 20 A H4'  H -32.858  13.209 38.496 . . . 1.0 . . . . . . . . . . . . A . 20 A H4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2320 . 1 1 20 A H5'  H -33.574  13.311 36.052 . . . 1.0 . . . . . . . . . . . . A . 20 A H5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2321 . 1 1 20 A H5'' H -33.236  14.877 36.818 . . . 1.0 . . . . . . . . . . . . A . 20 A H5'' . . . . . . . . . rr_2l5z 1 
       .  3 .  2322 . 1 1 20 A H61  H -25.701   7.248 35.998 . . . 1.0 . . . . . . . . . . . . A . 20 A H61  . . . . . . . . . rr_2l5z 1 
       .  3 .  2323 . 1 1 20 A H62  H -26.435   8.414 34.919 . . . 1.0 . . . . . . . . . . . . A . 20 A H62  . . . . . . . . . rr_2l5z 1 
       .  3 .  2324 . 1 1 20 A H8   H -29.912  11.725 35.525 . . . 1.0 . . . . . . . . . . . . A . 20 A H8   . . . . . . . . . rr_2l5z 1 
       .  3 .  2325 . 1 1 20 A HO2' H -29.581  12.382 40.645 . . . 1.0 . . . . . . . . . . . . A . 20 A HO2' . . . . . . . . . rr_2l5z 1 
       .  3 .  2326 . 1 1 20 A N1   N -27.060   7.831 38.034 . . . 1.0 . . . . . . . . . . . . A . 20 A N1   . . . . . . . . . rr_2l5z 1 
       .  3 .  2327 . 1 1 20 A N3   N -28.768   9.186 39.006 . . . 1.0 . . . . . . . . . . . . A . 20 A N3   . . . . . . . . . rr_2l5z 1 
       .  3 .  2328 . 1 1 20 A N6   N -26.367   7.990 35.834 . . . 1.0 . . . . . . . . . . . . A . 20 A N6   . . . . . . . . . rr_2l5z 1 
       .  3 .  2329 . 1 1 20 A N7   N -28.475  10.232 35.577 . . . 1.0 . . . . . . . . . . . . A . 20 A N7   . . . . . . . . . rr_2l5z 1 
       .  3 .  2330 . 1 1 20 A N9   N -29.687  10.755 37.396 . . . 1.0 . . . . . . . . . . . . A . 20 A N9   . . . . . . . . . rr_2l5z 1 
       .  3 .  2331 . 1 1 20 A O2'  O -30.348  12.774 40.221 . . . 1.0 . . . . . . . . . . . . A . 20 A O2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2332 . 1 1 20 A O3'  O -31.172  14.887 39.070 . . . 1.0 . . . . . . . . . . . . A . 20 A O3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2333 . 1 1 20 A O4'  O -31.795  11.889 37.335 . . . 1.0 . . . . . . . . . . . . A . 20 A O4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2334 . 1 1 20 A O5'  O -31.825  14.234 35.458 . . . 1.0 . . . . . . . . . . . . A . 20 A O5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2335 . 1 1 20 A OP1  O -32.844  15.596 33.618 . . . 1.0 . . . . . . . . . . . . A . 20 A OP1  . . . . . . . . . rr_2l5z 1 
       .  3 .  2336 . 1 1 20 A OP2  O -31.119  13.773 33.099 . . . 1.0 . . . . . . . . . . . . A . 20 A OP2  . . . . . . . . . rr_2l5z 1 
       .  3 .  2337 . 1 1 20 A P    P -32.255  14.269 33.907 . . . 1.0 . . . . . . . . . . . . A . 20 A P    . . . . . . . . . rr_2l5z 1 
       .  3 .  2338 . 1 1 21 C C1'  C -25.134  12.865 38.472 . . . 1.0 . . . . . . . . . . . . A . 21 C C1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2339 . 1 1 21 C C2   C -23.798  11.120 37.377 . . . 1.0 . . . . . . . . . . . . A . 21 C C2   . . . . . . . . . rr_2l5z 1 
       .  3 .  2340 . 1 1 21 C C2'  C -24.235  14.083 38.197 . . . 1.0 . . . . . . . . . . . . A . 21 C C2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2341 . 1 1 21 C C3'  C -25.218  15.249 38.111 . . . 1.0 . . . . . . . . . . . . A . 21 C C3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2342 . 1 1 21 C C4   C -24.554  10.036 35.438 . . . 1.0 . . . . . . . . . . . . A . 21 C C4   . . . . . . . . . rr_2l5z 1 
       .  3 .  2343 . 1 1 21 C C4'  C -26.422  14.734 38.881 . . . 1.0 . . . . . . . . . . . . A . 21 C C4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2344 . 1 1 21 C C5   C -25.771  10.787 35.456 . . . 1.0 . . . . . . . . . . . . A . 21 C C5   . . . . . . . . . rr_2l5z 1 
       .  3 .  2345 . 1 1 21 C C5'  C -27.713  15.462 38.498 . . . 1.0 . . . . . . . . . . . . A . 21 C C5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2346 . 1 1 21 C C6   C -25.943  11.682 36.449 . . . 1.0 . . . . . . . . . . . . A . 21 C C6   . . . . . . . . . rr_2l5z 1 
       .  3 .  2347 . 1 1 21 C H1'  H -24.861  12.422 39.430 . . . 1.0 . . . . . . . . . . . . A . 21 C H1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2348 . 1 1 21 C H2'  H -23.716  13.955 37.241 . . . 1.0 . . . . . . . . . . . . A . 21 C H2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2349 . 1 1 21 C H3'  H -25.471  15.501 37.078 . . . 1.0 . . . . . . . . . . . . A . 21 C H3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2350 . 1 1 21 C H4'  H -26.247  14.840 39.949 . . . 1.0 . . . . . . . . . . . . A . 21 C H4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2351 . 1 1 21 C H41  H -23.481   8.615 34.453 . . . 1.0 . . . . . . . . . . . . A . 21 C H41  . . . . . . . . . rr_2l5z 1 
       .  3 .  2352 . 1 1 21 C H42  H -25.035   9.008 33.749 . . . 1.0 . . . . . . . . . . . . A . 21 C H42  . . . . . . . . . rr_2l5z 1 
       .  3 .  2353 . 1 1 21 C H5   H -26.528  10.642 34.699 . . . 1.0 . . . . . . . . . . . . A . 21 C H5   . . . . . . . . . rr_2l5z 1 
       .  3 .  2354 . 1 1 21 C H5'  H -27.518  16.533 38.410 . . . 1.0 . . . . . . . . . . . . A . 21 C H5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2355 . 1 1 21 C H5'' H -28.064  15.084 37.537 . . . 1.0 . . . . . . . . . . . . A . 21 C H5'' . . . . . . . . . rr_2l5z 1 
       .  3 .  2356 . 1 1 21 C H6   H -26.850  12.266 36.494 . . . 1.0 . . . . . . . . . . . . A . 21 C H6   . . . . . . . . . rr_2l5z 1 
       .  3 .  2357 . 1 1 21 C HO2' H -23.321  15.207 39.495 . . . 1.0 . . . . . . . . . . . . A . 21 C HO2' . . . . . . . . . rr_2l5z 1 
       .  3 .  2358 . 1 1 21 C N1   N -24.978  11.856 37.399 . . . 1.0 . . . . . . . . . . . . A . 21 C N1   . . . . . . . . . rr_2l5z 1 
       .  3 .  2359 . 1 1 21 C N3   N -23.619  10.216 36.378 . . . 1.0 . . . . . . . . . . . . A . 21 C N3   . . . . . . . . . rr_2l5z 1 
       .  3 .  2360 . 1 1 21 C N4   N -24.339   9.148 34.469 . . . 1.0 . . . . . . . . . . . . A . 21 C N4   . . . . . . . . . rr_2l5z 1 
       .  3 .  2361 . 1 1 21 C O2   O -22.945  11.292 38.247 . . . 1.0 . . . . . . . . . . . . A . 21 C O2   . . . . . . . . . rr_2l5z 1 
       .  3 .  2362 . 1 1 21 C O2'  O -23.293  14.278 39.258 . . . 1.0 . . . . . . . . . . . . A . 21 C O2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2363 . 1 1 21 C O3'  O -24.661  16.360 38.819 . . . 1.0 . . . . . . . . . . . . A . 21 C O3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2364 . 1 1 21 C O4'  O -26.477  13.353 38.551 . . . 1.0 . . . . . . . . . . . . A . 21 C O4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2365 . 1 1 21 C O5'  O -28.730  15.258 39.480 . . . 1.0 . . . . . . . . . . . . A . 21 C O5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2366 . 1 1 21 C OP1  O -30.430  16.598 40.740 . . . 1.0 . . . . . . . . . . . . A . 21 C OP1  . . . . . . . . . rr_2l5z 1 
       .  3 .  2367 . 1 1 21 C OP2  O -30.065  16.968 38.230 . . . 1.0 . . . . . . . . . . . . A . 21 C OP2  . . . . . . . . . rr_2l5z 1 
       .  3 .  2368 . 1 1 21 C P    P -30.122  16.059 39.396 . . . 1.0 . . . . . . . . . . . . A . 21 C P    . . . . . . . . . rr_2l5z 1 
       .  3 .  2369 . 1 1 22 G C1'  C -19.760  14.061 40.062 . . . 1.0 . . . . . . . . . . . . A . 22 G C1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2370 . 1 1 22 G C2   C -17.761  10.881 37.714 . . . 1.0 . . . . . . . . . . . . A . 22 G C2   . . . . . . . . . rr_2l5z 1 
       .  3 .  2371 . 1 1 22 G C2'  C -18.600  15.049 40.012 . . . 1.0 . . . . . . . . . . . . A . 22 G C2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2372 . 1 1 22 G C3'  C -19.326  16.344 39.709 . . . 1.0 . . . . . . . . . . . . A . 22 G C3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2373 . 1 1 22 G C4   C -19.281  12.469 38.094 . . . 1.0 . . . . . . . . . . . . A . 22 G C4   . . . . . . . . . rr_2l5z 1 
       .  3 .  2374 . 1 1 22 G C4'  C -20.577  16.204 40.561 . . . 1.0 . . . . . . . . . . . . A . 22 G C4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2375 . 1 1 22 G C5   C -19.892  12.325 36.857 . . . 1.0 . . . . . . . . . . . . A . 22 G C5   . . . . . . . . . rr_2l5z 1 
       .  3 .  2376 . 1 1 22 G C5'  C -21.717  17.083 40.048 . . . 1.0 . . . . . . . . . . . . A . 22 G C5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2377 . 1 1 22 G C6   C -19.396  11.362 35.940 . . . 1.0 . . . . . . . . . . . . A . 22 G C6   . . . . . . . . . rr_2l5z 1 
       .  3 .  2378 . 1 1 22 G C8   C -20.931  13.837 37.866 . . . 1.0 . . . . . . . . . . . . A . 22 G C8   . . . . . . . . . rr_2l5z 1 
       .  3 .  2379 . 1 1 22 G H1   H -17.880   9.963 35.838 . . . 1.0 . . . . . . . . . . . . A . 22 G H1   . . . . . . . . . rr_2l5z 1 
       .  3 .  2380 . 1 1 22 G H1'  H -19.547  13.276 40.786 . . . 1.0 . . . . . . . . . . . . A . 22 G H1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2381 . 1 1 22 G H2'  H -17.922  14.795 39.194 . . . 1.0 . . . . . . . . . . . . A . 22 G H2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2382 . 1 1 22 G H21  H -16.367   9.436 37.375 . . . 1.0 . . . . . . . . . . . . A . 22 G H21  . . . . . . . . . rr_2l5z 1 
       .  3 .  2383 . 1 1 22 G H22  H -16.268  10.225 38.933 . . . 1.0 . . . . . . . . . . . . A . 22 G H22  . . . . . . . . . rr_2l5z 1 
       .  3 .  2384 . 1 1 22 G H3'  H -19.558  16.440 38.646 . . . 1.0 . . . . . . . . . . . . A . 22 G H3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2385 . 1 1 22 G H4'  H -20.349  16.466 41.592 . . . 1.0 . . . . . . . . . . . . A . 22 G H4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2386 . 1 1 22 G H5'  H -22.551  17.024 40.747 . . . 1.0 . . . . . . . . . . . . A . 22 G H5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2387 . 1 1 22 G H5'' H -21.372  18.114 39.992 . . . 1.0 . . . . . . . . . . . . A . 22 G H5'' . . . . . . . . . rr_2l5z 1 
       .  3 .  2388 . 1 1 22 G H8   H -21.637  14.613 38.106 . . . 1.0 . . . . . . . . . . . . A . 22 G H8   . . . . . . . . . rr_2l5z 1 
       .  3 .  2389 . 1 1 22 G HO2' H -18.357  14.524 41.870 . . . 1.0 . . . . . . . . . . . . A . 22 G HO2' . . . . . . . . . rr_2l5z 1 
       .  3 .  2390 . 1 1 22 G N1   N -18.308  10.674 36.463 . . . 1.0 . . . . . . . . . . . . A . 22 G N1   . . . . . . . . . rr_2l5z 1 
       .  3 .  2391 . 1 1 22 G N2   N -16.714  10.119 38.033 . . . 1.0 . . . . . . . . . . . . A . 22 G N2   . . . . . . . . . rr_2l5z 1 
       .  3 .  2392 . 1 1 22 G N3   N -18.222  11.786 38.586 . . . 1.0 . . . . . . . . . . . . A . 22 G N3   . . . . . . . . . rr_2l5z 1 
       .  3 .  2393 . 1 1 22 G N7   N -20.963  13.224 36.728 . . . 1.0 . . . . . . . . . . . . A . 22 G N7   . . . . . . . . . rr_2l5z 1 
       .  3 .  2394 . 1 1 22 G N9   N -19.978  13.462 38.734 . . . 1.0 . . . . . . . . . . . . A . 22 G N9   . . . . . . . . . rr_2l5z 1 
       .  3 .  2395 . 1 1 22 G O2'  O -17.905  15.114 41.263 . . . 1.0 . . . . . . . . . . . . A . 22 G O2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2396 . 1 1 22 G O3'  O -18.545  17.437 40.198 . . . 1.0 . . . . . . . . . . . . A . 22 G O3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2397 . 1 1 22 G O4'  O -20.912  14.812 40.493 . . . 1.0 . . . . . . . . . . . . A . 22 G O4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2398 . 1 1 22 G O5'  O -22.164  16.672 38.754 . . . 1.0 . . . . . . . . . . . . A . 22 G O5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2399 . 1 1 22 G O6   O -19.811  11.097 34.814 . . . 1.0 . . . . . . . . . . . . A . 22 G O6   . . . . . . . . . rr_2l5z 1 
       .  3 .  2400 . 1 1 22 G OP1  O -23.683  18.660 38.627 . . . 1.0 . . . . . . . . . . . . A . 22 G OP1  . . . . . . . . . rr_2l5z 1 
       .  3 .  2401 . 1 1 22 G OP2  O -23.527  17.003 36.679 . . . 1.0 . . . . . . . . . . . . A . 22 G OP2  . . . . . . . . . rr_2l5z 1 
       .  3 .  2402 . 1 1 22 G P    P -23.524  17.273 38.134 . . . 1.0 . . . . . . . . . . . . A . 22 G P    . . . . . . . . . rr_2l5z 1 
       .  3 .  2403 . 1 1 23 G C1'  C -15.503  14.121 36.926 . . . 1.0 . . . . . . . . . . . . A . 23 G C1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2404 . 1 1 23 G C2   C -16.206  11.901 33.173 . . . 1.0 . . . . . . . . . . . . A . 23 G C2   . . . . . . . . . rr_2l5z 1 
       .  3 .  2405 . 1 1 23 G C2'  C -14.315  14.838 36.281 . . . 1.0 . . . . . . . . . . . . A . 23 G C2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2406 . 1 1 23 G C3'  C -14.402  16.226 36.889 . . . 1.0 . . . . . . . . . . . . A . 23 G C3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2407 . 1 1 23 G C4   C -16.742  13.298 34.827 . . . 1.0 . . . . . . . . . . . . A . 23 G C4   . . . . . . . . . rr_2l5z 1 
       .  3 .  2408 . 1 1 23 G C4'  C -14.907  15.924 38.285 . . . 1.0 . . . . . . . . . . . . A . 23 G C4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2409 . 1 1 23 G C5   C -18.004  13.577 34.327 . . . 1.0 . . . . . . . . . . . . A . 23 G C5   . . . . . . . . . rr_2l5z 1 
       .  3 .  2410 . 1 1 23 G C5'  C -15.533  17.153 38.941 . . . 1.0 . . . . . . . . . . . . A . 23 G C5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2411 . 1 1 23 G C6   C -18.429  12.957 33.120 . . . 1.0 . . . . . . . . . . . . A . 23 G C6   . . . . . . . . . rr_2l5z 1 
       .  3 .  2412 . 1 1 23 G C8   C -17.800  14.688 36.092 . . . 1.0 . . . . . . . . . . . . A . 23 G C8   . . . . . . . . . rr_2l5z 1 
       .  3 .  2413 . 1 1 23 G H1   H -17.685  11.628 31.718 . . . 1.0 . . . . . . . . . . . . A . 23 G H1   . . . . . . . . . rr_2l5z 1 
       .  3 .  2414 . 1 1 23 G H1'  H -15.208  13.114 37.223 . . . 1.0 . . . . . . . . . . . . A . 23 G H1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2415 . 1 1 23 G H2'  H -14.454  14.891 35.200 . . . 1.0 . . . . . . . . . . . . A . 23 G H2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2416 . 1 1 23 G H21  H -15.704  10.627 31.667 . . . 1.0 . . . . . . . . . . . . A . 23 G H21  . . . . . . . . . rr_2l5z 1 
       .  3 .  2417 . 1 1 23 G H22  H -14.476  10.867 32.890 . . . 1.0 . . . . . . . . . . . . A . 23 G H22  . . . . . . . . . rr_2l5z 1 
       .  3 .  2418 . 1 1 23 G H3'  H -15.088  16.872 36.338 . . . 1.0 . . . . . . . . . . . . A . 23 G H3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2419 . 1 1 23 G H4'  H -14.087  15.557 38.901 . . . 1.0 . . . . . . . . . . . . A . 23 G H4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2420 . 1 1 23 G H5'  H -15.652  16.963 40.008 . . . 1.0 . . . . . . . . . . . . A . 23 G H5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2421 . 1 1 23 G H5'' H -14.867  18.005 38.805 . . . 1.0 . . . . . . . . . . . . A . 23 G H5'' . . . . . . . . . rr_2l5z 1 
       .  3 .  2422 . 1 1 23 G H8   H -17.995  15.358 36.915 . . . 1.0 . . . . . . . . . . . . A . 23 G H8   . . . . . . . . . rr_2l5z 1 
       .  3 .  2423 . 1 1 23 G HO2' H -12.732  14.627 37.395 . . . 1.0 . . . . . . . . . . . . A . 23 G HO2' . . . . . . . . . rr_2l5z 1 
       .  3 .  2424 . 1 1 23 G N1   N -17.446  12.119 32.604 . . . 1.0 . . . . . . . . . . . . A . 23 G N1   . . . . . . . . . rr_2l5z 1 
       .  3 .  2425 . 1 1 23 G N2   N -15.397  11.064 32.524 . . . 1.0 . . . . . . . . . . . . A . 23 G N2   . . . . . . . . . rr_2l5z 1 
       .  3 .  2426 . 1 1 23 G N3   N -15.800  12.479 34.308 . . . 1.0 . . . . . . . . . . . . A . 23 G N3   . . . . . . . . . rr_2l5z 1 
       .  3 .  2427 . 1 1 23 G N7   N -18.678  14.484 35.164 . . . 1.0 . . . . . . . . . . . . A . 23 G N7   . . . . . . . . . rr_2l5z 1 
       .  3 .  2428 . 1 1 23 G N9   N -16.630  14.033 35.979 . . . 1.0 . . . . . . . . . . . . A . 23 G N9   . . . . . . . . . rr_2l5z 1 
       .  3 .  2429 . 1 1 23 G O2'  O -13.075  14.199 36.608 . . . 1.0 . . . . . . . . . . . . A . 23 G O2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2430 . 1 1 23 G O3'  O -13.085  16.776 36.977 . . . 1.0 . . . . . . . . . . . . A . 23 G O3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2431 . 1 1 23 G O4'  O -15.859  14.877 38.099 . . . 1.0 . . . . . . . . . . . . A . 23 G O4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2432 . 1 1 23 G O5'  O -16.809  17.466 38.380 . . . 1.0 . . . . . . . . . . . . A . 23 G O5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2433 . 1 1 23 G O6   O -19.503  13.083 32.533 . . . 1.0 . . . . . . . . . . . . A . 23 G O6   . . . . . . . . . rr_2l5z 1 
       .  3 .  2434 . 1 1 23 G OP1  O -17.027  19.414 39.942 . . . 1.0 . . . . . . . . . . . . A . 23 G OP1  . . . . . . . . . rr_2l5z 1 
       .  3 .  2435 . 1 1 23 G OP2  O -18.843  18.921 38.202 . . . 1.0 . . . . . . . . . . . . A . 23 G OP2  . . . . . . . . . rr_2l5z 1 
       .  3 .  2436 . 1 1 23 G P    P -17.825  18.440 39.164 . . . 1.0 . . . . . . . . . . . . A . 23 G P    . . . . . . . . . rr_2l5z 1 
       .  3 .  2437 . 1 1 24 C C1'  C -12.635  14.814 31.694 . . . 1.0 . . . . . . . . . . . . A . 24 C C1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2438 . 1 1 24 C C2   C -14.828  14.489 30.574 . . . 1.0 . . . . . . . . . . . . A . 24 C C2   . . . . . . . . . rr_2l5z 1 
       .  3 .  2439 . 1 1 24 C C2'  C -11.881  15.825 30.828 . . . 1.0 . . . . . . . . . . . . A . 24 C C2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2440 . 1 1 24 C C3'  C -11.375  16.828 31.850 . . . 1.0 . . . . . . . . . . . . A . 24 C C3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2441 . 1 1 24 C C4   C -16.773  15.496 31.420 . . . 1.0 . . . . . . . . . . . . A . 24 C C4   . . . . . . . . . rr_2l5z 1 
       .  3 .  2442 . 1 1 24 C C4'  C -11.104  15.948 33.057 . . . 1.0 . . . . . . . . . . . . A . 24 C C4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2443 . 1 1 24 C C5   C -16.037  16.087 32.495 . . . 1.0 . . . . . . . . . . . . A . 24 C C5   . . . . . . . . . rr_2l5z 1 
       .  3 .  2444 . 1 1 24 C C5'  C -11.096  16.750 34.358 . . . 1.0 . . . . . . . . . . . . A . 24 C C5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2445 . 1 1 24 C C6   C -14.712  15.847 32.557 . . . 1.0 . . . . . . . . . . . . A . 24 C C6   . . . . . . . . . rr_2l5z 1 
       .  3 .  2446 . 1 1 24 C H1'  H -12.400  13.799 31.358 . . . 1.0 . . . . . . . . . . . . A . 24 C H1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2447 . 1 1 24 C H2'  H -12.574  16.312 30.138 . . . 1.0 . . . . . . . . . . . . A . 24 C H2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2448 . 1 1 24 C H3'  H -12.115  17.602 32.061 . . . 1.0 . . . . . . . . . . . . A . 24 C H3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2449 . 1 1 24 C H4'  H -10.148  15.442 32.933 . . . 1.0 . . . . . . . . . . . . A . 24 C H4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2450 . 1 1 24 C H41  H -18.608  15.295 30.566 . . . 1.0 . . . . . . . . . . . . A . 24 C H41  . . . . . . . . . rr_2l5z 1 
       .  3 .  2451 . 1 1 24 C H42  H -18.554  16.286 32.006 . . . 1.0 . . . . . . . . . . . . A . 24 C H42  . . . . . . . . . rr_2l5z 1 
       .  3 .  2452 . 1 1 24 C H5   H -16.527  16.705 33.234 . . . 1.0 . . . . . . . . . . . . A . 24 C H5   . . . . . . . . . rr_2l5z 1 
       .  3 .  2453 . 1 1 24 C H5'  H -10.834  16.086 35.183 . . . 1.0 . . . . . . . . . . . . A . 24 C H5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2454 . 1 1 24 C H5'' H -10.347  17.538 34.286 . . . 1.0 . . . . . . . . . . . . A . 24 C H5'' . . . . . . . . . rr_2l5z 1 
       .  3 .  2455 . 1 1 24 C H6   H -14.124  16.294 33.347 . . . 1.0 . . . . . . . . . . . . A . 24 C H6   . . . . . . . . . rr_2l5z 1 
       .  3 .  2456 . 1 1 24 C HO2' H -10.763  15.610 29.250 . . . 1.0 . . . . . . . . . . . . A . 24 C HO2' . . . . . . . . . rr_2l5z 1 
       .  3 .  2457 . 1 1 24 C N1   N -14.101  15.062 31.622 . . . 1.0 . . . . . . . . . . . . A . 24 C N1   . . . . . . . . . rr_2l5z 1 
       .  3 .  2458 . 1 1 24 C N3   N -16.164  14.730 30.507 . . . 1.0 . . . . . . . . . . . . A . 24 C N3   . . . . . . . . . rr_2l5z 1 
       .  3 .  2459 . 1 1 24 C N4   N -18.085  15.710 31.323 . . . 1.0 . . . . . . . . . . . . A . 24 C N4   . . . . . . . . . rr_2l5z 1 
       .  3 .  2460 . 1 1 24 C O2   O -14.257  13.790 29.738 . . . 1.0 . . . . . . . . . . . . A . 24 C O2   . . . . . . . . . rr_2l5z 1 
       .  3 .  2461 . 1 1 24 C O2'  O -10.801  15.207 30.120 . . . 1.0 . . . . . . . . . . . . A . 24 C O2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2462 . 1 1 24 C O3'  O -10.138  17.371 31.381 . . . 1.0 . . . . . . . . . . . . A . 24 C O3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2463 . 1 1 24 C O4'  O -12.151  14.981 33.042 . . . 1.0 . . . . . . . . . . . . A . 24 C O4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2464 . 1 1 24 C O5'  O -12.370  17.344 34.625 . . . 1.0 . . . . . . . . . . . . A . 24 C O5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2465 . 1 1 24 C OP1  O -11.398  18.585 36.573 . . . 1.0 . . . . . . . . . . . . A . 24 C OP1  . . . . . . . . . rr_2l5z 1 
       .  3 .  2466 . 1 1 24 C OP2  O -13.849  18.908 35.906 . . . 1.0 . . . . . . . . . . . . A . 24 C OP2  . . . . . . . . . rr_2l5z 1 
       .  3 .  2467 . 1 1 24 C P    P -12.667  18.030 36.054 . . . 1.0 . . . . . . . . . . . . A . 24 C P    . . . . . . . . . rr_2l5z 1 
       .  3 .  2468 . 1 1 25 U C1'  C -12.104  15.890 26.326 . . . 1.0 . . . . . . . . . . . . A . 25 U C1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2469 . 1 1 25 U C2   C -14.599  15.929 26.296 . . . 1.0 . . . . . . . . . . . . A . 25 U C2   . . . . . . . . . rr_2l5z 1 
       .  3 .  2470 . 1 1 25 U C2'  C -11.565  16.822 25.237 . . . 1.0 . . . . . . . . . . . . A . 25 U C2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2471 . 1 1 25 U C3'  C -10.615  17.712 26.013 . . . 1.0 . . . . . . . . . . . . A . 25 U C3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2472 . 1 1 25 U C4   C -15.858  17.430 27.798 . . . 1.0 . . . . . . . . . . . . A . 25 U C4   . . . . . . . . . rr_2l5z 1 
       .  3 .  2473 . 1 1 25 U C4'  C -10.026  16.737 27.013 . . . 1.0 . . . . . . . . . . . . A . 25 U C4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2474 . 1 1 25 U C5   C -14.581  17.862 28.318 . . . 1.0 . . . . . . . . . . . . A . 25 U C5   . . . . . . . . . rr_2l5z 1 
       .  3 .  2475 . 1 1 25 U C5'  C  -9.449  17.450 28.235 . . . 1.0 . . . . . . . . . . . . A . 25 U C5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2476 . 1 1 25 U C6   C -13.422  17.345 27.845 . . . 1.0 . . . . . . . . . . . . A . 25 U C6   . . . . . . . . . rr_2l5z 1 
       .  3 .  2477 . 1 1 25 U H1'  H -12.207  14.885 25.904 . . . 1.0 . . . . . . . . . . . . A . 25 U H1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2478 . 1 1 25 U H2'  H -12.378  17.412 24.814 . . . 1.0 . . . . . . . . . . . . A . 25 U H2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2479 . 1 1 25 U H3   H -16.658  16.151 26.376 . . . 1.0 . . . . . . . . . . . . A . 25 U H3   . . . . . . . . . rr_2l5z 1 
       .  3 .  2480 . 1 1 25 U H3'  H -11.131  18.543 26.497 . . . 1.0 . . . . . . . . . . . . A . 25 U H3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2481 . 1 1 25 U H4'  H  -9.247  16.158 26.527 . . . 1.0 . . . . . . . . . . . . A . 25 U H4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2482 . 1 1 25 U H5   H -14.546  18.643 29.065 . . . 1.0 . . . . . . . . . . . . A . 25 U H5   . . . . . . . . . rr_2l5z 1 
       .  3 .  2483 . 1 1 25 U H5'  H  -8.949  16.718 28.868 . . . 1.0 . . . . . . . . . . . . A . 25 U H5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2484 . 1 1 25 U H5'' H  -8.720  18.188 27.903 . . . 1.0 . . . . . . . . . . . . A . 25 U H5'' . . . . . . . . . rr_2l5z 1 
       .  3 .  2485 . 1 1 25 U H6   H -12.485  17.699 28.248 . . . 1.0 . . . . . . . . . . . . A . 25 U H6   . . . . . . . . . rr_2l5z 1 
       .  3 .  2486 . 1 1 25 U HO2' H  -9.996  16.461 24.144 . . . 1.0 . . . . . . . . . . . . A . 25 U HO2' . . . . . . . . . rr_2l5z 1 
       .  3 .  2487 . 1 1 25 U N1   N -13.409  16.398 26.854 . . . 1.0 . . . . . . . . . . . . A . 25 U N1   . . . . . . . . . rr_2l5z 1 
       .  3 .  2488 . 1 1 25 U N3   N -15.766  16.475 26.801 . . . 1.0 . . . . . . . . . . . . A . 25 U N3   . . . . . . . . . rr_2l5z 1 
       .  3 .  2489 . 1 1 25 U O2   O -14.612  15.082 25.407 . . . 1.0 . . . . . . . . . . . . A . 25 U O2   . . . . . . . . . rr_2l5z 1 
       .  3 .  2490 . 1 1 25 U O2'  O -10.879  16.091 24.215 . . . 1.0 . . . . . . . . . . . . A . 25 U O2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2491 . 1 1 25 U O3'  O  -9.575  18.151 25.135 . . . 1.0 . . . . . . . . . . . . A . 25 U O3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2492 . 1 1 25 U O4   O -16.954  17.842 28.172 . . . 1.0 . . . . . . . . . . . . A . 25 U O4   . . . . . . . . . rr_2l5z 1 
       .  3 .  2493 . 1 1 25 U O4'  O -11.104  15.868 27.364 . . . 1.0 . . . . . . . . . . . . A . 25 U O4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2494 . 1 1 25 U O5'  O -10.463  18.108 28.996 . . . 1.0 . . . . . . . . . . . . A . 25 U O5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2495 . 1 1 25 U OP1  O  -8.751  19.233 30.439 . . . 1.0 . . . . . . . . . . . . A . 25 U OP1  . . . . . . . . . rr_2l5z 1 
       .  3 .  2496 . 1 1 25 U OP2  O -11.254  19.558 30.880 . . . 1.0 . . . . . . . . . . . . A . 25 U OP2  . . . . . . . . . rr_2l5z 1 
       .  3 .  2497 . 1 1 25 U P    P -10.128  18.693 30.461 . . . 1.0 . . . . . . . . . . . . A . 25 U P    . . . . . . . . . rr_2l5z 1 
       .  3 .  2498 . 1 1 26 C C1'  C -14.492  19.390 22.490 . . . 1.0 . . . . . . . . . . . . A . 26 C C1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2499 . 1 1 26 C C2   C -16.465  20.297 23.632 . . . 1.0 . . . . . . . . . . . . A . 26 C C2   . . . . . . . . . rr_2l5z 1 
       .  3 .  2500 . 1 1 26 C C2'  C -14.140  20.575 21.584 . . . 1.0 . . . . . . . . . . . . A . 26 C C2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2501 . 1 1 26 C C3'  C -12.620  20.661 21.685 . . . 1.0 . . . . . . . . . . . . A . 26 C C3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2502 . 1 1 26 C C4   C -16.454  20.706 25.945 . . . 1.0 . . . . . . . . . . . . A . 26 C C4   . . . . . . . . . rr_2l5z 1 
       .  3 .  2503 . 1 1 26 C C4'  C -12.246  19.209 21.927 . . . 1.0 . . . . . . . . . . . . A . 26 C C4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2504 . 1 1 26 C C5   C -15.103  20.248 26.050 . . . 1.0 . . . . . . . . . . . . A . 26 C C5   . . . . . . . . . rr_2l5z 1 
       .  3 .  2505 . 1 1 26 C C5'  C -10.860  19.074 22.559 . . . 1.0 . . . . . . . . . . . . A . 26 C C5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2506 . 1 1 26 C C6   C -14.493  19.831 24.923 . . . 1.0 . . . . . . . . . . . . A . 26 C C6   . . . . . . . . . rr_2l5z 1 
       .  3 .  2507 . 1 1 26 C H1'  H -15.158  18.712 21.955 . . . 1.0 . . . . . . . . . . . . A . 26 C H1'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2508 . 1 1 26 C H2'  H -14.598  21.490 21.972 . . . 1.0 . . . . . . . . . . . . A . 26 C H2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2509 . 1 1 26 C H3'  H -12.332  21.280 22.543 . . . 1.0 . . . . . . . . . . . . A . 26 C H3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2510 . 1 1 26 C H4'  H -12.273  18.663 20.988 . . . 1.0 . . . . . . . . . . . . A . 26 C H4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2511 . 1 1 26 C H41  H -18.049  21.449 26.967 . . . 1.0 . . . . . . . . . . . . A . 26 C H41  . . . . . . . . . rr_2l5z 1 
       .  3 .  2512 . 1 1 26 C H42  H -16.627  21.119 27.931 . . . 1.0 . . . . . . . . . . . . A . 26 C H42  . . . . . . . . . rr_2l5z 1 
       .  3 .  2513 . 1 1 26 C H5   H -14.589  20.237 27.000 . . . 1.0 . . . . . . . . . . . . A . 26 C H5   . . . . . . . . . rr_2l5z 1 
       .  3 .  2514 . 1 1 26 C H5'  H -10.692  18.031 22.825 . . . 1.0 . . . . . . . . . . . . A . 26 C H5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2515 . 1 1 26 C H5'' H -10.108  19.381 21.831 . . . 1.0 . . . . . . . . . . . . A . 26 C H5'' . . . . . . . . . rr_2l5z 1 
       .  3 .  2516 . 1 1 26 C H6   H -13.471  19.482 24.965 . . . 1.0 . . . . . . . . . . . . A . 26 C H6   . . . . . . . . . rr_2l5z 1 
       .  3 .  2517 . 1 1 26 C HO2' H -13.977  20.844 19.661 . . . 1.0 . . . . . . . . . . . . A . 26 C HO2' . . . . . . . . . rr_2l5z 1 
       .  3 .  2518 . 1 1 26 C HO3' H -12.112  20.462 19.816 . . . 1.0 . . . . . . . . . . . . A . 26 C HO3' . . . . . . . . . rr_2l5z 1 
       .  3 .  2519 . 1 1 26 C N1   N -15.153  19.850 23.729 . . . 1.0 . . . . . . . . . . . . A . 26 C N1   . . . . . . . . . rr_2l5z 1 
       .  3 .  2520 . 1 1 26 C N3   N -17.088  20.720 24.766 . . . 1.0 . . . . . . . . . . . . A . 26 C N3   . . . . . . . . . rr_2l5z 1 
       .  3 .  2521 . 1 1 26 C N4   N -17.095  21.125 27.035 . . . 1.0 . . . . . . . . . . . . A . 26 C N4   . . . . . . . . . rr_2l5z 1 
       .  3 .  2522 . 1 1 26 C O2   O -17.036  20.305 22.543 . . . 1.0 . . . . . . . . . . . . A . 26 C O2   . . . . . . . . . rr_2l5z 1 
       .  3 .  2523 . 1 1 26 C O2'  O -14.557  20.337 20.234 . . . 1.0 . . . . . . . . . . . . A . 26 C O2'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2524 . 1 1 26 C O3'  O -12.040  21.158 20.474 . . . 1.0 . . . . . . . . . . . . A . 26 C O3'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2525 . 1 1 26 C O4'  O -13.265  18.710 22.785 . . . 1.0 . . . . . . . . . . . . A . 26 C O4'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2526 . 1 1 26 C O5'  O -10.732  19.882 23.730 . . . 1.0 . . . . . . . . . . . . A . 26 C O5'  . . . . . . . . . rr_2l5z 1 
       .  3 .  2527 . 1 1 26 C OP1  O  -8.234  19.874 23.907 . . . 1.0 . . . . . . . . . . . . A . 26 C OP1  . . . . . . . . . rr_2l5z 1 
       .  3 .  2528 . 1 1 26 C OP2  O  -9.688  20.529 25.913 . . . 1.0 . . . . . . . . . . . . A . 26 C OP2  . . . . . . . . . rr_2l5z 1 
       .  3 .  2529 . 1 1 26 C P    P  -9.467  19.699 24.708 . . . 1.0 . . . . . . . . . . . . A . 26 C P    . . . . . . . . . rr_2l5z 1 
       .  4 .  2530 . 1 1  1 G C1'  C -24.493  19.442 22.263 . . . 1.0 . . . . . . . . . . . . A .  1 G C1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2531 . 1 1  1 G C2   C -20.304  20.866 22.491 . . . 1.0 . . . . . . . . . . . . A .  1 G C2   . . . . . . . . . rr_2l5z 1 
       .  4 .  2532 . 1 1  1 G C2'  C -24.516  17.956 21.916 . . . 1.0 . . . . . . . . . . . . A .  1 G C2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2533 . 1 1  1 G C3'  C -25.708  17.452 22.705 . . . 1.0 . . . . . . . . . . . . A .  1 G C3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2534 . 1 1  1 G C4   C -22.250  20.157 23.317 . . . 1.0 . . . . . . . . . . . . A .  1 G C4   . . . . . . . . . rr_2l5z 1 
       .  4 .  2535 . 1 1  1 G C4'  C -26.666  18.640 22.658 . . . 1.0 . . . . . . . . . . . . A .  1 G C4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2536 . 1 1  1 G C5   C -21.835  20.229 24.639 . . . 1.0 . . . . . . . . . . . . A .  1 G C5   . . . . . . . . . rr_2l5z 1 
       .  4 .  2537 . 1 1  1 G C5'  C -27.619  18.656 23.855 . . . 1.0 . . . . . . . . . . . . A .  1 G C5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2538 . 1 1  1 G C6   C -20.515  20.663 24.934 . . . 1.0 . . . . . . . . . . . . A .  1 G C6   . . . . . . . . . rr_2l5z 1 
       .  4 .  2539 . 1 1  1 G C8   C -23.816  19.550 24.672 . . . 1.0 . . . . . . . . . . . . A .  1 G C8   . . . . . . . . . rr_2l5z 1 
       .  4 .  2540 . 1 1  1 G H1   H -18.829  21.291 23.911 . . . 1.0 . . . . . . . . . . . . A .  1 G H1   . . . . . . . . . rr_2l5z 1 
       .  4 .  2541 . 1 1  1 G H1'  H -24.198  20.015 21.385 . . . 1.0 . . . . . . . . . . . . A .  1 G H1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2542 . 1 1  1 G H2'  H -23.600  17.475 22.270 . . . 1.0 . . . . . . . . . . . . A .  1 G H2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2543 . 1 1  1 G H21  H -18.533  21.513 21.724 . . . 1.0 . . . . . . . . . . . . A .  1 G H21  . . . . . . . . . rr_2l5z 1 
       .  4 .  2544 . 1 1  1 G H22  H -19.776  21.154 20.546 . . . 1.0 . . . . . . . . . . . . A .  1 G H22  . . . . . . . . . rr_2l5z 1 
       .  4 .  2545 . 1 1  1 G H3'  H -25.428  17.175 23.725 . . . 1.0 . . . . . . . . . . . . A .  1 G H3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2546 . 1 1  1 G H4'  H -27.243  18.602 21.736 . . . 1.0 . . . . . . . . . . . . A .  1 G H4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2547 . 1 1  1 G H5'  H -28.192  19.584 23.841 . . . 1.0 . . . . . . . . . . . . A .  1 G H5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2548 . 1 1  1 G H5'' H -28.306  17.814 23.773 . . . 1.0 . . . . . . . . . . . . A .  1 G H5'' . . . . . . . . . rr_2l5z 1 
       .  4 .  2549 . 1 1  1 G H8   H -24.782  19.204 25.011 . . . 1.0 . . . . . . . . . . . . A .  1 G H8   . . . . . . . . . rr_2l5z 1 
       .  4 .  2550 . 1 1  1 G HO2' H -25.044  18.563 20.143 . . . 1.0 . . . . . . . . . . . . A .  1 G HO2' . . . . . . . . . rr_2l5z 1 
       .  4 .  2551 . 1 1  1 G HO5' H -27.368  17.916 25.636 . . . 1.0 . . . . . . . . . . . . A .  1 G HO5' . . . . . . . . . rr_2l5z 1 
       .  4 .  2552 . 1 1  1 G N1   N -19.808  20.966 23.776 . . . 1.0 . . . . . . . . . . . . A .  1 G N1   . . . . . . . . . rr_2l5z 1 
       .  4 .  2553 . 1 1  1 G N2   N -19.470  21.205 21.507 . . . 1.0 . . . . . . . . . . . . A .  1 G N2   . . . . . . . . . rr_2l5z 1 
       .  4 .  2554 . 1 1  1 G N3   N -21.546  20.457 22.204 . . . 1.0 . . . . . . . . . . . . A .  1 G N3   . . . . . . . . . rr_2l5z 1 
       .  4 .  2555 . 1 1  1 G N7   N -22.867  19.830 25.504 . . . 1.0 . . . . . . . . . . . . A .  1 G N7   . . . . . . . . . rr_2l5z 1 
       .  4 .  2556 . 1 1  1 G N9   N -23.547  19.712 23.364 . . . 1.0 . . . . . . . . . . . . A .  1 G N9   . . . . . . . . . rr_2l5z 1 
       .  4 .  2557 . 1 1  1 G O2'  O -24.692  17.749 20.509 . . . 1.0 . . . . . . . . . . . . A .  1 G O2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2558 . 1 1  1 G O3'  O -26.301  16.365 21.990 . . . 1.0 . . . . . . . . . . . . A .  1 G O3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2559 . 1 1  1 G O4'  O -25.833  19.802 22.640 . . . 1.0 . . . . . . . . . . . . A .  1 G O4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2560 . 1 1  1 G O5'  O -26.912  18.562 25.093 . . . 1.0 . . . . . . . . . . . . A .  1 G O5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2561 . 1 1  1 G O6   O -19.979  20.786 26.033 . . . 1.0 . . . . . . . . . . . . A .  1 G O6   . . . . . . . . . rr_2l5z 1 
       .  4 .  2562 . 1 1  2 A C1'  C -20.882  14.108 21.635 . . . 1.0 . . . . . . . . . . . . A .  2 A C1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2563 . 1 1  2 A C2   C -17.452  15.479 24.067 . . . 1.0 . . . . . . . . . . . . A .  2 A C2   . . . . . . . . . rr_2l5z 1 
       .  4 .  2564 . 1 1  2 A C2'  C -21.100  12.655 22.051 . . . 1.0 . . . . . . . . . . . . A .  2 A C2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2565 . 1 1  2 A C3'  C -22.609  12.516 21.984 . . . 1.0 . . . . . . . . . . . . A .  2 A C3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2566 . 1 1  2 A C4   C -19.580  15.327 23.495 . . . 1.0 . . . . . . . . . . . . A .  2 A C4   . . . . . . . . . rr_2l5z 1 
       .  4 .  2567 . 1 1  2 A C4'  C -22.969  13.419 20.811 . . . 1.0 . . . . . . . . . . . . A .  2 A C4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2568 . 1 1  2 A C5   C -19.995  16.141 24.525 . . . 1.0 . . . . . . . . . . . . A .  2 A C5   . . . . . . . . . rr_2l5z 1 
       .  4 .  2569 . 1 1  2 A C5'  C -24.411  13.921 20.896 . . . 1.0 . . . . . . . . . . . . A .  2 A C5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2570 . 1 1  2 A C6   C -18.997  16.637 25.368 . . . 1.0 . . . . . . . . . . . . A .  2 A C6   . . . . . . . . . rr_2l5z 1 
       .  4 .  2571 . 1 1  2 A C8   C -21.718  15.584 23.478 . . . 1.0 . . . . . . . . . . . . A .  2 A C8   . . . . . . . . . rr_2l5z 1 
       .  4 .  2572 . 1 1  2 A H1'  H -19.991  14.178 21.011 . . . 1.0 . . . . . . . . . . . . A .  2 A H1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2573 . 1 1  2 A H2   H -16.401  15.231 23.912 . . . 1.0 . . . . . . . . . . . . A .  2 A H2   . . . . . . . . . rr_2l5z 1 
       .  4 .  2574 . 1 1  2 A H2'  H -20.755  12.503 23.078 . . . 1.0 . . . . . . . . . . . . A .  2 A H2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2575 . 1 1  2 A H3'  H -23.086  12.830 22.915 . . . 1.0 . . . . . . . . . . . . A .  2 A H3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2576 . 1 1  2 A H4'  H -22.829  12.876 19.878 . . . 1.0 . . . . . . . . . . . . A .  2 A H4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2577 . 1 1  2 A H5'  H -24.555  14.717 20.165 . . . 1.0 . . . . . . . . . . . . A .  2 A H5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2578 . 1 1  2 A H5'' H -25.088  13.099 20.664 . . . 1.0 . . . . . . . . . . . . A .  2 A H5'' . . . . . . . . . rr_2l5z 1 
       .  4 .  2579 . 1 1  2 A H61  H -18.493  17.769 26.983 . . . 1.0 . . . . . . . . . . . . A .  2 A H61  . . . . . . . . . rr_2l5z 1 
       .  4 .  2580 . 1 1  2 A H62  H -20.201  17.711 26.608 . . . 1.0 . . . . . . . . . . . . A .  2 A H62  . . . . . . . . . rr_2l5z 1 
       .  4 .  2581 . 1 1  2 A H8   H -22.747  15.479 23.167 . . . 1.0 . . . . . . . . . . . . A .  2 A H8   . . . . . . . . . rr_2l5z 1 
       .  4 .  2582 . 1 1  2 A HO2' H -19.746  12.235 20.716 . . . 1.0 . . . . . . . . . . . . A .  2 A HO2' . . . . . . . . . rr_2l5z 1 
       .  4 .  2583 . 1 1  2 A N1   N -17.726  16.280 25.101 . . . 1.0 . . . . . . . . . . . . A .  2 A N1   . . . . . . . . . rr_2l5z 1 
       .  4 .  2584 . 1 1  2 A N3   N -18.318  14.953 23.206 . . . 1.0 . . . . . . . . . . . . A .  2 A N3   . . . . . . . . . rr_2l5z 1 
       .  4 .  2585 . 1 1  2 A N6   N -19.250  17.437 26.403 . . . 1.0 . . . . . . . . . . . . A .  2 A N6   . . . . . . . . . rr_2l5z 1 
       .  4 .  2586 . 1 1  2 A N7   N -21.391  16.301 24.502 . . . 1.0 . . . . . . . . . . . . A .  2 A N7   . . . . . . . . . rr_2l5z 1 
       .  4 .  2587 . 1 1  2 A N9   N -20.719  14.972 22.819 . . . 1.0 . . . . . . . . . . . . A .  2 A N9   . . . . . . . . . rr_2l5z 1 
       .  4 .  2588 . 1 1  2 A O2'  O -20.449  11.748 21.153 . . . 1.0 . . . . . . . . . . . . A .  2 A O2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2589 . 1 1  2 A O3'  O -22.927  11.165 21.637 . . . 1.0 . . . . . . . . . . . . A .  2 A O3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2590 . 1 1  2 A O4'  O -22.035  14.499 20.867 . . . 1.0 . . . . . . . . . . . . A .  2 A O4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2591 . 1 1  2 A O5'  O -24.717  14.424 22.199 . . . 1.0 . . . . . . . . . . . . A .  2 A O5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2592 . 1 1  2 A OP1  O -27.156  14.018 21.796 . . . 1.0 . . . . . . . . . . . . A .  2 A OP1  . . . . . . . . . rr_2l5z 1 
       .  4 .  2593 . 1 1  2 A OP2  O -26.334  14.932 24.044 . . . 1.0 . . . . . . . . . . . . A .  2 A OP2  . . . . . . . . . rr_2l5z 1 
       .  4 .  2594 . 1 1  2 A P    P -26.221  14.865 22.570 . . . 1.0 . . . . . . . . . . . . A .  2 A P    . . . . . . . . . rr_2l5z 1 
       .  4 .  2595 . 1 1  3 G C1'  C -17.946  10.665 24.103 . . . 1.0 . . . . . . . . . . . . A .  3 G C1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2596 . 1 1  3 G C2   C -15.846  13.080 27.149 . . . 1.0 . . . . . . . . . . . . A .  3 G C2   . . . . . . . . . rr_2l5z 1 
       .  4 .  2597 . 1 1  3 G C2'  C -17.741   9.218 24.559 . . . 1.0 . . . . . . . . . . . . A .  3 G C2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2598 . 1 1  3 G C3'  C -18.969   8.513 24.009 . . . 1.0 . . . . . . . . . . . . A .  3 G C3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2599 . 1 1  3 G C4   C -17.632  12.223 26.127 . . . 1.0 . . . . . . . . . . . . A .  3 G C4   . . . . . . . . . rr_2l5z 1 
       .  4 .  2600 . 1 1  3 G C4'  C -19.248   9.289 22.733 . . . 1.0 . . . . . . . . . . . . A .  3 G C4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2601 . 1 1  3 G C5   C -18.543  12.826 26.981 . . . 1.0 . . . . . . . . . . . . A .  3 G C5   . . . . . . . . . rr_2l5z 1 
       .  4 .  2602 . 1 1  3 G C5'  C -20.701   9.141 22.283 . . . 1.0 . . . . . . . . . . . . A .  3 G C5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2603 . 1 1  3 G C6   C -18.070  13.649 28.040 . . . 1.0 . . . . . . . . . . . . A .  3 G C6   . . . . . . . . . rr_2l5z 1 
       .  4 .  2604 . 1 1  3 G C8   C -19.660  11.723 25.594 . . . 1.0 . . . . . . . . . . . . A .  3 G C8   . . . . . . . . . rr_2l5z 1 
       .  4 .  2605 . 1 1  3 G H1   H -16.260  14.305 28.793 . . . 1.0 . . . . . . . . . . . . A .  3 G H1   . . . . . . . . . rr_2l5z 1 
       .  4 .  2606 . 1 1  3 G H1'  H -17.008  11.055 23.704 . . . 1.0 . . . . . . . . . . . . A .  3 G H1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2607 . 1 1  3 G H2'  H -17.738   9.167 25.650 . . . 1.0 . . . . . . . . . . . . A .  3 G H2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2608 . 1 1  3 G H21  H -14.206  13.853 28.075 . . . 1.0 . . . . . . . . . . . . A .  3 G H21  . . . . . . . . . rr_2l5z 1 
       .  4 .  2609 . 1 1  3 G H22  H -13.877  12.826 26.697 . . . 1.0 . . . . . . . . . . . . A .  3 G H22  . . . . . . . . . rr_2l5z 1 
       .  4 .  2610 . 1 1  3 G H3'  H -19.806   8.550 24.709 . . . 1.0 . . . . . . . . . . . . A .  3 G H3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2611 . 1 1  3 G H4'  H -18.584   8.946 21.943 . . . 1.0 . . . . . . . . . . . . A .  3 G H4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2612 . 1 1  3 G H5'  H -20.826   9.630 21.318 . . . 1.0 . . . . . . . . . . . . A .  3 G H5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2613 . 1 1  3 G H5'' H -20.932   8.080 22.177 . . . 1.0 . . . . . . . . . . . . A .  3 G H5'' . . . . . . . . . rr_2l5z 1 
       .  4 .  2614 . 1 1  3 G H8   H -20.483  11.272 25.059 . . . 1.0 . . . . . . . . . . . . A .  3 G H8   . . . . . . . . . rr_2l5z 1 
       .  4 .  2615 . 1 1  3 G HO2' H -15.811   9.229 24.300 . . . 1.0 . . . . . . . . . . . . A .  3 G HO2' . . . . . . . . . rr_2l5z 1 
       .  4 .  2616 . 1 1  3 G N1   N -16.681  13.719 28.046 . . . 1.0 . . . . . . . . . . . . A .  3 G N1   . . . . . . . . . rr_2l5z 1 
       .  4 .  2617 . 1 1  3 G N2   N -14.538  13.269 27.321 . . . 1.0 . . . . . . . . . . . . A .  3 G N2   . . . . . . . . . rr_2l5z 1 
       .  4 .  2618 . 1 1  3 G N3   N -16.284  12.307 26.151 . . . 1.0 . . . . . . . . . . . . A .  3 G N3   . . . . . . . . . rr_2l5z 1 
       .  4 .  2619 . 1 1  3 G N7   N -19.858  12.488 26.618 . . . 1.0 . . . . . . . . . . . . A .  3 G N7   . . . . . . . . . rr_2l5z 1 
       .  4 .  2620 . 1 1  3 G N9   N -18.383  11.510 25.230 . . . 1.0 . . . . . . . . . . . . A .  3 G N9   . . . . . . . . . rr_2l5z 1 
       .  4 .  2621 . 1 1  3 G O2'  O -16.536   8.665 24.018 . . . 1.0 . . . . . . . . . . . . A .  3 G O2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2622 . 1 1  3 G O3'  O -18.609   7.173 23.660 . . . 1.0 . . . . . . . . . . . . A .  3 G O3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2623 . 1 1  3 G O4'  O -18.933  10.643 23.056 . . . 1.0 . . . . . . . . . . . . A .  3 G O4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2624 . 1 1  3 G O5'  O -21.609   9.724 23.221 . . . 1.0 . . . . . . . . . . . . A .  3 G O5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2625 . 1 1  3 G O6   O -18.722  14.256 28.886 . . . 1.0 . . . . . . . . . . . . A .  3 G O6   . . . . . . . . . rr_2l5z 1 
       .  4 .  2626 . 1 1  3 G OP1  O -23.703   8.842 22.165 . . . 1.0 . . . . . . . . . . . . A .  3 G OP1  . . . . . . . . . rr_2l5z 1 
       .  4 .  2627 . 1 1  3 G OP2  O -23.806  10.691 23.936 . . . 1.0 . . . . . . . . . . . . A .  3 G OP2  . . . . . . . . . rr_2l5z 1 
       .  4 .  2628 . 1 1  3 G P    P -23.125  10.054 22.787 . . . 1.0 . . . . . . . . . . . . A .  3 G P    . . . . . . . . . rr_2l5z 1 
       .  4 .  2629 . 1 1  4 C C1'  C -15.821   8.364 28.354 . . . 1.0 . . . . . . . . . . . . A .  4 C C1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2630 . 1 1  4 C C2   C -16.615  10.178 29.874 . . . 1.0 . . . . . . . . . . . . A .  4 C C2   . . . . . . . . . rr_2l5z 1 
       .  4 .  2631 . 1 1  4 C C2'  C -15.676   7.076 29.180 . . . 1.0 . . . . . . . . . . . . A .  4 C C2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2632 . 1 1  4 C C3'  C -16.081   5.971 28.205 . . . 1.0 . . . . . . . . . . . . A .  4 C C3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2633 . 1 1  4 C C4   C -18.877  10.806 29.918 . . . 1.0 . . . . . . . . . . . . A .  4 C C4   . . . . . . . . . rr_2l5z 1 
       .  4 .  2634 . 1 1  4 C C4'  C -15.777   6.588 26.852 . . . 1.0 . . . . . . . . . . . . A .  4 C C4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2635 . 1 1  4 C C5   C -19.201   9.832 28.922 . . . 1.0 . . . . . . . . . . . . A .  4 C C5   . . . . . . . . . rr_2l5z 1 
       .  4 .  2636 . 1 1  4 C C5'  C -16.583   5.937 25.727 . . . 1.0 . . . . . . . . . . . . A .  4 C C5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2637 . 1 1  4 C C6   C -18.200   9.064 28.443 . . . 1.0 . . . . . . . . . . . . A .  4 C C6   . . . . . . . . . rr_2l5z 1 
       .  4 .  2638 . 1 1  4 C H1'  H -14.870   8.905 28.358 . . . 1.0 . . . . . . . . . . . . A .  4 C H1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2639 . 1 1  4 C H2'  H -16.366   7.100 30.028 . . . 1.0 . . . . . . . . . . . . A .  4 C H2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2640 . 1 1  4 C H3'  H -17.134   5.698 28.310 . . . 1.0 . . . . . . . . . . . . A .  4 C H3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2641 . 1 1  4 C H4'  H -14.713   6.501 26.638 . . . 1.0 . . . . . . . . . . . . A .  4 C H4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2642 . 1 1  4 C H41  H -19.617  12.271 31.121 . . . 1.0 . . . . . . . . . . . . A .  4 C H41  . . . . . . . . . rr_2l5z 1 
       .  4 .  2643 . 1 1  4 C H42  H -20.790  11.477 30.095 . . . 1.0 . . . . . . . . . . . . A .  4 C H42  . . . . . . . . . rr_2l5z 1 
       .  4 .  2644 . 1 1  4 C H5   H -20.212   9.716 28.566 . . . 1.0 . . . . . . . . . . . . A .  4 C H5   . . . . . . . . . rr_2l5z 1 
       .  4 .  2645 . 1 1  4 C H5'  H -16.254   6.346 24.772 . . . 1.0 . . . . . . . . . . . . A .  4 C H5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2646 . 1 1  4 C H5'' H -16.399   4.862 25.737 . . . 1.0 . . . . . . . . . . . . A .  4 C H5'' . . . . . . . . . rr_2l5z 1 
       .  4 .  2647 . 1 1  4 C H6   H -18.420   8.291 27.719 . . . 1.0 . . . . . . . . . . . . A .  4 C H6   . . . . . . . . . rr_2l5z 1 
       .  4 .  2648 . 1 1  4 C HO2' H -13.755   6.997 28.867 . . . 1.0 . . . . . . . . . . . . A .  4 C HO2' . . . . . . . . . rr_2l5z 1 
       .  4 .  2649 . 1 1  4 C N1   N -16.920   9.221 28.897 . . . 1.0 . . . . . . . . . . . . A .  4 C N1   . . . . . . . . . rr_2l5z 1 
       .  4 .  2650 . 1 1  4 C N3   N -17.623  10.951 30.358 . . . 1.0 . . . . . . . . . . . . A .  4 C N3   . . . . . . . . . rr_2l5z 1 
       .  4 .  2651 . 1 1  4 C N4   N -19.839  11.581 30.418 . . . 1.0 . . . . . . . . . . . . A .  4 C N4   . . . . . . . . . rr_2l5z 1 
       .  4 .  2652 . 1 1  4 C O2   O -15.460  10.302 30.276 . . . 1.0 . . . . . . . . . . . . A .  4 C O2   . . . . . . . . . rr_2l5z 1 
       .  4 .  2653 . 1 1  4 C O2'  O -14.328   6.900 29.632 . . . 1.0 . . . . . . . . . . . . A .  4 C O2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2654 . 1 1  4 C O3'  O -15.208   4.852 28.397 . . . 1.0 . . . . . . . . . . . . A .  4 C O3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2655 . 1 1  4 C O4'  O -16.111   7.960 27.005 . . . 1.0 . . . . . . . . . . . . A .  4 C O4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2656 . 1 1  4 C O5'  O -17.985   6.170 25.878 . . . 1.0 . . . . . . . . . . . . A .  4 C O5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2657 . 1 1  4 C OP1  O -18.611   4.686 23.959 . . . 1.0 . . . . . . . . . . . . A .  4 C OP1  . . . . . . . . . rr_2l5z 1 
       .  4 .  2658 . 1 1  4 C OP2  O -20.371   6.146 25.116 . . . 1.0 . . . . . . . . . . . . A .  4 C OP2  . . . . . . . . . rr_2l5z 1 
       .  4 .  2659 . 1 1  4 C P    P -18.985   5.949 24.636 . . . 1.0 . . . . . . . . . . . . A .  4 C P    . . . . . . . . . rr_2l5z 1 
       .  4 .  2660 . 1 1  5 U C1'  C -15.353   7.181 33.426 . . . 1.0 . . . . . . . . . . . . A .  5 U C1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2661 . 1 1  5 U C2   C -17.448   8.384 34.018 . . . 1.0 . . . . . . . . . . . . A .  5 U C2   . . . . . . . . . rr_2l5z 1 
       .  4 .  2662 . 1 1  5 U C2'  C -15.053   6.200 34.568 . . . 1.0 . . . . . . . . . . . . A .  5 U C2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2663 . 1 1  5 U C3'  C -14.620   4.932 33.841 . . . 1.0 . . . . . . . . . . . . A .  5 U C3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2664 . 1 1  5 U C4   C -19.608   7.742 33.014 . . . 1.0 . . . . . . . . . . . . A .  5 U C4   . . . . . . . . . rr_2l5z 1 
       .  4 .  2665 . 1 1  5 U C4'  C -14.024   5.467 32.546 . . . 1.0 . . . . . . . . . . . . A .  5 U C4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2666 . 1 1  5 U C5   C -18.884   6.727 32.283 . . . 1.0 . . . . . . . . . . . . A .  5 U C5   . . . . . . . . . rr_2l5z 1 
       .  4 .  2667 . 1 1  5 U C5'  C -14.075   4.438 31.413 . . . 1.0 . . . . . . . . . . . . A .  5 U C5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2668 . 1 1  5 U C6   C -17.544   6.582 32.431 . . . 1.0 . . . . . . . . . . . . A .  5 U C6   . . . . . . . . . rr_2l5z 1 
       .  4 .  2669 . 1 1  5 U H1'  H -14.850   8.133 33.626 . . . 1.0 . . . . . . . . . . . . A .  5 U H1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2670 . 1 1  5 U H2'  H -15.966   6.008 35.143 . . . 1.0 . . . . . . . . . . . . A .  5 U H2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2671 . 1 1  5 U H3   H -19.293   9.243 34.410 . . . 1.0 . . . . . . . . . . . . A .  5 U H3   . . . . . . . . . rr_2l5z 1 
       .  4 .  2672 . 1 1  5 U H3'  H -15.460   4.255 33.666 . . . 1.0 . . . . . . . . . . . . A .  5 U H3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2673 . 1 1  5 U H4'  H -12.991   5.768 32.717 . . . 1.0 . . . . . . . . . . . . A .  5 U H4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2674 . 1 1  5 U H5   H -19.422   6.058 31.629 . . . 1.0 . . . . . . . . . . . . A .  5 U H5   . . . . . . . . . rr_2l5z 1 
       .  4 .  2675 . 1 1  5 U H5'  H -13.375   4.735 30.633 . . . 1.0 . . . . . . . . . . . . A .  5 U H5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2676 . 1 1  5 U H5'' H -13.783   3.460 31.798 . . . 1.0 . . . . . . . . . . . . A .  5 U H5'' . . . . . . . . . rr_2l5z 1 
       .  4 .  2677 . 1 1  5 U H6   H -17.034   5.811 31.873 . . . 1.0 . . . . . . . . . . . . A .  5 U H6   . . . . . . . . . rr_2l5z 1 
       .  4 .  2678 . 1 1  5 U HO2' H -13.405   5.967 35.577 . . . 1.0 . . . . . . . . . . . . A .  5 U HO2' . . . . . . . . . rr_2l5z 1 
       .  4 .  2679 . 1 1  5 U N1   N -16.825   7.383 33.275 . . . 1.0 . . . . . . . . . . . . A .  5 U N1   . . . . . . . . . rr_2l5z 1 
       .  4 .  2680 . 1 1  5 U N3   N -18.815   8.510 33.848 . . . 1.0 . . . . . . . . . . . . A .  5 U N3   . . . . . . . . . rr_2l5z 1 
       .  4 .  2681 . 1 1  5 U O2   O -16.820   9.115 34.779 . . . 1.0 . . . . . . . . . . . . A .  5 U O2   . . . . . . . . . rr_2l5z 1 
       .  4 .  2682 . 1 1  5 U O2'  O -14.012   6.693 35.418 . . . 1.0 . . . . . . . . . . . . A .  5 U O2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2683 . 1 1  5 U O3'  O -13.574   4.315 34.597 . . . 1.0 . . . . . . . . . . . . A .  5 U O3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2684 . 1 1  5 U O4   O -20.816   7.948 32.935 . . . 1.0 . . . . . . . . . . . . A .  5 U O4   . . . . . . . . . rr_2l5z 1 
       .  4 .  2685 . 1 1  5 U O4'  O -14.798   6.616 32.227 . . . 1.0 . . . . . . . . . . . . A .  5 U O4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2686 . 1 1  5 U O5'  O -15.387   4.347 30.850 . . . 1.0 . . . . . . . . . . . . A .  5 U O5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2687 . 1 1  5 U OP1  O -14.630   2.571 29.255 . . . 1.0 . . . . . . . . . . . . A .  5 U OP1  . . . . . . . . . rr_2l5z 1 
       .  4 .  2688 . 1 1  5 U OP2  O -17.058   3.391 29.248 . . . 1.0 . . . . . . . . . . . . A .  5 U OP2  . . . . . . . . . rr_2l5z 1 
       .  4 .  2689 . 1 1  5 U P    P -15.612   3.666 29.410 . . . 1.0 . . . . . . . . . . . . A .  5 U P    . . . . . . . . . rr_2l5z 1 
       .  4 .  2690 . 1 1  6 G C1'  C -18.332   5.291 37.900 . . . 1.0 . . . . . . . . . . . . A .  6 G C1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2691 . 1 1  6 G C2   C -20.612   9.059 37.456 . . . 1.0 . . . . . . . . . . . . A .  6 G C2   . . . . . . . . . rr_2l5z 1 
       .  4 .  2692 . 1 1  6 G C2'  C -18.873   4.150 38.772 . . . 1.0 . . . . . . . . . . . . A .  6 G C2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2693 . 1 1  6 G C3'  C -17.877   3.003 38.546 . . . 1.0 . . . . . . . . . . . . A .  6 G C3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2694 . 1 1  6 G C4   C -20.016   6.977 36.920 . . . 1.0 . . . . . . . . . . . . A .  6 G C4   . . . . . . . . . rr_2l5z 1 
       .  4 .  2695 . 1 1  6 G C4'  C -16.657   3.703 37.956 . . . 1.0 . . . . . . . . . . . . A .  6 G C4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2696 . 1 1  6 G C5   C -20.897   6.889 35.851 . . . 1.0 . . . . . . . . . . . . A .  6 G C5   . . . . . . . . . rr_2l5z 1 
       .  4 .  2697 . 1 1  6 G C5'  C -15.811   2.766 37.090 . . . 1.0 . . . . . . . . . . . . A .  6 G C5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2698 . 1 1  6 G C6   C -21.732   7.996 35.541 . . . 1.0 . . . . . . . . . . . . A .  6 G C6   . . . . . . . . . rr_2l5z 1 
       .  4 .  2699 . 1 1  6 G C8   C -19.884   5.059 35.945 . . . 1.0 . . . . . . . . . . . . A .  6 G C8   . . . . . . . . . rr_2l5z 1 
       .  4 .  2700 . 1 1  6 G H1   H -22.090   9.907 36.245 . . . 1.0 . . . . . . . . . . . . A .  6 G H1   . . . . . . . . . rr_2l5z 1 
       .  4 .  2701 . 1 1  6 G H1'  H -18.017   6.115 38.540 . . . 1.0 . . . . . . . . . . . . A .  6 G H1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2702 . 1 1  6 G H2'  H -19.870   3.863 38.425 . . . 1.0 . . . . . . . . . . . . A .  6 G H2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2703 . 1 1  6 G H21  H -21.152  10.957 37.956 . . . 1.0 . . . . . . . . . . . . A .  6 G H21  . . . . . . . . . rr_2l5z 1 
       .  4 .  2704 . 1 1  6 G H22  H -19.916  10.236 38.963 . . . 1.0 . . . . . . . . . . . . A .  6 G H22  . . . . . . . . . rr_2l5z 1 
       .  4 .  2705 . 1 1  6 G H3'  H -18.280   2.230 37.882 . . . 1.0 . . . . . . . . . . . . A .  6 G H3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2706 . 1 1  6 G H4'  H -16.044   4.106 38.760 . . . 1.0 . . . . . . . . . . . . A .  6 G H4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2707 . 1 1  6 G H5'  H -15.592   1.861 37.655 . . . 1.0 . . . . . . . . . . . . A .  6 G H5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2708 . 1 1  6 G H5'' H -16.372   2.501 36.196 . . . 1.0 . . . . . . . . . . . . A .  6 G H5'' . . . . . . . . . rr_2l5z 1 
       .  4 .  2709 . 1 1  6 G H8   H -19.557   4.052 35.736 . . . 1.0 . . . . . . . . . . . . A .  6 G H8   . . . . . . . . . rr_2l5z 1 
       .  4 .  2710 . 1 1  6 G HO2' H -18.182   4.091 40.592 . . . 1.0 . . . . . . . . . . . . A .  6 G HO2' . . . . . . . . . rr_2l5z 1 
       .  4 .  2711 . 1 1  6 G N1   N -21.516   9.057 36.412 . . . 1.0 . . . . . . . . . . . . A .  6 G N1   . . . . . . . . . rr_2l5z 1 
       .  4 .  2712 . 1 1  6 G N2   N -20.555  10.173 38.184 . . . 1.0 . . . . . . . . . . . . A .  6 G N2   . . . . . . . . . rr_2l5z 1 
       .  4 .  2713 . 1 1  6 G N3   N -19.823   8.022 37.757 . . . 1.0 . . . . . . . . . . . . A .  6 G N3   . . . . . . . . . rr_2l5z 1 
       .  4 .  2714 . 1 1  6 G N7   N -20.796   5.633 35.230 . . . 1.0 . . . . . . . . . . . . A .  6 G N7   . . . . . . . . . rr_2l5z 1 
       .  4 .  2715 . 1 1  6 G N9   N -19.366   5.771 36.961 . . . 1.0 . . . . . . . . . . . . A .  6 G N9   . . . . . . . . . rr_2l5z 1 
       .  4 .  2716 . 1 1  6 G O2'  O -18.913   4.533 40.152 . . . 1.0 . . . . . . . . . . . . A .  6 G O2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2717 . 1 1  6 G O3'  O -17.510   2.473 39.824 . . . 1.0 . . . . . . . . . . . . A .  6 G O3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2718 . 1 1  6 G O4'  O -17.195   4.777 37.200 . . . 1.0 . . . . . . . . . . . . A .  6 G O4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2719 . 1 1  6 G O5'  O -14.580   3.381 36.701 . . . 1.0 . . . . . . . . . . . . A .  6 G O5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2720 . 1 1  6 G O6   O -22.567   8.094 34.643 . . . 1.0 . . . . . . . . . . . . A .  6 G O6   . . . . . . . . . rr_2l5z 1 
       .  4 .  2721 . 1 1  6 G OP1  O -12.513   2.351 35.732 . . . 1.0 . . . . . . . . . . . . A .  6 G OP1  . . . . . . . . . rr_2l5z 1 
       .  4 .  2722 . 1 1  6 G OP2  O -14.772   2.117 34.547 . . . 1.0 . . . . . . . . . . . . A .  6 G OP2  . . . . . . . . . rr_2l5z 1 
       .  4 .  2723 . 1 1  6 G P    P -13.826   2.918 35.355 . . . 1.0 . . . . . . . . . . . . A .  6 G P    . . . . . . . . . rr_2l5z 1 
       .  4 .  2724 . 1 1  7 C C1'  C -18.877   3.761 44.699 . . . 1.0 . . . . . . . . . . . . A .  7 C C1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2725 . 1 1  7 C C2   C -21.245   4.378 44.860 . . . 1.0 . . . . . . . . . . . . A .  7 C C2   . . . . . . . . . rr_2l5z 1 
       .  4 .  2726 . 1 1  7 C C2'  C -18.897   2.475 45.525 . . . 1.0 . . . . . . . . . . . . A .  7 C C2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2727 . 1 1  7 C C3'  C -18.199   1.480 44.616 . . . 1.0 . . . . . . . . . . . . A .  7 C C3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2728 . 1 1  7 C C4   C -22.624   4.425 42.957 . . . 1.0 . . . . . . . . . . . . A .  7 C C4   . . . . . . . . . rr_2l5z 1 
       .  4 .  2729 . 1 1  7 C C4'  C -17.195   2.351 43.871 . . . 1.0 . . . . . . . . . . . . A .  7 C C4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2730 . 1 1  7 C C5   C -21.534   4.024 42.121 . . . 1.0 . . . . . . . . . . . . A .  7 C C5   . . . . . . . . . rr_2l5z 1 
       .  4 .  2731 . 1 1  7 C C5'  C -16.811   1.754 42.514 . . . 1.0 . . . . . . . . . . . . A .  7 C C5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2732 . 1 1  7 C C6   C -20.339   3.818 42.707 . . . 1.0 . . . . . . . . . . . . A .  7 C C6   . . . . . . . . . rr_2l5z 1 
       .  4 .  2733 . 1 1  7 C H1'  H -18.646   4.604 45.350 . . . 1.0 . . . . . . . . . . . . A .  7 C H1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2734 . 1 1  7 C H2'  H -19.929   2.159 45.701 . . . 1.0 . . . . . . . . . . . . A .  7 C H2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2735 . 1 1  7 C H3'  H -18.903   0.983 43.944 . . . 1.0 . . . . . . . . . . . . A .  7 C H3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2736 . 1 1  7 C H4'  H -16.300   2.477 44.480 . . . 1.0 . . . . . . . . . . . . A .  7 C H4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2737 . 1 1  7 C H41  H -24.597   4.926 43.004 . . . 1.0 . . . . . . . . . . . . A .  7 C H41  . . . . . . . . . rr_2l5z 1 
       .  4 .  2738 . 1 1  7 C H42  H -23.959   4.524 41.425 . . . 1.0 . . . . . . . . . . . . A .  7 C H42  . . . . . . . . . rr_2l5z 1 
       .  4 .  2739 . 1 1  7 C H5   H -21.666   3.891 41.058 . . . 1.0 . . . . . . . . . . . . A .  7 C H5   . . . . . . . . . rr_2l5z 1 
       .  4 .  2740 . 1 1  7 C H5'  H -16.453   2.551 41.863 . . . 1.0 . . . . . . . . . . . . A .  7 C H5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2741 . 1 1  7 C H5'' H -16.012   1.025 42.656 . . . 1.0 . . . . . . . . . . . . A .  7 C H5'' . . . . . . . . . rr_2l5z 1 
       .  4 .  2742 . 1 1  7 C H6   H -19.495   3.515 42.106 . . . 1.0 . . . . . . . . . . . . A .  7 C H6   . . . . . . . . . rr_2l5z 1 
       .  4 .  2743 . 1 1  7 C HO2' H -18.352   3.533 47.065 . . . 1.0 . . . . . . . . . . . . A .  7 C HO2' . . . . . . . . . rr_2l5z 1 
       .  4 .  2744 . 1 1  7 C N1   N -20.186   3.989 44.051 . . . 1.0 . . . . . . . . . . . . A .  7 C N1   . . . . . . . . . rr_2l5z 1 
       .  4 .  2745 . 1 1  7 C N3   N -22.457   4.589 44.276 . . . 1.0 . . . . . . . . . . . . A .  7 C N3   . . . . . . . . . rr_2l5z 1 
       .  4 .  2746 . 1 1  7 C N4   N -23.824   4.642 42.418 . . . 1.0 . . . . . . . . . . . . A .  7 C N4   . . . . . . . . . rr_2l5z 1 
       .  4 .  2747 . 1 1  7 C O2   O -21.080   4.524 46.070 . . . 1.0 . . . . . . . . . . . . A .  7 C O2   . . . . . . . . . rr_2l5z 1 
       .  4 .  2748 . 1 1  7 C O2'  O -18.193   2.635 46.761 . . . 1.0 . . . . . . . . . . . . A .  7 C O2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2749 . 1 1  7 C O3'  O -17.479   0.551 45.430 . . . 1.0 . . . . . . . . . . . . A .  7 C O3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2750 . 1 1  7 C O4'  O -17.836   3.619 43.718 . . . 1.0 . . . . . . . . . . . . A .  7 C O4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2751 . 1 1  7 C O5'  O -17.925   1.108 41.892 . . . 1.0 . . . . . . . . . . . . A .  7 C O5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2752 . 1 1  7 C OP1  O -17.058   0.009 39.815 . . . 1.0 . . . . . . . . . . . . A .  7 C OP1  . . . . . . . . . rr_2l5z 1 
       .  4 .  2753 . 1 1  7 C OP2  O -19.457   0.901 39.921 . . . 1.0 . . . . . . . . . . . . A .  7 C OP2  . . . . . . . . . rr_2l5z 1 
       .  4 .  2754 . 1 1  7 C P    P -18.028   1.022 40.288 . . . 1.0 . . . . . . . . . . . . A .  7 C P    . . . . . . . . . rr_2l5z 1 
       .  4 .  2755 . 1 1  8 A C1'  C -23.137   0.237 43.990 . . . 1.0 . . . . . . . . . . . . A .  8 A C1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2756 . 1 1  8 A C2   C -26.418   3.149 43.419 . . . 1.0 . . . . . . . . . . . . A .  8 A C2   . . . . . . . . . rr_2l5z 1 
       .  4 .  2757 . 1 1  8 A C2'  C -21.885   0.549 43.193 . . . 1.0 . . . . . . . . . . . . A .  8 A C2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2758 . 1 1  8 A C3'  C -21.242  -0.822 43.056 . . . 1.0 . . . . . . . . . . . . A .  8 A C3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2759 . 1 1  8 A C4   C -24.665   2.266 44.432 . . . 1.0 . . . . . . . . . . . . A .  8 A C4   . . . . . . . . . rr_2l5z 1 
       .  4 .  2760 . 1 1  8 A C4'  C -21.700  -1.579 44.327 . . . 1.0 . . . . . . . . . . . . A .  8 A C4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2761 . 1 1  8 A C5   C -24.665   3.216 45.428 . . . 1.0 . . . . . . . . . . . . A .  8 A C5   . . . . . . . . . rr_2l5z 1 
       .  4 .  2762 . 1 1  8 A C5'  C -20.572  -1.772 45.356 . . . 1.0 . . . . . . . . . . . . A .  8 A C5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2763 . 1 1  8 A C6   C -25.661   4.196 45.354 . . . 1.0 . . . . . . . . . . . . A .  8 A C6   . . . . . . . . . rr_2l5z 1 
       .  4 .  2764 . 1 1  8 A C8   C -23.070   1.927 45.840 . . . 1.0 . . . . . . . . . . . . A .  8 A C8   . . . . . . . . . rr_2l5z 1 
       .  4 .  2765 . 1 1  8 A H1'  H -23.918  -0.118 43.318 . . . 1.0 . . . . . . . . . . . . A .  8 A H1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2766 . 1 1  8 A H2   H -27.152   3.154 42.613 . . . 1.0 . . . . . . . . . . . . A .  8 A H2   . . . . . . . . . rr_2l5z 1 
       .  4 .  2767 . 1 1  8 A H2'  H -21.233   1.215 43.764 . . . 1.0 . . . . . . . . . . . . A .  8 A H2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2768 . 1 1  8 A H3'  H -20.153  -0.750 42.956 . . . 1.0 . . . . . . . . . . . . A .  8 A H3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2769 . 1 1  8 A H4'  H -22.090  -2.554 44.037 . . . 1.0 . . . . . . . . . . . . A .  8 A H4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2770 . 1 1  8 A H5'  H -21.012  -1.915 46.343 . . . 1.0 . . . . . . . . . . . . A .  8 A H5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2771 . 1 1  8 A H5'' H -19.996  -2.660 45.091 . . . 1.0 . . . . . . . . . . . . A .  8 A H5'' . . . . . . . . . rr_2l5z 1 
       .  4 .  2772 . 1 1  8 A H61  H -26.523   5.862 46.148 . . . 1.0 . . . . . . . . . . . . A .  8 A H61  . . . . . . . . . rr_2l5z 1 
       .  4 .  2773 . 1 1  8 A H62  H -25.143   5.239 47.025 . . . 1.0 . . . . . . . . . . . . A .  8 A H62  . . . . . . . . . rr_2l5z 1 
       .  4 .  2774 . 1 1  8 A H8   H -22.210   1.467 46.304 . . . 1.0 . . . . . . . . . . . . A .  8 A H8   . . . . . . . . . rr_2l5z 1 
       .  4 .  2775 . 1 1  8 A HO2' H -21.505   0.850 41.307 . . . 1.0 . . . . . . . . . . . . A .  8 A HO2' . . . . . . . . . rr_2l5z 1 
       .  4 .  2776 . 1 1  8 A N1   N -26.524   4.125 44.325 . . . 1.0 . . . . . . . . . . . . A .  8 A N1   . . . . . . . . . rr_2l5z 1 
       .  4 .  2777 . 1 1  8 A N3   N -25.516   2.172 43.392 . . . 1.0 . . . . . . . . . . . . A .  8 A N3   . . . . . . . . . rr_2l5z 1 
       .  4 .  2778 . 1 1  8 A N6   N -25.785   5.179 46.248 . . . 1.0 . . . . . . . . . . . . A .  8 A N6   . . . . . . . . . rr_2l5z 1 
       .  4 .  2779 . 1 1  8 A N7   N -23.621   2.985 46.340 . . . 1.0 . . . . . . . . . . . . A .  8 A N7   . . . . . . . . . rr_2l5z 1 
       .  4 .  2780 . 1 1  8 A N9   N -23.616   1.430 44.716 . . . 1.0 . . . . . . . . . . . . A .  8 A N9   . . . . . . . . . rr_2l5z 1 
       .  4 .  2781 . 1 1  8 A O2'  O -22.201   1.111 41.914 . . . 1.0 . . . . . . . . . . . . A .  8 A O2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2782 . 1 1  8 A O3'  O -21.833  -1.469 41.926 . . . 1.0 . . . . . . . . . . . . A .  8 A O3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2783 . 1 1  8 A O4'  O -22.769  -0.807 44.892 . . . 1.0 . . . . . . . . . . . . A .  8 A O4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2784 . 1 1  8 A O5'  O -19.692  -0.645 45.395 . . . 1.0 . . . . . . . . . . . . A .  8 A O5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2785 . 1 1  8 A OP1  O -18.218  -0.787 47.415 . . . 1.0 . . . . . . . . . . . . A .  8 A OP1  . . . . . . . . . rr_2l5z 1 
       .  4 .  2786 . 1 1  8 A OP2  O -17.557  -1.945 45.226 . . . 1.0 . . . . . . . . . . . . A .  8 A OP2  . . . . . . . . . rr_2l5z 1 
       .  4 .  2787 . 1 1  8 A P    P -18.184  -0.807 45.935 . . . 1.0 . . . . . . . . . . . . A .  8 A P    . . . . . . . . . rr_2l5z 1 
       .  4 .  2788 . 1 1  9 G C1'  C -23.688   1.803 39.780 . . . 1.0 . . . . . . . . . . . . A .  9 G C1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2789 . 1 1  9 G C2   C -24.813   6.078 39.702 . . . 1.0 . . . . . . . . . . . . A .  9 G C2   . . . . . . . . . rr_2l5z 1 
       .  4 .  2790 . 1 1  9 G C2'  C -24.982   0.979 39.737 . . . 1.0 . . . . . . . . . . . . A .  9 G C2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2791 . 1 1  9 G C3'  C -24.516  -0.399 39.276 . . . 1.0 . . . . . . . . . . . . A .  9 G C3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2792 . 1 1  9 G C4   C -24.082   4.162 38.828 . . . 1.0 . . . . . . . . . . . . A .  9 G C4   . . . . . . . . . rr_2l5z 1 
       .  4 .  2793 . 1 1  9 G C4'  C -23.067  -0.443 39.741 . . . 1.0 . . . . . . . . . . . . A .  9 G C4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2794 . 1 1  9 G C5   C -23.934   4.679 37.549 . . . 1.0 . . . . . . . . . . . . A .  9 G C5   . . . . . . . . . rr_2l5z 1 
       .  4 .  2795 . 1 1  9 G C5'  C -22.229  -1.430 38.926 . . . 1.0 . . . . . . . . . . . . A .  9 G C5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2796 . 1 1  9 G C6   C -24.257   6.041 37.304 . . . 1.0 . . . . . . . . . . . . A .  9 G C6   . . . . . . . . . rr_2l5z 1 
       .  4 .  2797 . 1 1  9 G C8   C -23.354   2.668 37.453 . . . 1.0 . . . . . . . . . . . . A .  9 G C8   . . . . . . . . . rr_2l5z 1 
       .  4 .  2798 . 1 1  9 G H1   H -24.963   7.677 38.360 . . . 1.0 . . . . . . . . . . . . A .  9 G H1   . . . . . . . . . rr_2l5z 1 
       .  4 .  2799 . 1 1  9 G H1'  H -23.597   2.272 40.760 . . . 1.0 . . . . . . . . . . . . A .  9 G H1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2800 . 1 1  9 G H2'  H -25.671   1.407 39.003 . . . 1.0 . . . . . . . . . . . . A .  9 G H2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2801 . 1 1  9 G H21  H -25.471   7.824 40.517 . . . 1.0 . . . . . . . . . . . . A .  9 G H21  . . . . . . . . . rr_2l5z 1 
       .  4 .  2802 . 1 1  9 G H22  H -25.340   6.478 41.627 . . . 1.0 . . . . . . . . . . . . A .  9 G H22  . . . . . . . . . rr_2l5z 1 
       .  4 .  2803 . 1 1  9 G H3'  H -24.609  -0.522 38.193 . . . 1.0 . . . . . . . . . . . . A .  9 G H3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2804 . 1 1  9 G H4'  H -23.029  -0.716 40.795 . . . 1.0 . . . . . . . . . . . . A .  9 G H4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2805 . 1 1  9 G H5'  H -22.788  -2.358 38.802 . . . 1.0 . . . . . . . . . . . . A .  9 G H5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2806 . 1 1  9 G H5'' H -22.029  -1.001 37.944 . . . 1.0 . . . . . . . . . . . . A .  9 G H5'' . . . . . . . . . rr_2l5z 1 
       .  4 .  2807 . 1 1  9 G H8   H -23.005   1.713 37.091 . . . 1.0 . . . . . . . . . . . . A .  9 G H8   . . . . . . . . . rr_2l5z 1 
       .  4 .  2808 . 1 1  9 G HO2' H -26.364   1.490 41.010 . . . 1.0 . . . . . . . . . . . . A .  9 G HO2' . . . . . . . . . rr_2l5z 1 
       .  4 .  2809 . 1 1  9 G N1   N -24.698   6.676 38.461 . . . 1.0 . . . . . . . . . . . . A .  9 G N1   . . . . . . . . . rr_2l5z 1 
       .  4 .  2810 . 1 1  9 G N2   N -25.242   6.856 40.696 . . . 1.0 . . . . . . . . . . . . A .  9 G N2   . . . . . . . . . rr_2l5z 1 
       .  4 .  2811 . 1 1  9 G N3   N -24.512   4.798 39.940 . . . 1.0 . . . . . . . . . . . . A .  9 G N3   . . . . . . . . . rr_2l5z 1 
       .  4 .  2812 . 1 1  9 G N7   N -23.459   3.691 36.669 . . . 1.0 . . . . . . . . . . . . A .  9 G N7   . . . . . . . . . rr_2l5z 1 
       .  4 .  2813 . 1 1  9 G N9   N -23.699   2.850 38.741 . . . 1.0 . . . . . . . . . . . . A .  9 G N9   . . . . . . . . . rr_2l5z 1 
       .  4 .  2814 . 1 1  9 G O2'  O -25.598   0.912 41.028 . . . 1.0 . . . . . . . . . . . . A .  9 G O2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2815 . 1 1  9 G O3'  O -25.255  -1.389 39.998 . . . 1.0 . . . . . . . . . . . . A .  9 G O3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2816 . 1 1  9 G O4'  O -22.597   0.892 39.588 . . . 1.0 . . . . . . . . . . . . A .  9 G O4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2817 . 1 1  9 G O5'  O -20.986  -1.720 39.571 . . . 1.0 . . . . . . . . . . . . A .  9 G O5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2818 . 1 1  9 G O6   O -24.189   6.664 36.247 . . . 1.0 . . . . . . . . . . . . A .  9 G O6   . . . . . . . . . rr_2l5z 1 
       .  4 .  2819 . 1 1  9 G OP1  O -21.694  -3.739 40.872 . . . 1.0 . . . . . . . . . . . . A .  9 G OP1  . . . . . . . . . rr_2l5z 1 
       .  4 .  2820 . 1 1  9 G OP2  O -19.569  -2.454 41.502 . . . 1.0 . . . . . . . . . . . . A .  9 G OP2  . . . . . . . . . rr_2l5z 1 
       .  4 .  2821 . 1 1  9 G P    P -20.961  -2.459 41.001 . . . 1.0 . . . . . . . . . . . . A .  9 G P    . . . . . . . . . rr_2l5z 1 
       .  4 .  2822 . 1 1 10 C C1'  C -28.978   2.394 40.571 . . . 1.0 . . . . . . . . . . . . A . 10 C C1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2823 . 1 1 10 C C2   C -29.791   3.408 38.480 . . . 1.0 . . . . . . . . . . . . A . 10 C C2   . . . . . . . . . rr_2l5z 1 
       .  4 .  2824 . 1 1 10 C C2'  C -30.275   1.875 41.187 . . . 1.0 . . . . . . . . . . . . A . 10 C C2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2825 . 1 1 10 C C3'  C -29.962   0.408 41.406 . . . 1.0 . . . . . . . . . . . . A . 10 C C3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2826 . 1 1 10 C C4   C -29.260   2.477 36.390 . . . 1.0 . . . . . . . . . . . . A . 10 C C4   . . . . . . . . . rr_2l5z 1 
       .  4 .  2827 . 1 1 10 C C4'  C -28.482   0.436 41.771 . . . 1.0 . . . . . . . . . . . . A . 10 C C4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2828 . 1 1 10 C C5   C -28.510   1.430 37.012 . . . 1.0 . . . . . . . . . . . . A . 10 C C5   . . . . . . . . . rr_2l5z 1 
       .  4 .  2829 . 1 1 10 C C5'  C -27.781  -0.883 41.436 . . . 1.0 . . . . . . . . . . . . A . 10 C C5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2830 . 1 1 10 C C6   C -28.437   1.425 38.358 . . . 1.0 . . . . . . . . . . . . A . 10 C C6   . . . . . . . . . rr_2l5z 1 
       .  4 .  2831 . 1 1 10 C H1'  H -28.780   3.408 40.928 . . . 1.0 . . . . . . . . . . . . A . 10 C H1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2832 . 1 1 10 C H2'  H -31.097   1.983 40.475 . . . 1.0 . . . . . . . . . . . . A . 10 C H2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2833 . 1 1 10 C H3'  H -30.165  -0.187 40.512 . . . 1.0 . . . . . . . . . . . . A . 10 C H3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2834 . 1 1 10 C H4'  H -28.374   0.643 42.834 . . . 1.0 . . . . . . . . . . . . A . 10 C H4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2835 . 1 1 10 C H41  H -29.880   3.264 34.619 . . . 1.0 . . . . . . . . . . . . A . 10 C H41  . . . . . . . . . rr_2l5z 1 
       .  4 .  2836 . 1 1 10 C H42  H -28.894   1.824 34.498 . . . 1.0 . . . . . . . . . . . . A . 10 C H42  . . . . . . . . . rr_2l5z 1 
       .  4 .  2837 . 1 1 10 C H5   H -28.020   0.669 36.424 . . . 1.0 . . . . . . . . . . . . A . 10 C H5   . . . . . . . . . rr_2l5z 1 
       .  4 .  2838 . 1 1 10 C H5'  H -26.756  -0.845 41.807 . . . 1.0 . . . . . . . . . . . . A . 10 C H5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2839 . 1 1 10 C H5'' H -28.307  -1.700 41.929 . . . 1.0 . . . . . . . . . . . . A . 10 C H5'' . . . . . . . . . rr_2l5z 1 
       .  4 .  2840 . 1 1 10 C H6   H -27.886   0.644 38.861 . . . 1.0 . . . . . . . . . . . . A . 10 C H6   . . . . . . . . . rr_2l5z 1 
       .  4 .  2841 . 1 1 10 C HO2' H -30.923   1.879 43.023 . . . 1.0 . . . . . . . . . . . . A . 10 C HO2' . . . . . . . . . rr_2l5z 1 
       .  4 .  2842 . 1 1 10 C N1   N -29.062   2.393 39.091 . . . 1.0 . . . . . . . . . . . . A . 10 C N1   . . . . . . . . . rr_2l5z 1 
       .  4 .  2843 . 1 1 10 C N3   N -29.868   3.419 37.122 . . . 1.0 . . . . . . . . . . . . A . 10 C N3   . . . . . . . . . rr_2l5z 1 
       .  4 .  2844 . 1 1 10 C N4   N -29.352   2.525 35.061 . . . 1.0 . . . . . . . . . . . . A . 10 C N4   . . . . . . . . . rr_2l5z 1 
       .  4 .  2845 . 1 1 10 C O2   O -30.347   4.269 39.162 . . . 1.0 . . . . . . . . . . . . A . 10 C O2   . . . . . . . . . rr_2l5z 1 
       .  4 .  2846 . 1 1 10 C O2'  O -30.574   2.539 42.421 . . . 1.0 . . . . . . . . . . . . A . 10 C O2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2847 . 1 1 10 C O3'  O -30.703  -0.049 42.542 . . . 1.0 . . . . . . . . . . . . A . 10 C O3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2848 . 1 1 10 C O4'  O -27.928   1.522 41.024 . . . 1.0 . . . . . . . . . . . . A . 10 C O4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2849 . 1 1 10 C O5'  O -27.757  -1.126 40.027 . . . 1.0 . . . . . . . . . . . . A . 10 C O5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2850 . 1 1 10 C OP1  O -26.734  -3.408 39.891 . . . 1.0 . . . . . . . . . . . . A . 10 C OP1  . . . . . . . . . rr_2l5z 1 
       .  4 .  2851 . 1 1 10 C OP2  O -26.585  -1.786 37.913 . . . 1.0 . . . . . . . . . . . . A . 10 C OP2  . . . . . . . . . rr_2l5z 1 
       .  4 .  2852 . 1 1 10 C P    P -26.594  -2.028 39.373 . . . 1.0 . . . . . . . . . . . . A . 10 C P    . . . . . . . . . rr_2l5z 1 
       .  4 .  2853 . 1 1 11 A C1'  C -35.460   2.619 40.205 . . . 1.0 . . . . . . . . . . . . A . 11 A C1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2854 . 1 1 11 A C2   C -35.391   4.156 36.052 . . . 1.0 . . . . . . . . . . . . A . 11 A C2   . . . . . . . . . rr_2l5z 1 
       .  4 .  2855 . 1 1 11 A C2'  C -36.542   1.571 40.451 . . . 1.0 . . . . . . . . . . . . A . 11 A C2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2856 . 1 1 11 A C3'  C -35.866   0.625 41.425 . . . 1.0 . . . . . . . . . . . . A . 11 A C3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2857 . 1 1 11 A C4   C -34.766   2.863 37.733 . . . 1.0 . . . . . . . . . . . . A . 11 A C4   . . . . . . . . . rr_2l5z 1 
       .  4 .  2858 . 1 1 11 A C4'  C -35.002   1.569 42.257 . . . 1.0 . . . . . . . . . . . . A . 11 A C4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2859 . 1 1 11 A C5   C -33.836   2.193 36.971 . . . 1.0 . . . . . . . . . . . . A . 11 A C5   . . . . . . . . . rr_2l5z 1 
       .  4 .  2860 . 1 1 11 A C5'  C -33.787   0.857 42.856 . . . 1.0 . . . . . . . . . . . . A . 11 A C5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2861 . 1 1 11 A C6   C -33.724   2.587 35.633 . . . 1.0 . . . . . . . . . . . . A . 11 A C6   . . . . . . . . . rr_2l5z 1 
       .  4 .  2862 . 1 1 11 A C8   C -33.741   1.362 38.888 . . . 1.0 . . . . . . . . . . . . A . 11 A C8   . . . . . . . . . rr_2l5z 1 
       .  4 .  2863 . 1 1 11 A H1'  H -35.923   3.600 40.100 . . . 1.0 . . . . . . . . . . . . A . 11 A H1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2864 . 1 1 11 A H2   H -35.998   4.965 35.646 . . . 1.0 . . . . . . . . . . . . A . 11 A H2   . . . . . . . . . rr_2l5z 1 
       .  4 .  2865 . 1 1 11 A H2'  H -36.775   1.048 39.521 . . . 1.0 . . . . . . . . . . . . A . 11 A H2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2866 . 1 1 11 A H3'  H -35.278  -0.136 40.906 . . . 1.0 . . . . . . . . . . . . A . 11 A H3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2867 . 1 1 11 A H4'  H -35.602   1.996 43.059 . . . 1.0 . . . . . . . . . . . . A . 11 A H4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2868 . 1 1 11 A H5'  H -33.083   1.604 43.224 . . . 1.0 . . . . . . . . . . . . A . 11 A H5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2869 . 1 1 11 A H5'' H -34.115   0.237 43.691 . . . 1.0 . . . . . . . . . . . . A . 11 A H5'' . . . . . . . . . rr_2l5z 1 
       .  4 .  2870 . 1 1 11 A H61  H -32.822   2.348 33.825 . . . 1.0 . . . . . . . . . . . . A . 11 A H61  . . . . . . . . . rr_2l5z 1 
       .  4 .  2871 . 1 1 11 A H62  H -32.259   1.281 35.093 . . . 1.0 . . . . . . . . . . . . A . 11 A H62  . . . . . . . . . rr_2l5z 1 
       .  4 .  2872 . 1 1 11 A H8   H -33.451   0.762 39.738 . . . 1.0 . . . . . . . . . . . . A . 11 A H8   . . . . . . . . . rr_2l5z 1 
       .  4 .  2873 . 1 1 11 A HO2' H -37.435   2.732 41.734 . . . 1.0 . . . . . . . . . . . . A . 11 A HO2' . . . . . . . . . rr_2l5z 1 
       .  4 .  2874 . 1 1 11 A N1   N -34.526   3.582 35.209 . . . 1.0 . . . . . . . . . . . . A . 11 A N1   . . . . . . . . . rr_2l5z 1 
       .  4 .  2875 . 1 1 11 A N3   N -35.581   3.860 37.335 . . . 1.0 . . . . . . . . . . . . A . 11 A N3   . . . . . . . . . rr_2l5z 1 
       .  4 .  2876 . 1 1 11 A N6   N -32.866   2.027 34.782 . . . 1.0 . . . . . . . . . . . . A . 11 A N6   . . . . . . . . . rr_2l5z 1 
       .  4 .  2877 . 1 1 11 A N7   N -33.175   1.216 37.735 . . . 1.0 . . . . . . . . . . . . A . 11 A N7   . . . . . . . . . rr_2l5z 1 
       .  4 .  2878 . 1 1 11 A N9   N -34.692   2.307 38.984 . . . 1.0 . . . . . . . . . . . . A . 11 A N9   . . . . . . . . . rr_2l5z 1 
       .  4 .  2879 . 1 1 11 A O2'  O -37.719   2.156 41.020 . . . 1.0 . . . . . . . . . . . . A . 11 A O2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2880 . 1 1 11 A O3'  O -36.866   0.054 42.275 . . . 1.0 . . . . . . . . . . . . A . 11 A O3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2881 . 1 1 11 A O4'  O -34.606   2.614 41.363 . . . 1.0 . . . . . . . . . . . . A . 11 A O4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2882 . 1 1 11 A O5'  O -33.131   0.031 41.893 . . . 1.0 . . . . . . . . . . . . A . 11 A O5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2883 . 1 1 11 A OP1  O -32.358  -1.551 43.673 . . . 1.0 . . . . . . . . . . . . A . 11 A OP1  . . . . . . . . . rr_2l5z 1 
       .  4 .  2884 . 1 1 11 A OP2  O -31.714  -1.923 41.221 . . . 1.0 . . . . . . . . . . . . A . 11 A OP2  . . . . . . . . . rr_2l5z 1 
       .  4 .  2885 . 1 1 11 A P    P -31.985  -1.004 42.349 . . . 1.0 . . . . . . . . . . . . A . 11 A P    . . . . . . . . . rr_2l5z 1 
       .  4 .  2886 . 1 1 12 C C1'  C -39.283   0.252 37.218 . . . 1.0 . . . . . . . . . . . . A . 12 C C1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2887 . 1 1 12 C C2   C -37.974   0.175 35.119 . . . 1.0 . . . . . . . . . . . . A . 12 C C2   . . . . . . . . . rr_2l5z 1 
       .  4 .  2888 . 1 1 12 C C2'  C -40.344  -0.844 37.038 . . . 1.0 . . . . . . . . . . . . A . 12 C C2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2889 . 1 1 12 C C3'  C -40.496  -1.432 38.439 . . . 1.0 . . . . . . . . . . . . A . 12 C C3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2890 . 1 1 12 C C4   C -35.788  -0.686 35.084 . . . 1.0 . . . . . . . . . . . . A . 12 C C4   . . . . . . . . . rr_2l5z 1 
       .  4 .  2891 . 1 1 12 C C4'  C -40.075  -0.282 39.338 . . . 1.0 . . . . . . . . . . . . A . 12 C C4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2892 . 1 1 12 C C5   C -35.844  -0.966 36.485 . . . 1.0 . . . . . . . . . . . . A . 12 C C5   . . . . . . . . . rr_2l5z 1 
       .  4 .  2893 . 1 1 12 C C5'  C -39.601  -0.759 40.714 . . . 1.0 . . . . . . . . . . . . A . 12 C C5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2894 . 1 1 12 C C6   C -36.979  -0.657 37.144 . . . 1.0 . . . . . . . . . . . . A . 12 C C6   . . . . . . . . . rr_2l5z 1 
       .  4 .  2895 . 1 1 12 C H1'  H -39.679   1.205 36.859 . . . 1.0 . . . . . . . . . . . . A . 12 C H1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2896 . 1 1 12 C H2'  H -39.974  -1.609 36.348 . . . 1.0 . . . . . . . . . . . . A . 12 C H2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2897 . 1 1 12 C H3'  H -39.872  -2.317 38.583 . . . 1.0 . . . . . . . . . . . . A . 12 C H3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2898 . 1 1 12 C H4'  H -40.906   0.410 39.456 . . . 1.0 . . . . . . . . . . . . A . 12 C H4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2899 . 1 1 12 C H41  H -34.639  -0.780 33.407 . . . 1.0 . . . . . . . . . . . . A . 12 C H41  . . . . . . . . . rr_2l5z 1 
       .  4 .  2900 . 1 1 12 C H42  H -33.892  -1.391 34.865 . . . 1.0 . . . . . . . . . . . . A . 12 C H42  . . . . . . . . . rr_2l5z 1 
       .  4 .  2901 . 1 1 12 C H5   H -35.004  -1.410 36.999 . . . 1.0 . . . . . . . . . . . . A . 12 C H5   . . . . . . . . . rr_2l5z 1 
       .  4 .  2902 . 1 1 12 C H5'  H -39.631   0.081 41.407 . . . 1.0 . . . . . . . . . . . . A . 12 C H5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2903 . 1 1 12 C H5'' H -40.267  -1.542 41.079 . . . 1.0 . . . . . . . . . . . . A . 12 C H5'' . . . . . . . . . rr_2l5z 1 
       .  4 .  2904 . 1 1 12 C H6   H -37.060  -0.872 38.200 . . . 1.0 . . . . . . . . . . . . A . 12 C H6   . . . . . . . . . rr_2l5z 1 
       .  4 .  2905 . 1 1 12 C HO2' H -41.630   0.609 36.883 . . . 1.0 . . . . . . . . . . . . A . 12 C HO2' . . . . . . . . . rr_2l5z 1 
       .  4 .  2906 . 1 1 12 C N1   N -38.034  -0.093 36.486 . . . 1.0 . . . . . . . . . . . . A . 12 C N1   . . . . . . . . . rr_2l5z 1 
       .  4 .  2907 . 1 1 12 C N3   N -36.831  -0.136 34.449 . . . 1.0 . . . . . . . . . . . . A . 12 C N3   . . . . . . . . . rr_2l5z 1 
       .  4 .  2908 . 1 1 12 C N4   N -34.684  -0.976 34.396 . . . 1.0 . . . . . . . . . . . . A . 12 C N4   . . . . . . . . . rr_2l5z 1 
       .  4 .  2909 . 1 1 12 C O2   O -38.936   0.684 34.546 . . . 1.0 . . . . . . . . . . . . A . 12 C O2   . . . . . . . . . rr_2l5z 1 
       .  4 .  2910 . 1 1 12 C O2'  O -41.581  -0.297 36.568 . . . 1.0 . . . . . . . . . . . . A . 12 C O2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2911 . 1 1 12 C O3'  O -41.881  -1.701 38.670 . . . 1.0 . . . . . . . . . . . . A . 12 C O3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2912 . 1 1 12 C O4'  O -39.031   0.363 38.626 . . . 1.0 . . . . . . . . . . . . A . 12 C O4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2913 . 1 1 12 C O5'  O -38.266  -1.268 40.660 . . . 1.0 . . . . . . . . . . . . A . 12 C O5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2914 . 1 1 12 C OP1  O -38.330  -1.801 43.107 . . . 1.0 . . . . . . . . . . . . A . 12 C OP1  . . . . . . . . . rr_2l5z 1 
       .  4 .  2915 . 1 1 12 C OP2  O -36.242  -2.305 41.709 . . . 1.0 . . . . . . . . . . . . A . 12 C OP2  . . . . . . . . . rr_2l5z 1 
       .  4 .  2916 . 1 1 12 C P    P -37.405  -1.440 42.009 . . . 1.0 . . . . . . . . . . . . A . 12 C P    . . . . . . . . . rr_2l5z 1 
       .  4 .  2917 . 1 1 13 G C1'  C -39.733  -3.396 33.380 . . . 1.0 . . . . . . . . . . . . A . 13 G C1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2918 . 1 1 13 G C2   C -36.218  -3.082 30.704 . . . 1.0 . . . . . . . . . . . . A . 13 G C2   . . . . . . . . . rr_2l5z 1 
       .  4 .  2919 . 1 1 13 G C2'  C -40.165  -4.784 32.897 . . . 1.0 . . . . . . . . . . . . A . 13 G C2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2920 . 1 1 13 G C3'  C -40.837  -5.385 34.122 . . . 1.0 . . . . . . . . . . . . A . 13 G C3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2921 . 1 1 13 G C4   C -37.260  -3.252 32.669 . . . 1.0 . . . . . . . . . . . . A . 13 G C4   . . . . . . . . . rr_2l5z 1 
       .  4 .  2922 . 1 1 13 G C4'  C -41.395  -4.162 34.835 . . . 1.0 . . . . . . . . . . . . A . 13 G C4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2923 . 1 1 13 G C5   C -36.086  -3.267 33.408 . . . 1.0 . . . . . . . . . . . . A . 13 G C5   . . . . . . . . . rr_2l5z 1 
       .  4 .  2924 . 1 1 13 G C5'  C -41.599  -4.410 36.332 . . . 1.0 . . . . . . . . . . . . A . 13 G C5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2925 . 1 1 13 G C6   C -34.836  -3.182 32.738 . . . 1.0 . . . . . . . . . . . . A . 13 G C6   . . . . . . . . . rr_2l5z 1 
       .  4 .  2926 . 1 1 13 G C8   C -37.659  -3.411 34.782 . . . 1.0 . . . . . . . . . . . . A . 13 G C8   . . . . . . . . . rr_2l5z 1 
       .  4 .  2927 . 1 1 13 G H1   H -34.130  -3.026 30.799 . . . 1.0 . . . . . . . . . . . . A . 13 G H1   . . . . . . . . . rr_2l5z 1 
       .  4 .  2928 . 1 1 13 G H1'  H -40.018  -2.653 32.636 . . . 1.0 . . . . . . . . . . . . A . 13 G H1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2929 . 1 1 13 G H2'  H -39.287  -5.374 32.624 . . . 1.0 . . . . . . . . . . . . A . 13 G H2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2930 . 1 1 13 G H21  H -35.278  -2.927 28.906 . . . 1.0 . . . . . . . . . . . . A . 13 G H21  . . . . . . . . . rr_2l5z 1 
       .  4 .  2931 . 1 1 13 G H22  H -37.025  -2.974 28.838 . . . 1.0 . . . . . . . . . . . . A . 13 G H22  . . . . . . . . . rr_2l5z 1 
       .  4 .  2932 . 1 1 13 G H3'  H -40.130  -5.941 34.742 . . . 1.0 . . . . . . . . . . . . A . 13 G H3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2933 . 1 1 13 G H4'  H -42.343  -3.876 34.381 . . . 1.0 . . . . . . . . . . . . A . 13 G H4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2934 . 1 1 13 G H5'  H -42.061  -5.386 36.476 . . . 1.0 . . . . . . . . . . . . A . 13 G H5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2935 . 1 1 13 G H5'' H -40.629  -4.399 36.830 . . . 1.0 . . . . . . . . . . . . A . 13 G H5'' . . . . . . . . . rr_2l5z 1 
       .  4 .  2936 . 1 1 13 G H8   H -38.220  -3.492 35.702 . . . 1.0 . . . . . . . . . . . . A . 13 G H8   . . . . . . . . . rr_2l5z 1 
       .  4 .  2937 . 1 1 13 G HO2' H -40.849  -5.390 31.177 . . . 1.0 . . . . . . . . . . . . A . 13 G HO2' . . . . . . . . . rr_2l5z 1 
       .  4 .  2938 . 1 1 13 G N1   N -35.003  -3.091 31.361 . . . 1.0 . . . . . . . . . . . . A . 13 G N1   . . . . . . . . . rr_2l5z 1 
       .  4 .  2939 . 1 1 13 G N2   N -36.171  -2.987 29.375 . . . 1.0 . . . . . . . . . . . . A . 13 G N2   . . . . . . . . . rr_2l5z 1 
       .  4 .  2940 . 1 1 13 G N3   N -37.399  -3.162 31.327 . . . 1.0 . . . . . . . . . . . . A . 13 G N3   . . . . . . . . . rr_2l5z 1 
       .  4 .  2941 . 1 1 13 G N7   N -36.367  -3.372 34.782 . . . 1.0 . . . . . . . . . . . . A . 13 G N7   . . . . . . . . . rr_2l5z 1 
       .  4 .  2942 . 1 1 13 G N9   N -38.273  -3.347 33.587 . . . 1.0 . . . . . . . . . . . . A . 13 G N9   . . . . . . . . . rr_2l5z 1 
       .  4 .  2943 . 1 1 13 G O2'  O -41.077  -4.692 31.796 . . . 1.0 . . . . . . . . . . . . A . 13 G O2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2944 . 1 1 13 G O3'  O -41.932  -6.196 33.686 . . . 1.0 . . . . . . . . . . . . A . 13 G O3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2945 . 1 1 13 G O4'  O -40.438  -3.133 34.605 . . . 1.0 . . . . . . . . . . . . A . 13 G O4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2946 . 1 1 13 G O5'  O -42.435  -3.410 36.917 . . . 1.0 . . . . . . . . . . . . A . 13 G O5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2947 . 1 1 13 G O6   O -33.708  -3.182 33.224 . . . 1.0 . . . . . . . . . . . . A . 13 G O6   . . . . . . . . . rr_2l5z 1 
       .  4 .  2948 . 1 1 13 G OP1  O -43.869  -3.197 38.960 . . . 1.0 . . . . . . . . . . . . A . 13 G OP1  . . . . . . . . . rr_2l5z 1 
       .  4 .  2949 . 1 1 13 G OP2  O -41.490  -4.134 39.121 . . . 1.0 . . . . . . . . . . . . A . 13 G OP2  . . . . . . . . . rr_2l5z 1 
       .  4 .  2950 . 1 1 13 G P    P -42.459  -3.195 38.512 . . . 1.0 . . . . . . . . . . . . A . 13 G P    . . . . . . . . . rr_2l5z 1 
       .  4 .  2951 . 1 1 14 A C1'  C -42.162  -9.048 28.545 . . . 1.0 . . . . . . . . . . . . A . 14 A C1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2952 . 1 1 14 A C2   C -43.934  -6.233 25.631 . . . 1.0 . . . . . . . . . . . . A . 14 A C2   . . . . . . . . . rr_2l5z 1 
       .  4 .  2953 . 1 1 14 A C2'  C -40.770  -8.504 28.228 . . . 1.0 . . . . . . . . . . . . A . 14 A C2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2954 . 1 1 14 A C3'  C -40.130  -8.410 29.602 . . . 1.0 . . . . . . . . . . . . A . 14 A C3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2955 . 1 1 14 A C4   C -43.627  -7.139 27.622 . . . 1.0 . . . . . . . . . . . . A . 14 A C4   . . . . . . . . . rr_2l5z 1 
       .  4 .  2956 . 1 1 14 A C4'  C -40.752  -9.590 30.345 . . . 1.0 . . . . . . . . . . . . A . 14 A C4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2957 . 1 1 14 A C5   C -44.529  -6.296 28.230 . . . 1.0 . . . . . . . . . . . . A . 14 A C5   . . . . . . . . . rr_2l5z 1 
       .  4 .  2958 . 1 1 14 A C5'  C -40.793  -9.360 31.857 . . . 1.0 . . . . . . . . . . . . A . 14 A C5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2959 . 1 1 14 A C6   C -45.158  -5.357 27.406 . . . 1.0 . . . . . . . . . . . . A . 14 A C6   . . . . . . . . . rr_2l5z 1 
       .  4 .  2960 . 1 1 14 A C8   C -43.787  -7.553 29.730 . . . 1.0 . . . . . . . . . . . . A . 14 A C8   . . . . . . . . . rr_2l5z 1 
       .  4 .  2961 . 1 1 14 A H1'  H -42.458  -9.754 27.769 . . . 1.0 . . . . . . . . . . . . A . 14 A H1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2962 . 1 1 14 A H2   H -43.714  -6.175 24.565 . . . 1.0 . . . . . . . . . . . . A . 14 A H2   . . . . . . . . . rr_2l5z 1 
       .  4 .  2963 . 1 1 14 A H2'  H -40.849  -7.510 27.783 . . . 1.0 . . . . . . . . . . . . A . 14 A H2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2964 . 1 1 14 A H3'  H -40.341  -7.449 30.079 . . . 1.0 . . . . . . . . . . . . A . 14 A H3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2965 . 1 1 14 A H4'  H -40.179 -10.491 30.133 . . . 1.0 . . . . . . . . . . . . A . 14 A H4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2966 . 1 1 14 A H5'  H -41.275 -10.213 32.334 . . . 1.0 . . . . . . . . . . . . A . 14 A H5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2967 . 1 1 14 A H5'' H -39.774  -9.272 32.232 . . . 1.0 . . . . . . . . . . . . A . 14 A H5'' . . . . . . . . . rr_2l5z 1 
       .  4 .  2968 . 1 1 14 A H61  H -46.478  -3.819 27.215 . . . 1.0 . . . . . . . . . . . . A . 14 A H61  . . . . . . . . . rr_2l5z 1 
       .  4 .  2969 . 1 1 14 A H62  H -46.307  -4.468 28.831 . . . 1.0 . . . . . . . . . . . . A . 14 A H62  . . . . . . . . . rr_2l5z 1 
       .  4 .  2970 . 1 1 14 A H8   H -43.609  -8.024 30.686 . . . 1.0 . . . . . . . . . . . . A . 14 A H8   . . . . . . . . . rr_2l5z 1 
       .  4 .  2971 . 1 1 14 A HO2' H -39.372  -9.822 27.909 . . . 1.0 . . . . . . . . . . . . A . 14 A HO2' . . . . . . . . . rr_2l5z 1 
       .  4 .  2972 . 1 1 14 A N1   N -44.828  -5.360 26.101 . . . 1.0 . . . . . . . . . . . . A . 14 A N1   . . . . . . . . . rr_2l5z 1 
       .  4 .  2973 . 1 1 14 A N3   N -43.280  -7.163 26.320 . . . 1.0 . . . . . . . . . . . . A . 14 A N3   . . . . . . . . . rr_2l5z 1 
       .  4 .  2974 . 1 1 14 A N6   N -46.053  -4.477 27.853 . . . 1.0 . . . . . . . . . . . . A . 14 A N6   . . . . . . . . . rr_2l5z 1 
       .  4 .  2975 . 1 1 14 A N7   N -44.625  -6.575 29.604 . . . 1.0 . . . . . . . . . . . . A . 14 A N7   . . . . . . . . . rr_2l5z 1 
       .  4 .  2976 . 1 1 14 A N9   N -43.150  -7.955 28.614 . . . 1.0 . . . . . . . . . . . . A . 14 A N9   . . . . . . . . . rr_2l5z 1 
       .  4 .  2977 . 1 1 14 A O2'  O -40.042  -9.392 27.372 . . . 1.0 . . . . . . . . . . . . A . 14 A O2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2978 . 1 1 14 A O3'  O -38.726  -8.649 29.463 . . . 1.0 . . . . . . . . . . . . A . 14 A O3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2979 . 1 1 14 A O4'  O -42.066  -9.735 29.805 . . . 1.0 . . . . . . . . . . . . A . 14 A O4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2980 . 1 1 14 A O5'  O -41.517  -8.171 32.188 . . . 1.0 . . . . . . . . . . . . A . 14 A O5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2981 . 1 1 14 A OP1  O -43.157  -8.346 34.073 . . . 1.0 . . . . . . . . . . . . A . 14 A OP1  . . . . . . . . . rr_2l5z 1 
       .  4 .  2982 . 1 1 14 A OP2  O -40.643  -8.169 34.536 . . . 1.0 . . . . . . . . . . . . A . 14 A OP2  . . . . . . . . . rr_2l5z 1 
       .  4 .  2983 . 1 1 14 A P    P -41.825  -7.802 33.724 . . . 1.0 . . . . . . . . . . . . A . 14 A P    . . . . . . . . . rr_2l5z 1 
       .  4 .  2984 . 1 1 15 A C1'  C -40.704  -5.061 26.135 . . . 1.0 . . . . . . . . . . . . A . 15 A C1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2985 . 1 1 15 A C2   C -43.356  -1.530 26.393 . . . 1.0 . . . . . . . . . . . . A . 15 A C2   . . . . . . . . . rr_2l5z 1 
       .  4 .  2986 . 1 1 15 A C2'  C -39.609  -4.213 25.476 . . . 1.0 . . . . . . . . . . . . A . 15 A C2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2987 . 1 1 15 A C3'  C -38.316  -4.911 25.889 . . . 1.0 . . . . . . . . . . . . A . 15 A C3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2988 . 1 1 15 A C4   C -42.176  -3.223 27.182 . . . 1.0 . . . . . . . . . . . . A . 15 A C4   . . . . . . . . . rr_2l5z 1 
       .  4 .  2989 . 1 1 15 A C4'  C -38.759  -6.352 26.113 . . . 1.0 . . . . . . . . . . . . A . 15 A C4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2990 . 1 1 15 A C5   C -42.522  -2.956 28.487 . . . 1.0 . . . . . . . . . . . . A . 15 A C5   . . . . . . . . . rr_2l5z 1 
       .  4 .  2991 . 1 1 15 A C5'  C -37.835  -7.094 27.082 . . . 1.0 . . . . . . . . . . . . A . 15 A C5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2992 . 1 1 15 A C6   C -43.368  -1.861 28.696 . . . 1.0 . . . . . . . . . . . . A . 15 A C6   . . . . . . . . . rr_2l5z 1 
       .  4 .  2993 . 1 1 15 A C8   C -41.266  -4.628 28.538 . . . 1.0 . . . . . . . . . . . . A . 15 A C8   . . . . . . . . . rr_2l5z 1 
       .  4 .  2994 . 1 1 15 A H1'  H -41.451  -5.324 25.387 . . . 1.0 . . . . . . . . . . . . A . 15 A H1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2995 . 1 1 15 A H2   H -43.701  -0.912 25.564 . . . 1.0 . . . . . . . . . . . . A . 15 A H2   . . . . . . . . . rr_2l5z 1 
       .  4 .  2996 . 1 1 15 A H2'  H -39.633  -3.196 25.880 . . . 1.0 . . . . . . . . . . . . A . 15 A H2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2997 . 1 1 15 A H3'  H -37.878  -4.461 26.785 . . . 1.0 . . . . . . . . . . . . A . 15 A H3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2998 . 1 1 15 A H4'  H -38.781  -6.878 25.159 . . . 1.0 . . . . . . . . . . . . A . 15 A H4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  2999 . 1 1 15 A H5'  H -38.137  -8.140 27.130 . . . 1.0 . . . . . . . . . . . . A . 15 A H5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3000 . 1 1 15 A H5'' H -36.811  -7.035 26.714 . . . 1.0 . . . . . . . . . . . . A . 15 A H5'' . . . . . . . . . rr_2l5z 1 
       .  4 .  3001 . 1 1 15 A H61  H -44.398  -0.686 30.001 . . . 1.0 . . . . . . . . . . . . A . 15 A H61  . . . . . . . . . rr_2l5z 1 
       .  4 .  3002 . 1 1 15 A H62  H -43.494  -1.997 30.724 . . . 1.0 . . . . . . . . . . . . A . 15 A H62  . . . . . . . . . rr_2l5z 1 
       .  4 .  3003 . 1 1 15 A H8   H -40.652  -5.446 28.886 . . . 1.0 . . . . . . . . . . . . A . 15 A H8   . . . . . . . . . rr_2l5z 1 
       .  4 .  3004 . 1 1 15 A HO2' H -39.879  -5.103 23.766 . . . 1.0 . . . . . . . . . . . . A . 15 A HO2' . . . . . . . . . rr_2l5z 1 
       .  4 .  3005 . 1 1 15 A N1   N -43.765  -1.170 27.612 . . . 1.0 . . . . . . . . . . . . A . 15 A N1   . . . . . . . . . rr_2l5z 1 
       .  4 .  3006 . 1 1 15 A N3   N -42.559  -2.548 26.080 . . . 1.0 . . . . . . . . . . . . A . 15 A N3   . . . . . . . . . rr_2l5z 1 
       .  4 .  3007 . 1 1 15 A N6   N -43.787  -1.485 29.904 . . . 1.0 . . . . . . . . . . . . A . 15 A N6   . . . . . . . . . rr_2l5z 1 
       .  4 .  3008 . 1 1 15 A N7   N -41.923  -3.879 29.361 . . . 1.0 . . . . . . . . . . . . A . 15 A N7   . . . . . . . . . rr_2l5z 1 
       .  4 .  3009 . 1 1 15 A N9   N -41.356  -4.321 27.232 . . . 1.0 . . . . . . . . . . . . A . 15 A N9   . . . . . . . . . rr_2l5z 1 
       .  4 .  3010 . 1 1 15 A O2'  O -39.755  -4.195 24.053 . . . 1.0 . . . . . . . . . . . . A . 15 A O2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3011 . 1 1 15 A O3'  O -37.418  -4.885 24.776 . . . 1.0 . . . . . . . . . . . . A . 15 A O3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3012 . 1 1 15 A O4'  O -40.083  -6.258 26.626 . . . 1.0 . . . . . . . . . . . . A . 15 A O4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3013 . 1 1 15 A O5'  O -37.892  -6.532 28.396 . . . 1.0 . . . . . . . . . . . . A . 15 A O5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3014 . 1 1 15 A OP1  O -36.304  -8.030 29.624 . . . 1.0 . . . . . . . . . . . . A . 15 A OP1  . . . . . . . . . rr_2l5z 1 
       .  4 .  3015 . 1 1 15 A OP2  O -38.085  -6.692 30.889 . . . 1.0 . . . . . . . . . . . . A . 15 A OP2  . . . . . . . . . rr_2l5z 1 
       .  4 .  3016 . 1 1 15 A P    P -37.668  -7.459 29.694 . . . 1.0 . . . . . . . . . . . . A . 15 A P    . . . . . . . . . rr_2l5z 1 
       .  4 .  3017 . 1 1 16 A C1'  C -39.981  -0.590 25.258 . . . 1.0 . . . . . . . . . . . . A . 16 A C1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3018 . 1 1 16 A C2   C -41.222   0.332 29.400 . . . 1.0 . . . . . . . . . . . . A . 16 A C2   . . . . . . . . . rr_2l5z 1 
       .  4 .  3019 . 1 1 16 A C2'  C -39.472   0.650 24.530 . . . 1.0 . . . . . . . . . . . . A . 16 A C2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3020 . 1 1 16 A C3'  C -38.335   0.097 23.691 . . . 1.0 . . . . . . . . . . . . A . 16 A C3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3021 . 1 1 16 A C4   C -39.856  -0.394 27.824 . . . 1.0 . . . . . . . . . . . . A . 16 A C4   . . . . . . . . . rr_2l5z 1 
       .  4 .  3022 . 1 1 16 A C4'  C -38.810  -1.319 23.352 . . . 1.0 . . . . . . . . . . . . A . 16 A C4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3023 . 1 1 16 A C5   C -38.872  -0.734 28.724 . . . 1.0 . . . . . . . . . . . . A . 16 A C5   . . . . . . . . . rr_2l5z 1 
       .  4 .  3024 . 1 1 16 A C5'  C -37.644  -2.299 23.179 . . . 1.0 . . . . . . . . . . . . A . 16 A C5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3025 . 1 1 16 A C6   C -39.153  -0.492 30.073 . . . 1.0 . . . . . . . . . . . . A . 16 A C6   . . . . . . . . . rr_2l5z 1 
       .  4 .  3026 . 1 1 16 A C8   C -38.135  -1.221 26.828 . . . 1.0 . . . . . . . . . . . . A . 16 A C8   . . . . . . . . . rr_2l5z 1 
       .  4 .  3027 . 1 1 16 A H1'  H -41.062  -0.522 25.372 . . . 1.0 . . . . . . . . . . . . A . 16 A H1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3028 . 1 1 16 A H2   H -42.172   0.766 29.714 . . . 1.0 . . . . . . . . . . . . A . 16 A H2   . . . . . . . . . rr_2l5z 1 
       .  4 .  3029 . 1 1 16 A H2'  H -39.088   1.377 25.252 . . . 1.0 . . . . . . . . . . . . A . 16 A H2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3030 . 1 1 16 A H3'  H -37.388   0.112 24.238 . . . 1.0 . . . . . . . . . . . . A . 16 A H3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3031 . 1 1 16 A H4'  H -39.394  -1.292 22.435 . . . 1.0 . . . . . . . . . . . . A . 16 A H4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3032 . 1 1 16 A H5'  H -38.037  -3.269 22.874 . . . 1.0 . . . . . . . . . . . . A . 16 A H5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3033 . 1 1 16 A H5'' H -36.978  -1.925 22.401 . . . 1.0 . . . . . . . . . . . . A . 16 A H5'' . . . . . . . . . rr_2l5z 1 
       .  4 .  3034 . 1 1 16 A H61  H -38.552  -0.579 32.016 . . . 1.0 . . . . . . . . . . . . A . 16 A H61  . . . . . . . . . rr_2l5z 1 
       .  4 .  3035 . 1 1 16 A H62  H -37.401  -1.182 30.845 . . . 1.0 . . . . . . . . . . . . A . 16 A H62  . . . . . . . . . rr_2l5z 1 
       .  4 .  3036 . 1 1 16 A H8   H -37.500  -1.568 26.026 . . . 1.0 . . . . . . . . . . . . A . 16 A H8   . . . . . . . . . rr_2l5z 1 
       .  4 .  3037 . 1 1 16 A HO2' H -40.913   0.518 23.228 . . . 1.0 . . . . . . . . . . . . A . 16 A HO2' . . . . . . . . . rr_2l5z 1 
       .  4 .  3038 . 1 1 16 A N1   N -40.350   0.047 30.370 . . . 1.0 . . . . . . . . . . . . A . 16 A N1   . . . . . . . . . rr_2l5z 1 
       .  4 .  3039 . 1 1 16 A N3   N -41.061   0.145 28.093 . . . 1.0 . . . . . . . . . . . . A . 16 A N3   . . . . . . . . . rr_2l5z 1 
       .  4 .  3040 . 1 1 16 A N6   N -38.299  -0.773 31.057 . . . 1.0 . . . . . . . . . . . . A . 16 A N6   . . . . . . . . . rr_2l5z 1 
       .  4 .  3041 . 1 1 16 A N7   N -37.755  -1.272 28.064 . . . 1.0 . . . . . . . . . . . . A . 16 A N7   . . . . . . . . . rr_2l5z 1 
       .  4 .  3042 . 1 1 16 A N9   N -39.359  -0.719 26.588 . . . 1.0 . . . . . . . . . . . . A . 16 A N9   . . . . . . . . . rr_2l5z 1 
       .  4 .  3043 . 1 1 16 A O2'  O -40.492   1.233 23.712 . . . 1.0 . . . . . . . . . . . . A . 16 A O2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3044 . 1 1 16 A O3'  O -38.270   0.850 22.476 . . . 1.0 . . . . . . . . . . . . A . 16 A O3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3045 . 1 1 16 A O4'  O -39.659  -1.718 24.432 . . . 1.0 . . . . . . . . . . . . A . 16 A O4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3046 . 1 1 16 A O5'  O -36.905  -2.454 24.392 . . . 1.0 . . . . . . . . . . . . A . 16 A O5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3047 . 1 1 16 A OP1  O -35.306  -4.216 23.607 . . . 1.0 . . . . . . . . . . . . A . 16 A OP1  . . . . . . . . . rr_2l5z 1 
       .  4 .  3048 . 1 1 16 A OP2  O -35.623  -3.755 26.107 . . . 1.0 . . . . . . . . . . . . A . 16 A OP2  . . . . . . . . . rr_2l5z 1 
       .  4 .  3049 . 1 1 16 A P    P -36.184  -3.852 24.742 . . . 1.0 . . . . . . . . . . . . A . 16 A P    . . . . . . . . . rr_2l5z 1 
       .  4 .  3050 . 1 1 17 G C1'  C -37.453   2.789 26.938 . . . 1.0 . . . . . . . . . . . . A . 17 G C1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3051 . 1 1 17 G C2   C -38.000   1.967 31.252 . . . 1.0 . . . . . . . . . . . . A . 17 G C2   . . . . . . . . . rr_2l5z 1 
       .  4 .  3052 . 1 1 17 G C2'  C -37.142   4.274 26.771 . . . 1.0 . . . . . . . . . . . . A . 17 G C2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3053 . 1 1 17 G C3'  C -36.103   4.250 25.669 . . . 1.0 . . . . . . . . . . . . A . 17 G C3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3054 . 1 1 17 G C4   C -36.889   1.986 29.320 . . . 1.0 . . . . . . . . . . . . A . 17 G C4   . . . . . . . . . rr_2l5z 1 
       .  4 .  3055 . 1 1 17 G C4'  C -36.618   3.134 24.774 . . . 1.0 . . . . . . . . . . . . A . 17 G C4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3056 . 1 1 17 G C5   C -35.747   1.401 29.851 . . . 1.0 . . . . . . . . . . . . A . 17 G C5   . . . . . . . . . rr_2l5z 1 
       .  4 .  3057 . 1 1 17 G C5'  C -35.502   2.522 23.928 . . . 1.0 . . . . . . . . . . . . A . 17 G C5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3058 . 1 1 17 G C6   C -35.715   1.057 31.228 . . . 1.0 . . . . . . . . . . . . A . 17 G C6   . . . . . . . . . rr_2l5z 1 
       .  4 .  3059 . 1 1 17 G C8   C -35.360   1.733 27.820 . . . 1.0 . . . . . . . . . . . . A . 17 G C8   . . . . . . . . . rr_2l5z 1 
       .  4 .  3060 . 1 1 17 G H1   H -36.959   1.161 32.874 . . . 1.0 . . . . . . . . . . . . A . 17 G H1   . . . . . . . . . rr_2l5z 1 
       .  4 .  3061 . 1 1 17 G H1'  H -38.504   2.660 27.197 . . . 1.0 . . . . . . . . . . . . A . 17 G H1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3062 . 1 1 17 G H2'  H -36.710   4.674 27.691 . . . 1.0 . . . . . . . . . . . . A . 17 G H2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3063 . 1 1 17 G H21  H -39.026   1.953 33.011 . . . 1.0 . . . . . . . . . . . . A . 17 G H21  . . . . . . . . . rr_2l5z 1 
       .  4 .  3064 . 1 1 17 G H22  H -39.887   2.623 31.644 . . . 1.0 . . . . . . . . . . . . A . 17 G H22  . . . . . . . . . rr_2l5z 1 
       .  4 .  3065 . 1 1 17 G H3'  H -35.103   4.045 26.060 . . . 1.0 . . . . . . . . . . . . A . 17 G H3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3066 . 1 1 17 G H4'  H -37.397   3.528 24.124 . . . 1.0 . . . . . . . . . . . . A . 17 G H4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3067 . 1 1 17 G H5'  H -35.178   3.250 23.185 . . . 1.0 . . . . . . . . . . . . A . 17 G H5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3068 . 1 1 17 G H5'' H -34.660   2.275 24.574 . . . 1.0 . . . . . . . . . . . . A . 17 G H5'' . . . . . . . . . rr_2l5z 1 
       .  4 .  3069 . 1 1 17 G H8   H -34.875   1.768 26.857 . . . 1.0 . . . . . . . . . . . . A . 17 G H8   . . . . . . . . . rr_2l5z 1 
       .  4 .  3070 . 1 1 17 G HO2' H -38.056   5.565 25.635 . . . 1.0 . . . . . . . . . . . . A . 17 G HO2' . . . . . . . . . rr_2l5z 1 
       .  4 .  3071 . 1 1 17 G N1   N -36.907   1.383 31.862 . . . 1.0 . . . . . . . . . . . . A . 17 G N1   . . . . . . . . . rr_2l5z 1 
       .  4 .  3072 . 1 1 17 G N2   N -39.057   2.200 32.032 . . . 1.0 . . . . . . . . . . . . A . 17 G N2   . . . . . . . . . rr_2l5z 1 
       .  4 .  3073 . 1 1 17 G N3   N -38.040   2.295 29.957 . . . 1.0 . . . . . . . . . . . . A . 17 G N3   . . . . . . . . . rr_2l5z 1 
       .  4 .  3074 . 1 1 17 G N7   N -34.765   1.245 28.859 . . . 1.0 . . . . . . . . . . . . A . 17 G N7   . . . . . . . . . rr_2l5z 1 
       .  4 .  3075 . 1 1 17 G N9   N -36.612   2.193 27.994 . . . 1.0 . . . . . . . . . . . . A . 17 G N9   . . . . . . . . . rr_2l5z 1 
       .  4 .  3076 . 1 1 17 G O2'  O -38.305   5.015 26.382 . . . 1.0 . . . . . . . . . . . . A . 17 G O2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3077 . 1 1 17 G O3'  O -36.162   5.482 24.944 . . . 1.0 . . . . . . . . . . . . A . 17 G O3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3078 . 1 1 17 G O4'  O -37.193   2.173 25.664 . . . 1.0 . . . . . . . . . . . . A . 17 G O4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3079 . 1 1 17 G O5'  O -35.936   1.335 23.259 . . . 1.0 . . . . . . . . . . . . A . 17 G O5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3080 . 1 1 17 G O6   O -34.799   0.537 31.863 . . . 1.0 . . . . . . . . . . . . A . 17 G O6   . . . . . . . . . rr_2l5z 1 
       .  4 .  3081 . 1 1 17 G OP1  O -37.050   2.860 21.614 . . . 1.0 . . . . . . . . . . . . A . 17 G OP1  . . . . . . . . . rr_2l5z 1 
       .  4 .  3082 . 1 1 17 G OP2  O -36.329   0.498 20.932 . . . 1.0 . . . . . . . . . . . . A . 17 G OP2  . . . . . . . . . rr_2l5z 1 
       .  4 .  3083 . 1 1 17 G P    P -36.865   1.431 21.948 . . . 1.0 . . . . . . . . . . . . A . 17 G P    . . . . . . . . . rr_2l5z 1 
       .  4 .  3084 . 1 1 18 U C1'  C -36.393   7.055 30.269 . . . 1.0 . . . . . . . . . . . . A . 18 U C1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3085 . 1 1 18 U C2   C -35.632   5.538 32.073 . . . 1.0 . . . . . . . . . . . . A . 18 U C2   . . . . . . . . . rr_2l5z 1 
       .  4 .  3086 . 1 1 18 U C2'  C -35.627   8.366 30.508 . . . 1.0 . . . . . . . . . . . . A . 18 U C2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3087 . 1 1 18 U C3'  C -35.332   8.869 29.098 . . . 1.0 . . . . . . . . . . . . A . 18 U C3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3088 . 1 1 18 U C4   C -34.066   3.690 31.604 . . . 1.0 . . . . . . . . . . . . A . 18 U C4   . . . . . . . . . rr_2l5z 1 
       .  4 .  3089 . 1 1 18 U C4'  C -36.458   8.260 28.285 . . . 1.0 . . . . . . . . . . . . A . 18 U C4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3090 . 1 1 18 U C5   C -34.084   4.122 30.225 . . . 1.0 . . . . . . . . . . . . A . 18 U C5   . . . . . . . . . rr_2l5z 1 
       .  4 .  3091 . 1 1 18 U C5'  C -36.110   8.163 26.802 . . . 1.0 . . . . . . . . . . . . A . 18 U C5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3092 . 1 1 18 U C6   C -34.829   5.183 29.836 . . . 1.0 . . . . . . . . . . . . A . 18 U C6   . . . . . . . . . rr_2l5z 1 
       .  4 .  3093 . 1 1 18 U H1'  H -37.348   7.093 30.796 . . . 1.0 . . . . . . . . . . . . A . 18 U H1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3094 . 1 1 18 U H2'  H -34.692   8.158 31.035 . . . 1.0 . . . . . . . . . . . . A . 18 U H2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3095 . 1 1 18 U H3   H -34.884   4.177 33.446 . . . 1.0 . . . . . . . . . . . . A . 18 U H3   . . . . . . . . . rr_2l5z 1 
       .  4 .  3096 . 1 1 18 U H3'  H -34.349   8.548 28.747 . . . 1.0 . . . . . . . . . . . . A . 18 U H3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3097 . 1 1 18 U H4'  H -37.364   8.851 28.412 . . . 1.0 . . . . . . . . . . . . A . 18 U H4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3098 . 1 1 18 U H5   H -33.494   3.589 29.493 . . . 1.0 . . . . . . . . . . . . A . 18 U H5   . . . . . . . . . rr_2l5z 1 
       .  4 .  3099 . 1 1 18 U H5'  H -37.020   7.962 26.236 . . . 1.0 . . . . . . . . . . . . A . 18 U H5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3100 . 1 1 18 U H5'' H -35.688   9.112 26.473 . . . 1.0 . . . . . . . . . . . . A . 18 U H5'' . . . . . . . . . rr_2l5z 1 
       .  4 .  3101 . 1 1 18 U H6   H -34.809   5.490 28.801 . . . 1.0 . . . . . . . . . . . . A . 18 U H6   . . . . . . . . . rr_2l5z 1 
       .  4 .  3102 . 1 1 18 U HO2' H -37.213   8.845 31.530 . . . 1.0 . . . . . . . . . . . . A . 18 U HO2' . . . . . . . . . rr_2l5z 1 
       .  4 .  3103 . 1 1 18 U N1   N -35.593   5.886 30.726 . . . 1.0 . . . . . . . . . . . . A . 18 U N1   . . . . . . . . . rr_2l5z 1 
       .  4 .  3104 . 1 1 18 U N3   N -34.862   4.450 32.444 . . . 1.0 . . . . . . . . . . . . A . 18 U N3   . . . . . . . . . rr_2l5z 1 
       .  4 .  3105 . 1 1 18 U O2   O -36.312   6.158 32.888 . . . 1.0 . . . . . . . . . . . . A . 18 U O2   . . . . . . . . . rr_2l5z 1 
       .  4 .  3106 . 1 1 18 U O2'  O -36.423   9.305 31.239 . . . 1.0 . . . . . . . . . . . . A . 18 U O2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3107 . 1 1 18 U O3'  O -35.476  10.291 29.082 . . . 1.0 . . . . . . . . . . . . A . 18 U O3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3108 . 1 1 18 U O4   O -33.423   2.738 32.041 . . . 1.0 . . . . . . . . . . . . A . 18 U O4   . . . . . . . . . rr_2l5z 1 
       .  4 .  3109 . 1 1 18 U O4'  O -36.653   6.977 28.859 . . . 1.0 . . . . . . . . . . . . A . 18 U O4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3110 . 1 1 18 U O5'  O -35.166   7.122 26.552 . . . 1.0 . . . . . . . . . . . . A . 18 U O5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3111 . 1 1 18 U OP1  O -35.226   7.649 24.105 . . . 1.0 . . . . . . . . . . . . A . 18 U OP1  . . . . . . . . . rr_2l5z 1 
       .  4 .  3112 . 1 1 18 U OP2  O -33.681   5.817 25.015 . . . 1.0 . . . . . . . . . . . . A . 18 U OP2  . . . . . . . . . rr_2l5z 1 
       .  4 .  3113 . 1 1 18 U P    P -34.965   6.551 25.063 . . . 1.0 . . . . . . . . . . . . A . 18 U P    . . . . . . . . . rr_2l5z 1 
       .  4 .  3114 . 1 1 19 G C1'  C -34.081   9.761 34.462 . . . 1.0 . . . . . . . . . . . . A . 19 G C1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3115 . 1 1 19 G C2   C -32.001   6.685 36.872 . . . 1.0 . . . . . . . . . . . . A . 19 G C2   . . . . . . . . . rr_2l5z 1 
       .  4 .  3116 . 1 1 19 G C2'  C -33.415  11.050 34.957 . . . 1.0 . . . . . . . . . . . . A . 19 G C2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3117 . 1 1 19 G C3'  C -33.601  12.010 33.790 . . . 1.0 . . . . . . . . . . . . A . 19 G C3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3118 . 1 1 19 G C4   C -32.489   7.811 35.009 . . . 1.0 . . . . . . . . . . . . A . 19 G C4   . . . . . . . . . rr_2l5z 1 
       .  4 .  3119 . 1 1 19 G C4'  C -34.886  11.512 33.149 . . . 1.0 . . . . . . . . . . . . A . 19 G C4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3120 . 1 1 19 G C5   C -31.621   7.078 34.213 . . . 1.0 . . . . . . . . . . . . A . 19 G C5   . . . . . . . . . rr_2l5z 1 
       .  4 .  3121 . 1 1 19 G C5'  C -34.996  11.936 31.685 . . . 1.0 . . . . . . . . . . . . A . 19 G C5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3122 . 1 1 19 G C6   C -30.854   6.033 34.795 . . . 1.0 . . . . . . . . . . . . A . 19 G C6   . . . . . . . . . rr_2l5z 1 
       .  4 .  3123 . 1 1 19 G C8   C -32.530   8.490 32.961 . . . 1.0 . . . . . . . . . . . . A . 19 G C8   . . . . . . . . . rr_2l5z 1 
       .  4 .  3124 . 1 1 19 G H1   H -30.590   5.160 36.651 . . . 1.0 . . . . . . . . . . . . A . 19 G H1   . . . . . . . . . rr_2l5z 1 
       .  4 .  3125 . 1 1 19 G H1'  H -34.763   9.389 35.228 . . . 1.0 . . . . . . . . . . . . A . 19 G H1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3126 . 1 1 19 G H2'  H -32.350  10.875 35.133 . . . 1.0 . . . . . . . . . . . . A . 19 G H2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3127 . 1 1 19 G H21  H -31.560   5.666 38.578 . . . 1.0 . . . . . . . . . . . . A . 19 G H21  . . . . . . . . . rr_2l5z 1 
       .  4 .  3128 . 1 1 19 G H22  H -32.740   6.946 38.751 . . . 1.0 . . . . . . . . . . . . A . 19 G H22  . . . . . . . . . rr_2l5z 1 
       .  4 .  3129 . 1 1 19 G H3'  H -32.754  11.979 33.100 . . . 1.0 . . . . . . . . . . . . A . 19 G H3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3130 . 1 1 19 G H4'  H -35.742  11.893 33.705 . . . 1.0 . . . . . . . . . . . . A . 19 G H4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3131 . 1 1 19 G H5'  H -35.992  11.685 31.316 . . . 1.0 . . . . . . . . . . . . A . 19 G H5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3132 . 1 1 19 G H5'' H -34.853  13.014 31.615 . . . 1.0 . . . . . . . . . . . . A . 19 G H5'' . . . . . . . . . rr_2l5z 1 
       .  4 .  3133 . 1 1 19 G H8   H -32.806   9.073 32.096 . . . 1.0 . . . . . . . . . . . . A . 19 G H8   . . . . . . . . . rr_2l5z 1 
       .  4 .  3134 . 1 1 19 G HO2' H -34.932  11.832 35.894 . . . 1.0 . . . . . . . . . . . . A . 19 G HO2' . . . . . . . . . rr_2l5z 1 
       .  4 .  3135 . 1 1 19 G N1   N -31.114   5.907 36.155 . . . 1.0 . . . . . . . . . . . . A . 19 G N1   . . . . . . . . . rr_2l5z 1 
       .  4 .  3136 . 1 1 19 G N2   N -32.109   6.411 38.172 . . . 1.0 . . . . . . . . . . . . A . 19 G N2   . . . . . . . . . rr_2l5z 1 
       .  4 .  3137 . 1 1 19 G N3   N -32.727   7.671 36.332 . . . 1.0 . . . . . . . . . . . . A . 19 G N3   . . . . . . . . . rr_2l5z 1 
       .  4 .  3138 . 1 1 19 G N7   N -31.661   7.535 32.885 . . . 1.0 . . . . . . . . . . . . A . 19 G N7   . . . . . . . . . rr_2l5z 1 
       .  4 .  3139 . 1 1 19 G N9   N -33.071   8.726 34.170 . . . 1.0 . . . . . . . . . . . . A . 19 G N9   . . . . . . . . . rr_2l5z 1 
       .  4 .  3140 . 1 1 19 G O2'  O -34.051  11.543 36.142 . . . 1.0 . . . . . . . . . . . . A . 19 G O2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3141 . 1 1 19 G O3'  O -33.831  13.322 34.309 . . . 1.0 . . . . . . . . . . . . A . 19 G O3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3142 . 1 1 19 G O4'  O -34.833  10.096 33.284 . . . 1.0 . . . . . . . . . . . . A . 19 G O4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3143 . 1 1 19 G O5'  O -34.021  11.282 30.871 . . . 1.0 . . . . . . . . . . . . A . 19 G O5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3144 . 1 1 19 G O6   O -30.044   5.285 34.250 . . . 1.0 . . . . . . . . . . . . A . 19 G O6   . . . . . . . . . rr_2l5z 1 
       .  4 .  3145 . 1 1 19 G OP1  O -34.548  12.602 28.809 . . . 1.0 . . . . . . . . . . . . A . 19 G OP1  . . . . . . . . . rr_2l5z 1 
       .  4 .  3146 . 1 1 19 G OP2  O -33.014  10.552 28.697 . . . 1.0 . . . . . . . . . . . . A . 19 G OP2  . . . . . . . . . rr_2l5z 1 
       .  4 .  3147 . 1 1 19 G P    P -34.191  11.242 29.271 . . . 1.0 . . . . . . . . . . . . A . 19 G P    . . . . . . . . . rr_2l5z 1 
       .  4 .  3148 . 1 1 20 A C1'  C -30.652  11.373 38.296 . . . 1.0 . . . . . . . . . . . . A . 20 A C1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3149 . 1 1 20 A C2   C -27.531   8.273 38.686 . . . 1.0 . . . . . . . . . . . . A . 20 A C2   . . . . . . . . . rr_2l5z 1 
       .  4 .  3150 . 1 1 20 A C2'  C -30.035  12.628 38.927 . . . 1.0 . . . . . . . . . . . . A . 20 A C2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3151 . 1 1 20 A C3'  C -30.847  13.767 38.318 . . . 1.0 . . . . . . . . . . . . A . 20 A C3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3152 . 1 1 20 A C4   C -28.764   9.759 37.617 . . . 1.0 . . . . . . . . . . . . A . 20 A C4   . . . . . . . . . rr_2l5z 1 
       .  4 .  3153 . 1 1 20 A C4'  C -32.179  13.107 38.004 . . . 1.0 . . . . . . . . . . . . A . 20 A C4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3154 . 1 1 20 A C5   C -28.149   9.516 36.411 . . . 1.0 . . . . . . . . . . . . A . 20 A C5   . . . . . . . . . rr_2l5z 1 
       .  4 .  3155 . 1 1 20 A C5'  C -32.942  13.849 36.906 . . . 1.0 . . . . . . . . . . . . A . 20 A C5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3156 . 1 1 20 A C6   C -27.138   8.549 36.410 . . . 1.0 . . . . . . . . . . . . A . 20 A C6   . . . . . . . . . rr_2l5z 1 
       .  4 .  3157 . 1 1 20 A C8   C -29.588  10.995 36.059 . . . 1.0 . . . . . . . . . . . . A . 20 A C8   . . . . . . . . . rr_2l5z 1 
       .  4 .  3158 . 1 1 20 A H1'  H -30.920  10.669 39.083 . . . 1.0 . . . . . . . . . . . . A . 20 A H1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3159 . 1 1 20 A H2   H -27.252   7.745 39.596 . . . 1.0 . . . . . . . . . . . . A . 20 A H2   . . . . . . . . . rr_2l5z 1 
       .  4 .  3160 . 1 1 20 A H2'  H -28.983  12.715 38.633 . . . 1.0 . . . . . . . . . . . . A . 20 A H2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3161 . 1 1 20 A H3'  H -30.364  14.181 37.429 . . . 1.0 . . . . . . . . . . . . A . 20 A H3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3162 . 1 1 20 A H4'  H -32.788  13.065 38.906 . . . 1.0 . . . . . . . . . . . . A . 20 A H4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3163 . 1 1 20 A H5'  H -33.713  13.192 36.503 . . . 1.0 . . . . . . . . . . . . A . 20 A H5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3164 . 1 1 20 A H5'' H -33.415  14.731 37.336 . . . 1.0 . . . . . . . . . . . . A . 20 A H5'' . . . . . . . . . rr_2l5z 1 
       .  4 .  3165 . 1 1 20 A H61  H -25.735   7.503 35.371 . . . 1.0 . . . . . . . . . . . . A . 20 A H61  . . . . . . . . . rr_2l5z 1 
       .  4 .  3166 . 1 1 20 A H62  H -26.660   8.654 34.435 . . . 1.0 . . . . . . . . . . . . A . 20 A H62  . . . . . . . . . rr_2l5z 1 
       .  4 .  3167 . 1 1 20 A H8   H -30.210  11.735 35.577 . . . 1.0 . . . . . . . . . . . . A . 20 A H8   . . . . . . . . . rr_2l5z 1 
       .  4 .  3168 . 1 1 20 A HO2' H -30.673  11.827 40.583 . . . 1.0 . . . . . . . . . . . . A . 20 A HO2' . . . . . . . . . rr_2l5z 1 
       .  4 .  3169 . 1 1 20 A N1   N -26.857   7.946 37.580 . . . 1.0 . . . . . . . . . . . . A . 20 A N1   . . . . . . . . . rr_2l5z 1 
       .  4 .  3170 . 1 1 20 A N3   N -28.503   9.171 38.800 . . . 1.0 . . . . . . . . . . . . A . 20 A N3   . . . . . . . . . rr_2l5z 1 
       .  4 .  3171 . 1 1 20 A N6   N -26.456   8.208 35.317 . . . 1.0 . . . . . . . . . . . . A . 20 A N6   . . . . . . . . . rr_2l5z 1 
       .  4 .  3172 . 1 1 20 A N7   N -28.695  10.328 35.402 . . . 1.0 . . . . . . . . . . . . A . 20 A N7   . . . . . . . . . rr_2l5z 1 
       .  4 .  3173 . 1 1 20 A N9   N -29.701  10.728 37.372 . . . 1.0 . . . . . . . . . . . . A . 20 A N9   . . . . . . . . . rr_2l5z 1 
       .  4 .  3174 . 1 1 20 A O2'  O -30.161  12.606 40.354 . . . 1.0 . . . . . . . . . . . . A . 20 A O2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3175 . 1 1 20 A O3'  O -31.062  14.759 39.327 . . . 1.0 . . . . . . . . . . . . A . 20 A O3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3176 . 1 1 20 A O4'  O -31.842  11.783 37.605 . . . 1.0 . . . . . . . . . . . . A . 20 A O4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3177 . 1 1 20 A O5'  O -32.075  14.254 35.844 . . . 1.0 . . . . . . . . . . . . A . 20 A O5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3178 . 1 1 20 A OP1  O -33.238  15.753 34.209 . . . 1.0 . . . . . . . . . . . . A . 20 A OP1  . . . . . . . . . rr_2l5z 1 
       .  4 .  3179 . 1 1 20 A OP2  O -31.586  13.967 33.404 . . . 1.0 . . . . . . . . . . . . A . 20 A OP2  . . . . . . . . . rr_2l5z 1 
       .  4 .  3180 . 1 1 20 A P    P -32.641  14.405 34.345 . . . 1.0 . . . . . . . . . . . . A . 20 A P    . . . . . . . . . rr_2l5z 1 
       .  4 .  3181 . 1 1 21 C C1'  C -25.167  13.225 38.449 . . . 1.0 . . . . . . . . . . . . A . 21 C C1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3182 . 1 1 21 C C2   C -24.002  11.537 37.099 . . . 1.0 . . . . . . . . . . . . A . 21 C C2   . . . . . . . . . rr_2l5z 1 
       .  4 .  3183 . 1 1 21 C C2'  C -24.267  14.441 38.183 . . . 1.0 . . . . . . . . . . . . A . 21 C C2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3184 . 1 1 21 C C3'  C -25.256  15.595 38.064 . . . 1.0 . . . . . . . . . . . . A . 21 C C3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3185 . 1 1 21 C C4   C -24.973  10.643 35.159 . . . 1.0 . . . . . . . . . . . . A . 21 C C4   . . . . . . . . . rr_2l5z 1 
       .  4 .  3186 . 1 1 21 C C4'  C -26.421  15.128 38.920 . . . 1.0 . . . . . . . . . . . . A . 21 C C4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3187 . 1 1 21 C C5   C -26.154  11.428 35.351 . . . 1.0 . . . . . . . . . . . . A . 21 C C5   . . . . . . . . . rr_2l5z 1 
       .  4 .  3188 . 1 1 21 C C5'  C -27.729  15.827 38.541 . . . 1.0 . . . . . . . . . . . . A . 21 C C5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3189 . 1 1 21 C C6   C -26.197  12.240 36.425 . . . 1.0 . . . . . . . . . . . . A . 21 C C6   . . . . . . . . . rr_2l5z 1 
       .  4 .  3190 . 1 1 21 C H1'  H -24.814  12.699 39.339 . . . 1.0 . . . . . . . . . . . . A . 21 C H1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3191 . 1 1 21 C H2'  H -23.731  14.310 37.238 . . . 1.0 . . . . . . . . . . . . A . 21 C H2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3192 . 1 1 21 C H3'  H -25.552  15.776 37.028 . . . 1.0 . . . . . . . . . . . . A . 21 C H3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3193 . 1 1 21 C H4'  H -26.200  15.309 39.970 . . . 1.0 . . . . . . . . . . . . A . 21 C H4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3194 . 1 1 21 C H41  H -24.051   9.279 33.966 . . . 1.0 . . . . . . . . . . . . A . 21 C H41  . . . . . . . . . rr_2l5z 1 
       .  4 .  3195 . 1 1 21 C H42  H -25.645   9.776 33.446 . . . 1.0 . . . . . . . . . . . . A . 21 C H42  . . . . . . . . . rr_2l5z 1 
       .  4 .  3196 . 1 1 21 C H5   H -26.981  11.371 34.660 . . . 1.0 . . . . . . . . . . . . A . 21 C H5   . . . . . . . . . rr_2l5z 1 
       .  4 .  3197 . 1 1 21 C H5'  H -27.542  16.894 38.414 . . . 1.0 . . . . . . . . . . . . A . 21 C H5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3198 . 1 1 21 C H5'' H -28.094  15.414 37.601 . . . 1.0 . . . . . . . . . . . . A . 21 C H5'' . . . . . . . . . rr_2l5z 1 
       .  4 .  3199 . 1 1 21 C H6   H -27.074  12.846 36.603 . . . 1.0 . . . . . . . . . . . . A . 21 C H6   . . . . . . . . . rr_2l5z 1 
       .  4 .  3200 . 1 1 21 C HO2' H -23.778  14.354 40.065 . . . 1.0 . . . . . . . . . . . . A . 21 C HO2' . . . . . . . . . rr_2l5z 1 
       .  4 .  3201 . 1 1 21 C N1   N -25.145  12.304 37.291 . . . 1.0 . . . . . . . . . . . . A . 21 C N1   . . . . . . . . . rr_2l5z 1 
       .  4 .  3202 . 1 1 21 C N3   N -23.950  10.715 36.018 . . . 1.0 . . . . . . . . . . . . A . 21 C N3   . . . . . . . . . rr_2l5z 1 
       .  4 .  3203 . 1 1 21 C N4   N -24.883   9.834 34.106 . . . 1.0 . . . . . . . . . . . . A . 21 C N4   . . . . . . . . . rr_2l5z 1 
       .  4 .  3204 . 1 1 21 C O2   O -23.068  11.610 37.896 . . . 1.0 . . . . . . . . . . . . A . 21 C O2   . . . . . . . . . rr_2l5z 1 
       .  4 .  3205 . 1 1 21 C O2'  O -23.349  14.653 39.261 . . . 1.0 . . . . . . . . . . . . A . 21 C O2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3206 . 1 1 21 C O3'  O -24.674  16.750 38.672 . . . 1.0 . . . . . . . . . . . . A . 21 C O3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3207 . 1 1 21 C O4'  O -26.491  13.725 38.691 . . . 1.0 . . . . . . . . . . . . A . 21 C O4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3208 . 1 1 21 C O5'  O -28.726  15.648 39.550 . . . 1.0 . . . . . . . . . . . . A . 21 C O5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3209 . 1 1 21 C OP1  O -30.659  16.952 40.465 . . . 1.0 . . . . . . . . . . . . A . 21 C OP1  . . . . . . . . . rr_2l5z 1 
       .  4 .  3210 . 1 1 21 C OP2  O -30.323  16.706 37.937 . . . 1.0 . . . . . . . . . . . . A . 21 C OP2  . . . . . . . . . rr_2l5z 1 
       .  4 .  3211 . 1 1 21 C P    P -30.237  16.140 39.301 . . . 1.0 . . . . . . . . . . . . A . 21 C P    . . . . . . . . . rr_2l5z 1 
       .  4 .  3212 . 1 1 22 G C1'  C -19.769  14.405 40.041 . . . 1.0 . . . . . . . . . . . . A . 22 G C1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3213 . 1 1 22 G C2   C -17.583  11.150 37.986 . . . 1.0 . . . . . . . . . . . . A . 22 G C2   . . . . . . . . . rr_2l5z 1 
       .  4 .  3214 . 1 1 22 G C2'  C -18.630  15.421 39.990 . . . 1.0 . . . . . . . . . . . . A . 22 G C2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3215 . 1 1 22 G C3'  C -19.372  16.697 39.651 . . . 1.0 . . . . . . . . . . . . A . 22 G C3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3216 . 1 1 22 G C4   C -19.157  12.715 38.197 . . . 1.0 . . . . . . . . . . . . A . 22 G C4   . . . . . . . . . rr_2l5z 1 
       .  4 .  3217 . 1 1 22 G C4'  C -20.652  16.537 40.454 . . . 1.0 . . . . . . . . . . . . A . 22 G C4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3218 . 1 1 22 G C5   C -19.699  12.489 36.940 . . . 1.0 . . . . . . . . . . . . A . 22 G C5   . . . . . . . . . rr_2l5z 1 
       .  4 .  3219 . 1 1 22 G C5'  C -21.783  17.399 39.895 . . . 1.0 . . . . . . . . . . . . A . 22 G C5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3220 . 1 1 22 G C6   C -19.134  11.489 36.106 . . . 1.0 . . . . . . . . . . . . A . 22 G C6   . . . . . . . . . rr_2l5z 1 
       .  4 .  3221 . 1 1 22 G C8   C -20.824  14.025 37.808 . . . 1.0 . . . . . . . . . . . . A . 22 G C8   . . . . . . . . . rr_2l5z 1 
       .  4 .  3222 . 1 1 22 G H1   H -17.572  10.141 36.153 . . . 1.0 . . . . . . . . . . . . A . 22 G H1   . . . . . . . . . rr_2l5z 1 
       .  4 .  3223 . 1 1 22 G H1'  H -19.571  13.668 40.818 . . . 1.0 . . . . . . . . . . . . A . 22 G H1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3224 . 1 1 22 G H2'  H -17.932  15.164 39.190 . . . 1.0 . . . . . . . . . . . . A . 22 G H2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3225 . 1 1 22 G H21  H -16.144   9.721 37.805 . . . 1.0 . . . . . . . . . . . . A . 22 G H21  . . . . . . . . . rr_2l5z 1 
       .  4 .  3226 . 1 1 22 G H22  H -16.150  10.593 39.321 . . . 1.0 . . . . . . . . . . . . A . 22 G H22  . . . . . . . . . rr_2l5z 1 
       .  4 .  3227 . 1 1 22 G H3'  H -19.564  16.783 38.580 . . . 1.0 . . . . . . . . . . . . A . 22 G H3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3228 . 1 1 22 G H4'  H -20.467  16.805 41.492 . . . 1.0 . . . . . . . . . . . . A . 22 G H4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3229 . 1 1 22 G H5'  H -22.644  17.328 40.560 . . . 1.0 . . . . . . . . . . . . A . 22 G H5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3230 . 1 1 22 G H5'' H -21.451  18.437 39.855 . . . 1.0 . . . . . . . . . . . . A . 22 G H5'' . . . . . . . . . rr_2l5z 1 
       .  4 .  3231 . 1 1 22 G H8   H -21.557  14.798 37.969 . . . 1.0 . . . . . . . . . . . . A . 22 G H8   . . . . . . . . . rr_2l5z 1 
       .  4 .  3232 . 1 1 22 G HO2' H -18.222  16.353 41.650 . . . 1.0 . . . . . . . . . . . . A . 22 G HO2' . . . . . . . . . rr_2l5z 1 
       .  4 .  3233 . 1 1 22 G N1   N -18.058  10.861 36.721 . . . 1.0 . . . . . . . . . . . . A . 22 G N1   . . . . . . . . . rr_2l5z 1 
       .  4 .  3234 . 1 1 22 G N2   N -16.541  10.430 38.406 . . . 1.0 . . . . . . . . . . . . A . 22 G N2   . . . . . . . . . rr_2l5z 1 
       .  4 .  3235 . 1 1 22 G N3   N -18.110  12.089 38.780 . . . 1.0 . . . . . . . . . . . . A . 22 G N3   . . . . . . . . . rr_2l5z 1 
       .  4 .  3236 . 1 1 22 G N7   N -20.783  13.350 36.706 . . . 1.0 . . . . . . . . . . . . A . 22 G N7   . . . . . . . . . rr_2l5z 1 
       .  4 .  3237 . 1 1 22 G N9   N -19.909  13.724 38.743 . . . 1.0 . . . . . . . . . . . . A . 22 G N9   . . . . . . . . . rr_2l5z 1 
       .  4 .  3238 . 1 1 22 G O2'  O -17.957  15.522 41.251 . . . 1.0 . . . . . . . . . . . . A . 22 G O2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3239 . 1 1 22 G O3'  O -18.634  17.809 40.165 . . . 1.0 . . . . . . . . . . . . A . 22 G O3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3240 . 1 1 22 G O4'  O -20.961  15.142 40.375 . . . 1.0 . . . . . . . . . . . . A . 22 G O4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3241 . 1 1 22 G O5'  O -22.172  16.984 38.585 . . . 1.0 . . . . . . . . . . . . A . 22 G O5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3242 . 1 1 22 G O6   O -19.484  11.149 34.978 . . . 1.0 . . . . . . . . . . . . A . 22 G O6   . . . . . . . . . rr_2l5z 1 
       .  4 .  3243 . 1 1 22 G OP1  O -23.633  18.996 38.284 . . . 1.0 . . . . . . . . . . . . A . 22 G OP1  . . . . . . . . . rr_2l5z 1 
       .  4 .  3244 . 1 1 22 G OP2  O -23.525  17.174 36.486 . . . 1.0 . . . . . . . . . . . . A . 22 G OP2  . . . . . . . . . rr_2l5z 1 
       .  4 .  3245 . 1 1 22 G P    P -23.513  17.568 37.912 . . . 1.0 . . . . . . . . . . . . A . 22 G P    . . . . . . . . . rr_2l5z 1 
       .  4 .  3246 . 1 1 23 G C1'  C -15.168  14.687 37.101 . . . 1.0 . . . . . . . . . . . . A . 23 G C1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3247 . 1 1 23 G C2   C -15.467  12.412 33.327 . . . 1.0 . . . . . . . . . . . . A . 23 G C2   . . . . . . . . . rr_2l5z 1 
       .  4 .  3248 . 1 1 23 G C2'  C -13.989  15.479 36.532 . . . 1.0 . . . . . . . . . . . . A . 23 G C2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3249 . 1 1 23 G C3'  C -14.205  16.859 37.126 . . . 1.0 . . . . . . . . . . . . A . 23 G C3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3250 . 1 1 23 G C4   C -16.206  13.773 34.932 . . . 1.0 . . . . . . . . . . . . A . 23 G C4   . . . . . . . . . rr_2l5z 1 
       .  4 .  3251 . 1 1 23 G C4'  C -14.789  16.528 38.485 . . . 1.0 . . . . . . . . . . . . A . 23 G C4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3252 . 1 1 23 G C5   C -17.454  13.950 34.354 . . . 1.0 . . . . . . . . . . . . A . 23 G C5   . . . . . . . . . rr_2l5z 1 
       .  4 .  3253 . 1 1 23 G C5'  C -15.538  17.717 39.087 . . . 1.0 . . . . . . . . . . . . A . 23 G C5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3254 . 1 1 23 G C6   C -17.757  13.294 33.129 . . . 1.0 . . . . . . . . . . . . A . 23 G C6   . . . . . . . . . rr_2l5z 1 
       .  4 .  3255 . 1 1 23 G C8   C -17.442  15.083 36.117 . . . 1.0 . . . . . . . . . . . . A . 23 G C8   . . . . . . . . . rr_2l5z 1 
       .  4 .  3256 . 1 1 23 G H1   H -16.829  12.021 31.788 . . . 1.0 . . . . . . . . . . . . A . 23 G H1   . . . . . . . . . rr_2l5z 1 
       .  4 .  3257 . 1 1 23 G H1'  H -14.830  13.702 37.426 . . . 1.0 . . . . . . . . . . . . A . 23 G H1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3258 . 1 1 23 G H2'  H -14.058  15.523 35.442 . . . 1.0 . . . . . . . . . . . . A . 23 G H2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3259 . 1 1 23 G H21  H -14.778  11.174 31.863 . . . 1.0 . . . . . . . . . . . . A . 23 G H21  . . . . . . . . . rr_2l5z 1 
       .  4 .  3260 . 1 1 23 G H22  H -13.647  11.515 33.154 . . . 1.0 . . . . . . . . . . . . A . 23 G H22  . . . . . . . . . rr_2l5z 1 
       .  4 .  3261 . 1 1 23 G H3'  H -14.888  17.461 36.524 . . . 1.0 . . . . . . . . . . . . A . 23 G H3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3262 . 1 1 23 G H4'  H -13.992  16.219 39.160 . . . 1.0 . . . . . . . . . . . . A . 23 G H4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3263 . 1 1 23 G H5'  H -15.708  17.529 40.146 . . . 1.0 . . . . . . . . . . . . A . 23 G H5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3264 . 1 1 23 G H5'' H -14.927  18.615 38.980 . . . 1.0 . . . . . . . . . . . . A . 23 G H5'' . . . . . . . . . rr_2l5z 1 
       .  4 .  3265 . 1 1 23 G H8   H -17.738  15.741 36.922 . . . 1.0 . . . . . . . . . . . . A . 23 G H8   . . . . . . . . . rr_2l5z 1 
       .  4 .  3266 . 1 1 23 G HO2' H -12.268  14.647 36.151 . . . 1.0 . . . . . . . . . . . . A . 23 G HO2' . . . . . . . . . rr_2l5z 1 
       .  4 .  3267 . 1 1 23 G N1   N -16.684  12.532 32.681 . . . 1.0 . . . . . . . . . . . . A . 23 G N1   . . . . . . . . . rr_2l5z 1 
       .  4 .  3268 . 1 1 23 G N2   N -14.558  11.637 32.734 . . . 1.0 . . . . . . . . . . . . A . 23 G N2   . . . . . . . . . rr_2l5z 1 
       .  4 .  3269 . 1 1 23 G N3   N -15.176  13.025 34.478 . . . 1.0 . . . . . . . . . . . . A . 23 G N3   . . . . . . . . . rr_2l5z 1 
       .  4 .  3270 . 1 1 23 G N7   N -18.244  14.807 35.140 . . . 1.0 . . . . . . . . . . . . A . 23 G N7   . . . . . . . . . rr_2l5z 1 
       .  4 .  3271 . 1 1 23 G N9   N -16.221  14.519 36.081 . . . 1.0 . . . . . . . . . . . . A . 23 G N9   . . . . . . . . . rr_2l5z 1 
       .  4 .  3272 . 1 1 23 G O2'  O -12.735  14.921 36.945 . . . 1.0 . . . . . . . . . . . . A . 23 G O2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3273 . 1 1 23 G O3'  O -12.934  17.490 37.305 . . . 1.0 . . . . . . . . . . . . A . 23 G O3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3274 . 1 1 23 G O4'  O -15.655  15.422 38.240 . . . 1.0 . . . . . . . . . . . . A . 23 G O4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3275 . 1 1 23 G O5'  O -16.798  17.935 38.447 . . . 1.0 . . . . . . . . . . . . A . 23 G O5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3276 . 1 1 23 G O6   O -18.801  13.331 32.480 . . . 1.0 . . . . . . . . . . . . A . 23 G O6   . . . . . . . . . rr_2l5z 1 
       .  4 .  3277 . 1 1 23 G OP1  O -17.242  19.881 39.961 . . . 1.0 . . . . . . . . . . . . A . 23 G OP1  . . . . . . . . . rr_2l5z 1 
       .  4 .  3278 . 1 1 23 G OP2  O -18.912  19.241 38.128 . . . 1.0 . . . . . . . . . . . . A . 23 G OP2  . . . . . . . . . rr_2l5z 1 
       .  4 .  3279 . 1 1 23 G P    P -17.924  18.844 39.155 . . . 1.0 . . . . . . . . . . . . A . 23 G P    . . . . . . . . . rr_2l5z 1 
       .  4 .  3280 . 1 1 24 C C1'  C -12.557  15.486 32.008 . . . 1.0 . . . . . . . . . . . . A . 24 C C1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3281 . 1 1 24 C C2   C -14.640  14.791 30.841 . . . 1.0 . . . . . . . . . . . . A . 24 C C2   . . . . . . . . . rr_2l5z 1 
       .  4 .  3282 . 1 1 24 C C2'  C -11.919  16.570 31.129 . . . 1.0 . . . . . . . . . . . . A . 24 C C2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3283 . 1 1 24 C C3'  C -11.385  17.576 32.141 . . . 1.0 . . . . . . . . . . . . A . 24 C C3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3284 . 1 1 24 C C4   C -16.736  15.577 31.546 . . . 1.0 . . . . . . . . . . . . A . 24 C C4   . . . . . . . . . rr_2l5z 1 
       .  4 .  3285 . 1 1 24 C C4'  C -11.089  16.702 33.343 . . . 1.0 . . . . . . . . . . . . A . 24 C C4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3286 . 1 1 24 C C5   C -16.134  16.325 32.607 . . . 1.0 . . . . . . . . . . . . A . 24 C C5   . . . . . . . . . rr_2l5z 1 
       .  4 .  3287 . 1 1 24 C C5'  C -11.023  17.515 34.636 . . . 1.0 . . . . . . . . . . . . A . 24 C C5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3288 . 1 1 24 C C6   C -14.793  16.268 32.733 . . . 1.0 . . . . . . . . . . . . A . 24 C C6   . . . . . . . . . rr_2l5z 1 
       .  4 .  3289 . 1 1 24 C H1'  H -12.166  14.506 31.718 . . . 1.0 . . . . . . . . . . . . A . 24 C H1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3290 . 1 1 24 C H2'  H -12.683  17.039 30.507 . . . 1.0 . . . . . . . . . . . . A . 24 C H2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3291 . 1 1 24 C H3'  H -12.116  18.354 32.368 . . . 1.0 . . . . . . . . . . . . A . 24 C H3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3292 . 1 1 24 C H4'  H -10.148  16.176 33.193 . . . 1.0 . . . . . . . . . . . . A . 24 C H4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3293 . 1 1 24 C H41  H -18.489  15.080 30.638 . . . 1.0 . . . . . . . . . . . . A . 24 C H41  . . . . . . . . . rr_2l5z 1 
       .  4 .  3294 . 1 1 24 C H42  H -18.631  16.154 32.012 . . . 1.0 . . . . . . . . . . . . A . 24 C H42  . . . . . . . . . rr_2l5z 1 
       .  4 .  3295 . 1 1 24 C H5   H -16.734  16.916 33.281 . . . 1.0 . . . . . . . . . . . . A . 24 C H5   . . . . . . . . . rr_2l5z 1 
       .  4 .  3296 . 1 1 24 C H5'  H -10.728  16.857 35.454 . . . 1.0 . . . . . . . . . . . . A . 24 C H5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3297 . 1 1 24 C H5'' H -10.275  18.299 34.524 . . . 1.0 . . . . . . . . . . . . A . 24 C H5'' . . . . . . . . . rr_2l5z 1 
       .  4 .  3298 . 1 1 24 C H6   H -14.305  16.837 33.512 . . . 1.0 . . . . . . . . . . . . A . 24 C H6   . . . . . . . . . rr_2l5z 1 
       .  4 .  3299 . 1 1 24 C HO2' H -10.996  15.084 30.273 . . . 1.0 . . . . . . . . . . . . A . 24 C HO2' . . . . . . . . . rr_2l5z 1 
       .  4 .  3300 . 1 1 24 C N1   N -14.043  15.518 31.874 . . . 1.0 . . . . . . . . . . . . A . 24 C N1   . . . . . . . . . rr_2l5z 1 
       .  4 .  3301 . 1 1 24 C N3   N -15.992  14.846 30.708 . . . 1.0 . . . . . . . . . . . . A . 24 C N3   . . . . . . . . . rr_2l5z 1 
       .  4 .  3302 . 1 1 24 C N4   N -18.059  15.606 31.386 . . . 1.0 . . . . . . . . . . . . A . 24 C N4   . . . . . . . . . rr_2l5z 1 
       .  4 .  3303 . 1 1 24 C O2   O -13.946  14.126 30.072 . . . 1.0 . . . . . . . . . . . . A . 24 C O2   . . . . . . . . . rr_2l5z 1 
       .  4 .  3304 . 1 1 24 C O2'  O -10.864  16.034 30.322 . . . 1.0 . . . . . . . . . . . . A . 24 C O2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3305 . 1 1 24 C O3'  O -10.158  18.113 31.642 . . . 1.0 . . . . . . . . . . . . A . 24 C O3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3306 . 1 1 24 C O4'  O -12.154  15.762 33.362 . . . 1.0 . . . . . . . . . . . . A . 24 C O4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3307 . 1 1 24 C O5'  O -12.281  18.115 34.953 . . . 1.0 . . . . . . . . . . . . A . 24 C O5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3308 . 1 1 24 C OP1  O -11.239  19.290 36.905 . . . 1.0 . . . . . . . . . . . . A . 24 C OP1  . . . . . . . . . rr_2l5z 1 
       .  4 .  3309 . 1 1 24 C OP2  O -13.705  19.660 36.318 . . . 1.0 . . . . . . . . . . . . A . 24 C OP2  . . . . . . . . . rr_2l5z 1 
       .  4 .  3310 . 1 1 24 C P    P -12.530  18.765 36.406 . . . 1.0 . . . . . . . . . . . . A . 24 C P    . . . . . . . . . rr_2l5z 1 
       .  4 .  3311 . 1 1 25 U C1'  C -11.768  16.289 26.572 . . . 1.0 . . . . . . . . . . . . A . 25 U C1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3312 . 1 1 25 U C2   C -14.247  16.065 26.421 . . . 1.0 . . . . . . . . . . . . A . 25 U C2   . . . . . . . . . rr_2l5z 1 
       .  4 .  3313 . 1 1 25 U C2'  C -11.285  17.237 25.471 . . . 1.0 . . . . . . . . . . . . A . 25 U C2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3314 . 1 1 25 U C3'  C -10.460  18.241 26.251 . . . 1.0 . . . . . . . . . . . . A . 25 U C3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3315 . 1 1 25 U C4   C -15.731  17.453 27.821 . . . 1.0 . . . . . . . . . . . . A . 25 U C4   . . . . . . . . . rr_2l5z 1 
       .  4 .  3316 . 1 1 25 U C4'  C  -9.810  17.358 27.295 . . . 1.0 . . . . . . . . . . . . A . 25 U C4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3317 . 1 1 25 U C5   C -14.535  18.029 28.392 . . . 1.0 . . . . . . . . . . . . A . 25 U C5   . . . . . . . . . rr_2l5z 1 
       .  4 .  3318 . 1 1 25 U C5'  C  -9.331  18.163 28.503 . . . 1.0 . . . . . . . . . . . . A . 25 U C5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3319 . 1 1 25 U C6   C -13.305  17.629 27.987 . . . 1.0 . . . . . . . . . . . . A . 25 U C6   . . . . . . . . . rr_2l5z 1 
       .  4 .  3320 . 1 1 25 U H1'  H -11.744  15.262 26.195 . . . 1.0 . . . . . . . . . . . . A . 25 U H1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3321 . 1 1 25 U H2'  H -12.136  17.731 25.001 . . . 1.0 . . . . . . . . . . . . A . 25 U H2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3322 . 1 1 25 U H3   H -16.319  16.067 26.395 . . . 1.0 . . . . . . . . . . . . A . 25 U H3   . . . . . . . . . rr_2l5z 1 
       .  4 .  3323 . 1 1 25 U H3'  H -11.075  19.024 26.697 . . . 1.0 . . . . . . . . . . . . A . 25 U H3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3324 . 1 1 25 U H4'  H  -8.972  16.831 26.851 . . . 1.0 . . . . . . . . . . . . A . 25 U H4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3325 . 1 1 25 U H5   H -14.622  18.816 29.126 . . . 1.0 . . . . . . . . . . . . A . 25 U H5   . . . . . . . . . rr_2l5z 1 
       .  4 .  3326 . 1 1 25 U H5'  H  -8.782  17.500 29.173 . . . 1.0 . . . . . . . . . . . . A . 25 U H5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3327 . 1 1 25 U H5'' H  -8.663  18.952 28.160 . . . 1.0 . . . . . . . . . . . . A . 25 U H5'' . . . . . . . . . rr_2l5z 1 
       .  4 .  3328 . 1 1 25 U H6   H -12.432  18.089 28.425 . . . 1.0 . . . . . . . . . . . . A . 25 U H6   . . . . . . . . . rr_2l5z 1 
       .  4 .  3329 . 1 1 25 U HO2' H  -9.957  15.903 24.971 . . . 1.0 . . . . . . . . . . . . A . 25 U HO2' . . . . . . . . . rr_2l5z 1 
       .  4 .  3330 . 1 1 25 U N1   N -13.143  16.670 27.022 . . . 1.0 . . . . . . . . . . . . A . 25 U N1   . . . . . . . . . rr_2l5z 1 
       .  4 .  3331 . 1 1 25 U N3   N -15.489  16.492 26.854 . . . 1.0 . . . . . . . . . . . . A . 25 U N3   . . . . . . . . . rr_2l5z 1 
       .  4 .  3332 . 1 1 25 U O2   O -14.126  15.202 25.555 . . . 1.0 . . . . . . . . . . . . A . 25 U O2   . . . . . . . . . rr_2l5z 1 
       .  4 .  3333 . 1 1 25 U O2'  O -10.491  16.548 24.499 . . . 1.0 . . . . . . . . . . . . A . 25 U O2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3334 . 1 1 25 U O3'  O  -9.440  18.765 25.395 . . . 1.0 . . . . . . . . . . . . A . 25 U O3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3335 . 1 1 25 U O4   O -16.882  17.752 28.131 . . . 1.0 . . . . . . . . . . . . A . 25 U O4   . . . . . . . . . rr_2l5z 1 
       .  4 .  3336 . 1 1 25 U O4'  O -10.821  16.415 27.653 . . . 1.0 . . . . . . . . . . . . A . 25 U O4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3337 . 1 1 25 U O5'  O -10.417  18.753 29.220 . . . 1.0 . . . . . . . . . . . . A . 25 U O5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3338 . 1 1 25 U OP1  O  -8.819  20.005 30.688 . . . 1.0 . . . . . . . . . . . . A . 25 U OP1  . . . . . . . . . rr_2l5z 1 
       .  4 .  3339 . 1 1 25 U OP2  O -11.351  20.227 31.018 . . . 1.0 . . . . . . . . . . . . A . 25 U OP2  . . . . . . . . . rr_2l5z 1 
       .  4 .  3340 . 1 1 25 U P    P -10.171  19.402 30.674 . . . 1.0 . . . . . . . . . . . . A . 25 U P    . . . . . . . . . rr_2l5z 1 
       .  4 .  3341 . 1 1 26 C C1'  C -14.349  19.489 22.557 . . . 1.0 . . . . . . . . . . . . A . 26 C C1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3342 . 1 1 26 C C2   C -16.424  20.196 23.653 . . . 1.0 . . . . . . . . . . . . A . 26 C C2   . . . . . . . . . rr_2l5z 1 
       .  4 .  3343 . 1 1 26 C C2'  C -14.130  20.689 21.628 . . . 1.0 . . . . . . . . . . . . A . 26 C C2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3344 . 1 1 26 C C3'  C -12.637  20.968 21.756 . . . 1.0 . . . . . . . . . . . . A . 26 C C3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3345 . 1 1 26 C C4   C -16.498  20.633 25.960 . . . 1.0 . . . . . . . . . . . . A . 26 C C4   . . . . . . . . . rr_2l5z 1 
       .  4 .  3346 . 1 1 26 C C4'  C -12.087  19.579 22.033 . . . 1.0 . . . . . . . . . . . . A . 26 C C4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3347 . 1 1 26 C C5   C -15.108  20.321 26.094 . . . 1.0 . . . . . . . . . . . . A . 26 C C5   . . . . . . . . . rr_2l5z 1 
       .  4 .  3348 . 1 1 26 C C5'  C -10.709  19.631 22.695 . . . 1.0 . . . . . . . . . . . . A . 26 C C5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3349 . 1 1 26 C C6   C -14.437  19.957 24.983 . . . 1.0 . . . . . . . . . . . . A . 26 C C6   . . . . . . . . . rr_2l5z 1 
       .  4 .  3350 . 1 1 26 C H1'  H -14.923  18.727 22.031 . . . 1.0 . . . . . . . . . . . . A . 26 C H1'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3351 . 1 1 26 C H2'  H -14.708  21.547 21.987 . . . 1.0 . . . . . . . . . . . . A . 26 C H2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3352 . 1 1 26 C H3'  H -12.447  21.632 22.608 . . . 1.0 . . . . . . . . . . . . A . 26 C H3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3353 . 1 1 26 C H4'  H -12.023  19.020 21.102 . . . 1.0 . . . . . . . . . . . . A . 26 C H4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3354 . 1 1 26 C H41  H -18.182  21.216 26.944 . . . 1.0 . . . . . . . . . . . . A . 26 C H41  . . . . . . . . . rr_2l5z 1 
       .  4 .  3355 . 1 1 26 C H42  H -16.751  21.050 27.936 . . . 1.0 . . . . . . . . . . . . A . 26 C H42  . . . . . . . . . rr_2l5z 1 
       .  4 .  3356 . 1 1 26 C H5   H -14.613  20.376 27.052 . . . 1.0 . . . . . . . . . . . . A . 26 C H5   . . . . . . . . . rr_2l5z 1 
       .  4 .  3357 . 1 1 26 C H5'  H -10.363  18.614 22.876 . . . 1.0 . . . . . . . . . . . . A . 26 C H5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3358 . 1 1 26 C H5'' H -10.011  20.130 22.022 . . . 1.0 . . . . . . . . . . . . A . 26 C H5'' . . . . . . . . . rr_2l5z 1 
       .  4 .  3359 . 1 1 26 C H6   H -13.384  19.715 25.046 . . . 1.0 . . . . . . . . . . . . A . 26 C H6   . . . . . . . . . rr_2l5z 1 
       .  4 .  3360 . 1 1 26 C HO2' H -15.076  19.613 20.309 . . . 1.0 . . . . . . . . . . . . A . 26 C HO2' . . . . . . . . . rr_2l5z 1 
       .  4 .  3361 . 1 1 26 C HO3' H -12.668  22.244 20.286 . . . 1.0 . . . . . . . . . . . . A . 26 C HO3' . . . . . . . . . rr_2l5z 1 
       .  4 .  3362 . 1 1 26 C N1   N -15.074  19.892 23.778 . . . 1.0 . . . . . . . . . . . . A . 26 C N1   . . . . . . . . . rr_2l5z 1 
       .  4 .  3363 . 1 1 26 C N3   N -17.109  20.564 24.769 . . . 1.0 . . . . . . . . . . . . A . 26 C N3   . . . . . . . . . rr_2l5z 1 
       .  4 .  3364 . 1 1 26 C N4   N -17.200  20.995 27.034 . . . 1.0 . . . . . . . . . . . . A . 26 C N4   . . . . . . . . . rr_2l5z 1 
       .  4 .  3365 . 1 1 26 C O2   O -16.975  20.132 22.554 . . . 1.0 . . . . . . . . . . . . A . 26 C O2   . . . . . . . . . rr_2l5z 1 
       .  4 .  3366 . 1 1 26 C O2'  O -14.485  20.370 20.278 . . . 1.0 . . . . . . . . . . . . A . 26 C O2'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3367 . 1 1 26 C O3'  O -12.099  21.515 20.546 . . . 1.0 . . . . . . . . . . . . A . 26 C O3'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3368 . 1 1 26 C O4'  O -13.052  18.967 22.878 . . . 1.0 . . . . . . . . . . . . A . 26 C O4'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3369 . 1 1 26 C O5'  O -10.747  20.338 23.935 . . . 1.0 . . . . . . . . . . . . A . 26 C O5'  . . . . . . . . . rr_2l5z 1 
       .  4 .  3370 . 1 1 26 C OP1  O  -8.262  20.582 24.135 . . . 1.0 . . . . . . . . . . . . A . 26 C OP1  . . . . . . . . . rr_2l5z 1 
       .  4 .  3371 . 1 1 26 C OP2  O  -9.796  21.139 26.110 . . . 1.0 . . . . . . . . . . . . A . 26 C OP2  . . . . . . . . . rr_2l5z 1 
       .  4 .  3372 . 1 1 26 C P    P  -9.481  20.306 24.929 . . . 1.0 . . . . . . . . . . . . A . 26 C P    . . . . . . . . . rr_2l5z 1 
       .  5 .  3373 . 1 1  1 G C1'  C -24.801  19.322 21.973 . . . 1.0 . . . . . . . . . . . . A .  1 G C1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3374 . 1 1  1 G C2   C -20.487  20.316 22.014 . . . 1.0 . . . . . . . . . . . . A .  1 G C2   . . . . . . . . . rr_2l5z 1 
       .  5 .  3375 . 1 1  1 G C2'  C -24.788  17.807 21.771 . . . 1.0 . . . . . . . . . . . . A .  1 G C2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3376 . 1 1  1 G C3'  C -25.976  17.353 22.596 . . . 1.0 . . . . . . . . . . . . A .  1 G C3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3377 . 1 1  1 G C4   C -22.504  20.010 22.916 . . . 1.0 . . . . . . . . . . . . A .  1 G C4   . . . . . . . . . rr_2l5z 1 
       .  5 .  3378 . 1 1  1 G C4'  C -26.954  18.511 22.441 . . . 1.0 . . . . . . . . . . . . A .  1 G C4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3379 . 1 1  1 G C5   C -22.092  20.324 24.203 . . . 1.0 . . . . . . . . . . . . A .  1 G C5   . . . . . . . . . rr_2l5z 1 
       .  5 .  3380 . 1 1  1 G C5'  C -27.927  18.604 23.619 . . . 1.0 . . . . . . . . . . . . A .  1 G C5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3381 . 1 1  1 G C6   C -20.735  20.675 24.436 . . . 1.0 . . . . . . . . . . . . A .  1 G C6   . . . . . . . . . rr_2l5z 1 
       .  5 .  3382 . 1 1  1 G C8   C -24.134  19.877 24.321 . . . 1.0 . . . . . . . . . . . . A .  1 G C8   . . . . . . . . . rr_2l5z 1 
       .  5 .  3383 . 1 1  1 G H1   H -18.986  20.892 23.353 . . . 1.0 . . . . . . . . . . . . A .  1 G H1   . . . . . . . . . rr_2l5z 1 
       .  5 .  3384 . 1 1  1 G H1'  H -24.539  19.814 21.036 . . . 1.0 . . . . . . . . . . . . A .  1 G H1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3385 . 1 1  1 G H2'  H -23.866  17.383 22.178 . . . 1.0 . . . . . . . . . . . . A .  1 G H2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3386 . 1 1  1 G H21  H -18.651  20.594 21.180 . . . 1.0 . . . . . . . . . . . . A .  1 G H21  . . . . . . . . . rr_2l5z 1 
       .  5 .  3387 . 1 1  1 G H22  H -19.915  20.113 20.071 . . . 1.0 . . . . . . . . . . . . A .  1 G H22  . . . . . . . . . rr_2l5z 1 
       .  5 .  3388 . 1 1  1 G H3'  H -25.699  17.170 23.637 . . . 1.0 . . . . . . . . . . . . A .  1 G H3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3389 . 1 1  1 G H4'  H -27.517  18.391 21.516 . . . 1.0 . . . . . . . . . . . . A .  1 G H4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3390 . 1 1  1 G H5'  H -28.659  19.386 23.416 . . . 1.0 . . . . . . . . . . . . A .  1 G H5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3391 . 1 1  1 G H5'' H -28.445  17.652 23.727 . . . 1.0 . . . . . . . . . . . . A .  1 G H5'' . . . . . . . . . rr_2l5z 1 
       .  5 .  3392 . 1 1  1 G H8   H -25.133  19.713 24.698 . . . 1.0 . . . . . . . . . . . . A .  1 G H8   . . . . . . . . . rr_2l5z 1 
       .  5 .  3393 . 1 1  1 G HO2' H -24.437  18.095 19.877 . . . 1.0 . . . . . . . . . . . . A .  1 G HO2' . . . . . . . . . rr_2l5z 1 
       .  5 .  3394 . 1 1  1 G HO5' H -27.595  18.319 25.514 . . . 1.0 . . . . . . . . . . . . A .  1 G HO5' . . . . . . . . . rr_2l5z 1 
       .  5 .  3395 . 1 1  1 G N1   N -19.992  20.643 23.262 . . . 1.0 . . . . . . . . . . . . A .  1 G N1   . . . . . . . . . rr_2l5z 1 
       .  5 .  3396 . 1 1  1 G N2   N -19.614  20.344 21.007 . . . 1.0 . . . . . . . . . . . . A .  1 G N2   . . . . . . . . . rr_2l5z 1 
       .  5 .  3397 . 1 1  1 G N3   N -21.763  19.986 21.785 . . . 1.0 . . . . . . . . . . . . A .  1 G N3   . . . . . . . . . rr_2l5z 1 
       .  5 .  3398 . 1 1  1 G N7   N -23.167  20.233 25.102 . . . 1.0 . . . . . . . . . . . . A .  1 G N7   . . . . . . . . . rr_2l5z 1 
       .  5 .  3399 . 1 1  1 G N9   N -23.840  19.722 23.018 . . . 1.0 . . . . . . . . . . . . A .  1 G N9   . . . . . . . . . rr_2l5z 1 
       .  5 .  3400 . 1 1  1 G O2'  O -24.944  17.461 20.390 . . . 1.0 . . . . . . . . . . . . A .  1 G O2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3401 . 1 1  1 G O3'  O -26.542  16.195 21.976 . . . 1.0 . . . . . . . . . . . . A .  1 G O3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3402 . 1 1  1 G O4'  O -26.142  19.684 22.343 . . . 1.0 . . . . . . . . . . . . A .  1 G O4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3403 . 1 1  1 G O5'  O -27.247  18.907 24.839 . . . 1.0 . . . . . . . . . . . . A .  1 G O5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3404 . 1 1  1 G O6   O -20.197  20.980 25.498 . . . 1.0 . . . . . . . . . . . . A .  1 G O6   . . . . . . . . . rr_2l5z 1 
       .  5 .  3405 . 1 1  2 A C1'  C -21.015  14.060 21.588 . . . 1.0 . . . . . . . . . . . . A .  2 A C1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3406 . 1 1  2 A C2   C -17.579  15.409 24.032 . . . 1.0 . . . . . . . . . . . . A .  2 A C2   . . . . . . . . . rr_2l5z 1 
       .  5 .  3407 . 1 1  2 A C2'  C -21.206  12.605 22.015 . . . 1.0 . . . . . . . . . . . . A .  2 A C2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3408 . 1 1  2 A C3'  C -22.714  12.446 21.968 . . . 1.0 . . . . . . . . . . . . A .  2 A C3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3409 . 1 1  2 A C4   C -19.707  15.277 23.447 . . . 1.0 . . . . . . . . . . . . A .  2 A C4   . . . . . . . . . rr_2l5z 1 
       .  5 .  3410 . 1 1  2 A C4'  C -23.104  13.341 20.798 . . . 1.0 . . . . . . . . . . . . A .  2 A C4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3411 . 1 1  2 A C5   C -20.119  16.101 24.470 . . . 1.0 . . . . . . . . . . . . A .  2 A C5   . . . . . . . . . rr_2l5z 1 
       .  5 .  3412 . 1 1  2 A C5'  C -24.552  13.825 20.907 . . . 1.0 . . . . . . . . . . . . A .  2 A C5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3413 . 1 1  2 A C6   C -19.120  16.591 25.317 . . . 1.0 . . . . . . . . . . . . A .  2 A C6   . . . . . . . . . rr_2l5z 1 
       .  5 .  3414 . 1 1  2 A C8   C -21.842  15.559 23.415 . . . 1.0 . . . . . . . . . . . . A .  2 A C8   . . . . . . . . . rr_2l5z 1 
       .  5 .  3415 . 1 1  2 A H1'  H -20.133  14.141 20.951 . . . 1.0 . . . . . . . . . . . . A .  2 A H1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3416 . 1 1  2 A H2   H -16.530  15.150 23.883 . . . 1.0 . . . . . . . . . . . . A .  2 A H2   . . . . . . . . . rr_2l5z 1 
       .  5 .  3417 . 1 1  2 A H2'  H -20.845  12.464 23.036 . . . 1.0 . . . . . . . . . . . . A .  2 A H2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3418 . 1 1  2 A H3'  H -23.181  12.753 22.906 . . . 1.0 . . . . . . . . . . . . A .  2 A H3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3419 . 1 1  2 A H4'  H -22.973  12.796 19.864 . . . 1.0 . . . . . . . . . . . . A .  2 A H4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3420 . 1 1  2 A H5'  H -24.729  14.589 20.149 . . . 1.0 . . . . . . . . . . . . A .  2 A H5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3421 . 1 1  2 A H5'' H -25.221  12.983 20.727 . . . 1.0 . . . . . . . . . . . . A .  2 A H5'' . . . . . . . . . rr_2l5z 1 
       .  5 .  3422 . 1 1  2 A H61  H -18.612  17.721 26.931 . . . 1.0 . . . . . . . . . . . . A .  2 A H61  . . . . . . . . . rr_2l5z 1 
       .  5 .  3423 . 1 1  2 A H62  H -20.318  17.680 26.550 . . . 1.0 . . . . . . . . . . . . A .  2 A H62  . . . . . . . . . rr_2l5z 1 
       .  5 .  3424 . 1 1  2 A H8   H -22.870  15.466 23.098 . . . 1.0 . . . . . . . . . . . . A .  2 A H8   . . . . . . . . . rr_2l5z 1 
       .  5 .  3425 . 1 1  2 A HO2' H -20.692  12.042 20.223 . . . 1.0 . . . . . . . . . . . . A .  2 A HO2' . . . . . . . . . rr_2l5z 1 
       .  5 .  3426 . 1 1  2 A N1   N -17.851  16.217 25.061 . . . 1.0 . . . . . . . . . . . . A .  2 A N1   . . . . . . . . . rr_2l5z 1 
       .  5 .  3427 . 1 1  2 A N3   N -18.447  14.888 23.168 . . . 1.0 . . . . . . . . . . . . A .  2 A N3   . . . . . . . . . rr_2l5z 1 
       .  5 .  3428 . 1 1  2 A N6   N -19.370  17.396 26.349 . . . 1.0 . . . . . . . . . . . . A .  2 A N6   . . . . . . . . . rr_2l5z 1 
       .  5 .  3429 . 1 1  2 A N7   N -21.513  16.277 24.439 . . . 1.0 . . . . . . . . . . . . A .  2 A N7   . . . . . . . . . rr_2l5z 1 
       .  5 .  3430 . 1 1  2 A N9   N -20.845  14.931 22.767 . . . 1.0 . . . . . . . . . . . . A .  2 A N9   . . . . . . . . . rr_2l5z 1 
       .  5 .  3431 . 1 1  2 A O2'  O -20.555  11.704 21.111 . . . 1.0 . . . . . . . . . . . . A .  2 A O2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3432 . 1 1  2 A O3'  O -23.018  11.091 21.628 . . . 1.0 . . . . . . . . . . . . A .  2 A O3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3433 . 1 1  2 A O4'  O -22.183  14.433 20.836 . . . 1.0 . . . . . . . . . . . . A .  2 A O4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3434 . 1 1  2 A O5'  O -24.826  14.374 22.198 . . . 1.0 . . . . . . . . . . . . A .  2 A O5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3435 . 1 1  2 A OP1  O -27.251  13.792 21.948 . . . 1.0 . . . . . . . . . . . . A .  2 A OP1  . . . . . . . . . rr_2l5z 1 
       .  5 .  3436 . 1 1  2 A OP2  O -26.378  14.877 24.099 . . . 1.0 . . . . . . . . . . . . A .  2 A OP2  . . . . . . . . . rr_2l5z 1 
       .  5 .  3437 . 1 1  2 A P    P -26.335  14.737 22.625 . . . 1.0 . . . . . . . . . . . . A .  2 A P    . . . . . . . . . rr_2l5z 1 
       .  5 .  3438 . 1 1  3 G C1'  C -18.023  10.568 23.979 . . . 1.0 . . . . . . . . . . . . A .  3 G C1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3439 . 1 1  3 G C2   C -15.997  13.078 27.000 . . . 1.0 . . . . . . . . . . . . A .  3 G C2   . . . . . . . . . rr_2l5z 1 
       .  5 .  3440 . 1 1  3 G C2'  C -17.798   9.127 24.444 . . . 1.0 . . . . . . . . . . . . A .  3 G C2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3441 . 1 1  3 G C3'  C -19.040   8.415 23.937 . . . 1.0 . . . . . . . . . . . . A .  3 G C3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3442 . 1 1  3 G C4   C -17.756  12.154 25.987 . . . 1.0 . . . . . . . . . . . . A .  3 G C4   . . . . . . . . . rr_2l5z 1 
       .  5 .  3443 . 1 1  3 G C4'  C -19.342   9.163 22.650 . . . 1.0 . . . . . . . . . . . . A .  3 G C4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3444 . 1 1  3 G C5   C -18.685  12.733 26.840 . . . 1.0 . . . . . . . . . . . . A .  3 G C5   . . . . . . . . . rr_2l5z 1 
       .  5 .  3445 . 1 1  3 G C5'  C -20.807   9.022 22.239 . . . 1.0 . . . . . . . . . . . . A .  3 G C5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3446 . 1 1  3 G C6   C -18.237  13.578 27.891 . . . 1.0 . . . . . . . . . . . . A .  3 G C6   . . . . . . . . . rr_2l5z 1 
       .  5 .  3447 . 1 1  3 G C8   C -19.768  11.583 25.464 . . . 1.0 . . . . . . . . . . . . A .  3 G C8   . . . . . . . . . rr_2l5z 1 
       .  5 .  3448 . 1 1  3 G H1   H -16.448  14.300 28.638 . . . 1.0 . . . . . . . . . . . . A .  3 G H1   . . . . . . . . . rr_2l5z 1 
       .  5 .  3449 . 1 1  3 G H1'  H -17.090  10.972 23.587 . . . 1.0 . . . . . . . . . . . . A .  3 G H1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3450 . 1 1  3 G H2'  H -17.763   9.088 25.536 . . . 1.0 . . . . . . . . . . . . A .  3 G H2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3451 . 1 1  3 G H21  H -14.382  13.913 27.914 . . . 1.0 . . . . . . . . . . . . A .  3 G H21  . . . . . . . . . rr_2l5z 1 
       .  5 .  3452 . 1 1  3 G H22  H -14.023  12.887 26.544 . . . 1.0 . . . . . . . . . . . . A .  3 G H22  . . . . . . . . . rr_2l5z 1 
       .  5 .  3453 . 1 1  3 G H3'  H -19.861   8.472 24.655 . . . 1.0 . . . . . . . . . . . . A .  3 G H3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3454 . 1 1  3 G H4'  H -18.702   8.789 21.852 . . . 1.0 . . . . . . . . . . . . A .  3 G H4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3455 . 1 1  3 G H5'  H -20.950   9.489 21.265 . . . 1.0 . . . . . . . . . . . . A .  3 G H5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3456 . 1 1  3 G H5'' H -21.055   7.964 22.166 . . . 1.0 . . . . . . . . . . . . A .  3 G H5'' . . . . . . . . . rr_2l5z 1 
       .  5 .  3457 . 1 1  3 G H8   H -20.576  11.104 24.932 . . . 1.0 . . . . . . . . . . . . A .  3 G H8   . . . . . . . . . rr_2l5z 1 
       .  5 .  3458 . 1 1  3 G HO2' H -16.687   8.645 22.920 . . . 1.0 . . . . . . . . . . . . A .  3 G HO2' . . . . . . . . . rr_2l5z 1 
       .  5 .  3459 . 1 1  3 G N1   N -16.852  13.695 27.894 . . . 1.0 . . . . . . . . . . . . A .  3 G N1   . . . . . . . . . rr_2l5z 1 
       .  5 .  3460 . 1 1  3 G N2   N -14.696  13.312 27.166 . . . 1.0 . . . . . . . . . . . . A .  3 G N2   . . . . . . . . . rr_2l5z 1 
       .  5 .  3461 . 1 1  3 G N3   N -16.411  12.282 26.009 . . . 1.0 . . . . . . . . . . . . A .  3 G N3   . . . . . . . . . rr_2l5z 1 
       .  5 .  3462 . 1 1  3 G N7   N -19.988  12.349 26.483 . . . 1.0 . . . . . . . . . . . . A .  3 G N7   . . . . . . . . . rr_2l5z 1 
       .  5 .  3463 . 1 1  3 G N9   N -18.485  11.410 25.099 . . . 1.0 . . . . . . . . . . . . A .  3 G N9   . . . . . . . . . rr_2l5z 1 
       .  5 .  3464 . 1 1  3 G O2'  O -16.607   8.572 23.873 . . . 1.0 . . . . . . . . . . . . A .  3 G O2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3465 . 1 1  3 G O3'  O -18.692   7.066 23.613 . . . 1.0 . . . . . . . . . . . . A .  3 G O3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3466 . 1 1  3 G O4'  O -19.002  10.522 22.925 . . . 1.0 . . . . . . . . . . . . A .  3 G O4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3467 . 1 1  3 G O5'  O -21.684   9.641 23.184 . . . 1.0 . . . . . . . . . . . . A .  3 G O5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3468 . 1 1  3 G O6   O -18.909  14.168 28.734 . . . 1.0 . . . . . . . . . . . . A .  3 G O6   . . . . . . . . . rr_2l5z 1 
       .  5 .  3469 . 1 1  3 G OP1  O -23.805   8.775 22.171 . . . 1.0 . . . . . . . . . . . . A .  3 G OP1  . . . . . . . . . rr_2l5z 1 
       .  5 .  3470 . 1 1  3 G OP2  O -23.859  10.627 23.942 . . . 1.0 . . . . . . . . . . . . A .  3 G OP2  . . . . . . . . . rr_2l5z 1 
       .  5 .  3471 . 1 1  3 G P    P -23.204   9.983 22.781 . . . 1.0 . . . . . . . . . . . . A .  3 G P    . . . . . . . . . rr_2l5z 1 
       .  5 .  3472 . 1 1  4 C C1'  C -15.901   8.250 28.300 . . . 1.0 . . . . . . . . . . . . A .  4 C C1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3473 . 1 1  4 C C2   C -16.688  10.084 29.796 . . . 1.0 . . . . . . . . . . . . A .  4 C C2   . . . . . . . . . rr_2l5z 1 
       .  5 .  3474 . 1 1  4 C C2'  C -15.785   6.975 29.149 . . . 1.0 . . . . . . . . . . . . A .  4 C C2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3475 . 1 1  4 C C3'  C -16.224   5.866 28.196 . . . 1.0 . . . . . . . . . . . . A .  4 C C3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3476 . 1 1  4 C C4   C -18.936  10.762 29.788 . . . 1.0 . . . . . . . . . . . . A .  4 C C4   . . . . . . . . . rr_2l5z 1 
       .  5 .  3477 . 1 1  4 C C4'  C -15.890   6.445 26.833 . . . 1.0 . . . . . . . . . . . . A .  4 C C4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3478 . 1 1  4 C C5   C -19.258   9.793 28.787 . . . 1.0 . . . . . . . . . . . . A .  4 C C5   . . . . . . . . . rr_2l5z 1 
       .  5 .  3479 . 1 1  4 C C5'  C -16.707   5.794 25.716 . . . 1.0 . . . . . . . . . . . . A .  4 C C5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3480 . 1 1  4 C C6   C -18.265   9.004 28.332 . . . 1.0 . . . . . . . . . . . . A .  4 C C6   . . . . . . . . . rr_2l5z 1 
       .  5 .  3481 . 1 1  4 C H1'  H -14.941   8.778 28.308 . . . 1.0 . . . . . . . . . . . . A .  4 C H1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3482 . 1 1  4 C H2'  H -16.471   7.032 30.000 . . . 1.0 . . . . . . . . . . . . A .  4 C H2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3483 . 1 1  4 C H3'  H -17.287   5.635 28.298 . . . 1.0 . . . . . . . . . . . . A .  4 C H3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3484 . 1 1  4 C H4'  H -14.827   6.317 26.631 . . . 1.0 . . . . . . . . . . . . A .  4 C H4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3485 . 1 1  4 C H41  H -19.670  12.245 30.973 . . . 1.0 . . . . . . . . . . . . A .  4 C H41  . . . . . . . . . rr_2l5z 1 
       .  5 .  3486 . 1 1  4 C H42  H -20.837  11.476 29.922 . . . 1.0 . . . . . . . . . . . . A .  4 C H42  . . . . . . . . . rr_2l5z 1 
       .  5 .  3487 . 1 1  4 C H5   H -20.265   9.698 28.409 . . . 1.0 . . . . . . . . . . . . A .  4 C H5   . . . . . . . . . rr_2l5z 1 
       .  5 .  3488 . 1 1  4 C H5'  H -16.358   6.171 24.754 . . . 1.0 . . . . . . . . . . . . A .  4 C H5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3489 . 1 1  4 C H5'' H -16.559   4.715 25.749 . . . 1.0 . . . . . . . . . . . . A .  4 C H5'' . . . . . . . . . rr_2l5z 1 
       .  5 .  3490 . 1 1  4 C H6   H -18.485   8.236 27.602 . . . 1.0 . . . . . . . . . . . . A .  4 C H6   . . . . . . . . . rr_2l5z 1 
       .  5 .  3491 . 1 1  4 C HO2' H -14.107   7.619 29.896 . . . 1.0 . . . . . . . . . . . . A .  4 C HO2' . . . . . . . . . rr_2l5z 1 
       .  5 .  3492 . 1 1  4 C N1   N -16.992   9.133 28.814 . . . 1.0 . . . . . . . . . . . . A .  4 C N1   . . . . . . . . . rr_2l5z 1 
       .  5 .  3493 . 1 1  4 C N3   N -17.689  10.881 30.257 . . . 1.0 . . . . . . . . . . . . A .  4 C N3   . . . . . . . . . rr_2l5z 1 
       .  5 .  3494 . 1 1  4 C N4   N -19.892  11.559 30.266 . . . 1.0 . . . . . . . . . . . . A .  4 C N4   . . . . . . . . . rr_2l5z 1 
       .  5 .  3495 . 1 1  4 C O2   O -15.539  10.183 30.224 . . . 1.0 . . . . . . . . . . . . A .  4 C O2   . . . . . . . . . rr_2l5z 1 
       .  5 .  3496 . 1 1  4 C O2'  O -14.441   6.770 29.599 . . . 1.0 . . . . . . . . . . . . A .  4 C O2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3497 . 1 1  4 C O3'  O -15.397   4.720 28.416 . . . 1.0 . . . . . . . . . . . . A .  4 C O3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3498 . 1 1  4 C O4'  O -16.180   7.830 26.955 . . . 1.0 . . . . . . . . . . . . A .  4 C O4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3499 . 1 1  4 C O5'  O -18.102   6.077 25.848 . . . 1.0 . . . . . . . . . . . . A .  4 C O5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3500 . 1 1  4 C OP1  O -18.744   4.583 23.943 . . . 1.0 . . . . . . . . . . . . A .  4 C OP1  . . . . . . . . . rr_2l5z 1 
       .  5 .  3501 . 1 1  4 C OP2  O -20.483   6.090 25.070 . . . 1.0 . . . . . . . . . . . . A .  4 C OP2  . . . . . . . . . rr_2l5z 1 
       .  5 .  3502 . 1 1  4 C P    P -19.098   5.860 24.601 . . . 1.0 . . . . . . . . . . . . A .  4 C P    . . . . . . . . . rr_2l5z 1 
       .  5 .  3503 . 1 1  5 U C1'  C -15.273   7.012 33.442 . . . 1.0 . . . . . . . . . . . . A .  5 U C1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3504 . 1 1  5 U C2   C -17.321   8.266 34.077 . . . 1.0 . . . . . . . . . . . . A .  5 U C2   . . . . . . . . . rr_2l5z 1 
       .  5 .  3505 . 1 1  5 U C2'  C -14.993   6.017 34.576 . . . 1.0 . . . . . . . . . . . . A .  5 U C2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3506 . 1 1  5 U C3'  C -14.668   4.726 33.838 . . . 1.0 . . . . . . . . . . . . A .  5 U C3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3507 . 1 1  5 U C4   C -19.511   7.708 33.088 . . . 1.0 . . . . . . . . . . . . A .  5 U C4   . . . . . . . . . rr_2l5z 1 
       .  5 .  3508 . 1 1  5 U C4'  C -14.060   5.221 32.532 . . . 1.0 . . . . . . . . . . . . A .  5 U C4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3509 . 1 1  5 U C5   C -18.826   6.685 32.329 . . . 1.0 . . . . . . . . . . . . A .  5 U C5   . . . . . . . . . rr_2l5z 1 
       .  5 .  3510 . 1 1  5 U C5'  C -14.216   4.207 31.398 . . . 1.0 . . . . . . . . . . . . A .  5 U C5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3511 . 1 1  5 U C6   C -17.490   6.498 32.457 . . . 1.0 . . . . . . . . . . . . A .  5 U C6   . . . . . . . . . rr_2l5z 1 
       .  5 .  3512 . 1 1  5 U H1'  H -14.738   7.947 33.639 . . . 1.0 . . . . . . . . . . . . A .  5 U H1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3513 . 1 1  5 U H2'  H -15.893   5.883 35.187 . . . 1.0 . . . . . . . . . . . . A .  5 U H2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3514 . 1 1  5 U H3   H -19.136   9.174 34.506 . . . 1.0 . . . . . . . . . . . . A .  5 U H3   . . . . . . . . . rr_2l5z 1 
       .  5 .  3515 . 1 1  5 U H3'  H -15.558   4.113 33.681 . . . 1.0 . . . . . . . . . . . . A .  5 U H3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3516 . 1 1  5 U H4'  H -13.004   5.439 32.682 . . . 1.0 . . . . . . . . . . . . A .  5 U H4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3517 . 1 1  5 U H5   H -19.393   6.039 31.675 . . . 1.0 . . . . . . . . . . . . A .  5 U H5   . . . . . . . . . rr_2l5z 1 
       .  5 .  3518 . 1 1  5 U H5'  H -13.518   4.456 30.599 . . . 1.0 . . . . . . . . . . . . A .  5 U H5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3519 . 1 1  5 U H5'' H -13.986   3.208 31.772 . . . 1.0 . . . . . . . . . . . . A .  5 U H5'' . . . . . . . . . rr_2l5z 1 
       .  5 .  3520 . 1 1  5 U H6   H -17.008   5.726 31.876 . . . 1.0 . . . . . . . . . . . . A .  5 U H6   . . . . . . . . . rr_2l5z 1 
       .  5 .  3521 . 1 1  5 U HO2' H -13.438   7.143 34.905 . . . 1.0 . . . . . . . . . . . . A .  5 U HO2' . . . . . . . . . rr_2l5z 1 
       .  5 .  3522 . 1 1  5 U N1   N -16.738   7.263 33.308 . . . 1.0 . . . . . . . . . . . . A .  5 U N1   . . . . . . . . . rr_2l5z 1 
       .  5 .  3523 . 1 1  5 U N3   N -18.685   8.437 33.925 . . . 1.0 . . . . . . . . . . . . A .  5 U N3   . . . . . . . . . rr_2l5z 1 
       .  5 .  3524 . 1 1  5 U O2   O -16.663   8.962 34.845 . . . 1.0 . . . . . . . . . . . . A .  5 U O2   . . . . . . . . . rr_2l5z 1 
       .  5 .  3525 . 1 1  5 U O2'  O -13.891   6.446 35.385 . . . 1.0 . . . . . . . . . . . . A .  5 U O2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3526 . 1 1  5 U O3'  O -13.654   4.031 34.570 . . . 1.0 . . . . . . . . . . . . A .  5 U O3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3527 . 1 1  5 U O4   O -20.714   7.949 33.027 . . . 1.0 . . . . . . . . . . . . A .  5 U O4   . . . . . . . . . rr_2l5z 1 
       .  5 .  3528 . 1 1  5 U O4'  O -14.749   6.431 32.235 . . . 1.0 . . . . . . . . . . . . A .  5 U O4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3529 . 1 1  5 U O5'  O -15.547   4.214 30.871 . . . 1.0 . . . . . . . . . . . . A .  5 U O5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3530 . 1 1  5 U OP1  O -14.966   2.395 29.249 . . . 1.0 . . . . . . . . . . . . A .  5 U OP1  . . . . . . . . . rr_2l5z 1 
       .  5 .  3531 . 1 1  5 U OP2  O -17.325   3.394 29.310 . . . 1.0 . . . . . . . . . . . . A .  5 U OP2  . . . . . . . . . rr_2l5z 1 
       .  5 .  3532 . 1 1  5 U P    P -15.860   3.561 29.435 . . . 1.0 . . . . . . . . . . . . A .  5 U P    . . . . . . . . . rr_2l5z 1 
       .  5 .  3533 . 1 1  6 G C1'  C -18.278   5.285 37.930 . . . 1.0 . . . . . . . . . . . . A .  6 G C1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3534 . 1 1  6 G C2   C -20.624   9.015 37.479 . . . 1.0 . . . . . . . . . . . . A .  6 G C2   . . . . . . . . . rr_2l5z 1 
       .  5 .  3535 . 1 1  6 G C2'  C -18.848   4.214 38.870 . . . 1.0 . . . . . . . . . . . . A .  6 G C2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3536 . 1 1  6 G C3'  C -17.878   3.031 38.722 . . . 1.0 . . . . . . . . . . . . A .  6 G C3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3537 . 1 1  6 G C4   C -19.983   6.947 36.939 . . . 1.0 . . . . . . . . . . . . A .  6 G C4   . . . . . . . . . rr_2l5z 1 
       .  5 .  3538 . 1 1  6 G C4'  C -16.650   3.660 38.071 . . . 1.0 . . . . . . . . . . . . A .  6 G C4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3539 . 1 1  6 G C5   C -20.857   6.845 35.867 . . . 1.0 . . . . . . . . . . . . A .  6 G C5   . . . . . . . . . rr_2l5z 1 
       .  5 .  3540 . 1 1  6 G C5'  C -15.832   2.644 37.268 . . . 1.0 . . . . . . . . . . . . A .  6 G C5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3541 . 1 1  6 G C6   C -21.712   7.936 35.554 . . . 1.0 . . . . . . . . . . . . A .  6 G C6   . . . . . . . . . rr_2l5z 1 
       .  5 .  3542 . 1 1  6 G C8   C -19.808   5.034 35.959 . . . 1.0 . . . . . . . . . . . . A .  6 G C8   . . . . . . . . . rr_2l5z 1 
       .  5 .  3543 . 1 1  6 G H1   H -22.114   9.836 36.263 . . . 1.0 . . . . . . . . . . . . A .  6 G H1   . . . . . . . . . rr_2l5z 1 
       .  5 .  3544 . 1 1  6 G H1'  H -17.923   6.128 38.521 . . . 1.0 . . . . . . . . . . . . A .  6 G H1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3545 . 1 1  6 G H2'  H -19.852   3.929 38.536 . . . 1.0 . . . . . . . . . . . . A .  6 G H2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3546 . 1 1  6 G H21  H -21.202  10.901 37.980 . . . 1.0 . . . . . . . . . . . . A .  6 G H21  . . . . . . . . . rr_2l5z 1 
       .  5 .  3547 . 1 1  6 G H22  H -19.957  10.203 38.990 . . . 1.0 . . . . . . . . . . . . A .  6 G H22  . . . . . . . . . rr_2l5z 1 
       .  5 .  3548 . 1 1  6 G H3'  H -18.304   2.221 38.119 . . . 1.0 . . . . . . . . . . . . A .  6 G H3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3549 . 1 1  6 G H4'  H -16.019   4.105 38.840 . . . 1.0 . . . . . . . . . . . . A .  6 G H4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3550 . 1 1  6 G H5'  H -15.557   1.814 37.920 . . . 1.0 . . . . . . . . . . . . A .  6 G H5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3551 . 1 1  6 G H5'' H -16.440   2.264 36.448 . . . 1.0 . . . . . . . . . . . . A .  6 G H5'' . . . . . . . . . rr_2l5z 1 
       .  5 .  3552 . 1 1  6 G H8   H -19.459   4.035 35.748 . . . 1.0 . . . . . . . . . . . . A .  6 G H8   . . . . . . . . . rr_2l5z 1 
       .  5 .  3553 . 1 1  6 G HO2' H -18.439   5.532 40.244 . . . 1.0 . . . . . . . . . . . . A .  6 G HO2' . . . . . . . . . rr_2l5z 1 
       .  5 .  3554 . 1 1  6 G N1   N -21.523   8.998 36.431 . . . 1.0 . . . . . . . . . . . . A .  6 G N1   . . . . . . . . . rr_2l5z 1 
       .  5 .  3555 . 1 1  6 G N2   N -20.592  10.130 38.209 . . . 1.0 . . . . . . . . . . . . A .  6 G N2   . . . . . . . . . rr_2l5z 1 
       .  5 .  3556 . 1 1  6 G N3   N -19.815   7.993 37.781 . . . 1.0 . . . . . . . . . . . . A .  6 G N3   . . . . . . . . . rr_2l5z 1 
       .  5 .  3557 . 1 1  6 G N7   N -20.727   5.593 35.242 . . . 1.0 . . . . . . . . . . . . A .  6 G N7   . . . . . . . . . rr_2l5z 1 
       .  5 .  3558 . 1 1  6 G N9   N -19.309   5.753 36.981 . . . 1.0 . . . . . . . . . . . . A .  6 G N9   . . . . . . . . . rr_2l5z 1 
       .  5 .  3559 . 1 1  6 G O2'  O -18.886   4.682 40.223 . . . 1.0 . . . . . . . . . . . . A .  6 G O2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3560 . 1 1  6 G O3'  O -17.512   2.592 40.033 . . . 1.0 . . . . . . . . . . . . A .  6 G O3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3561 . 1 1  6 G O4'  O -17.172   4.689 37.247 . . . 1.0 . . . . . . . . . . . . A .  6 G O4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3562 . 1 1  6 G O5'  O -14.643   3.229 36.735 . . . 1.0 . . . . . . . . . . . . A .  6 G O5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3563 . 1 1  6 G O6   O -22.545   8.019 34.654 . . . 1.0 . . . . . . . . . . . . A .  6 G O6   . . . . . . . . . rr_2l5z 1 
       .  5 .  3564 . 1 1  6 G OP1  O -12.734   1.988 35.691 . . . 1.0 . . . . . . . . . . . . A .  6 G OP1  . . . . . . . . . rr_2l5z 1 
       .  5 .  3565 . 1 1  6 G OP2  O -15.061   1.959 34.617 . . . 1.0 . . . . . . . . . . . . A .  6 G OP2  . . . . . . . . . rr_2l5z 1 
       .  5 .  3566 . 1 1  6 G P    P -14.004   2.676 35.365 . . . 1.0 . . . . . . . . . . . . A .  6 G P    . . . . . . . . . rr_2l5z 1 
       .  5 .  3567 . 1 1  7 C C1'  C -18.531   3.806 44.724 . . . 1.0 . . . . . . . . . . . . A .  7 C C1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3568 . 1 1  7 C C2   C -20.884   4.505 44.763 . . . 1.0 . . . . . . . . . . . . A .  7 C C2   . . . . . . . . . rr_2l5z 1 
       .  5 .  3569 . 1 1  7 C C2'  C -18.607   2.544 45.585 . . . 1.0 . . . . . . . . . . . . A .  7 C C2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3570 . 1 1  7 C C3'  C -17.915   1.511 44.718 . . . 1.0 . . . . . . . . . . . . A .  7 C C3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3571 . 1 1  7 C C4   C -22.199   4.474 42.817 . . . 1.0 . . . . . . . . . . . . A .  7 C C4   . . . . . . . . . rr_2l5z 1 
       .  5 .  3572 . 1 1  7 C C4'  C -16.848   2.336 44.013 . . . 1.0 . . . . . . . . . . . . A .  7 C C4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3573 . 1 1  7 C C5   C -21.097   3.989 42.045 . . . 1.0 . . . . . . . . . . . . A .  7 C C5   . . . . . . . . . rr_2l5z 1 
       .  5 .  3574 . 1 1  7 C C5'  C -16.400   1.691 42.702 . . . 1.0 . . . . . . . . . . . . A .  7 C C5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3575 . 1 1  7 C C6   C -19.928   3.785 42.681 . . . 1.0 . . . . . . . . . . . . A .  7 C C6   . . . . . . . . . rr_2l5z 1 
       .  5 .  3576 . 1 1  7 C H1'  H -18.305   4.664 45.358 . . . 1.0 . . . . . . . . . . . . A .  7 C H1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3577 . 1 1  7 C H2'  H -19.651   2.262 45.744 . . . 1.0 . . . . . . . . . . . . A .  7 C H2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3578 . 1 1  7 C H3'  H -18.608   1.041 44.017 . . . 1.0 . . . . . . . . . . . . A .  7 C H3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3579 . 1 1  7 C H4'  H -15.989   2.460 44.672 . . . 1.0 . . . . . . . . . . . . A .  7 C H4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3580 . 1 1  7 C H41  H -24.156   5.032 42.768 . . . 1.0 . . . . . . . . . . . . A .  7 C H41  . . . . . . . . . rr_2l5z 1 
       .  5 .  3581 . 1 1  7 C H42  H -23.484   4.512 41.239 . . . 1.0 . . . . . . . . . . . . A .  7 C H42  . . . . . . . . . rr_2l5z 1 
       .  5 .  3582 . 1 1  7 C H5   H -21.200   3.794 40.987 . . . 1.0 . . . . . . . . . . . . A .  7 C H5   . . . . . . . . . rr_2l5z 1 
       .  5 .  3583 . 1 1  7 C H5'  H -15.973   2.459 42.056 . . . 1.0 . . . . . . . . . . . . A .  7 C H5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3584 . 1 1  7 C H5'' H -15.638   0.942 42.915 . . . 1.0 . . . . . . . . . . . . A .  7 C H5'' . . . . . . . . . rr_2l5z 1 
       .  5 .  3585 . 1 1  7 C H6   H -19.077   3.414 42.129 . . . 1.0 . . . . . . . . . . . . A .  7 C H6   . . . . . . . . . rr_2l5z 1 
       .  5 .  3586 . 1 1  7 C HO2' H -17.844   1.854 47.239 . . . 1.0 . . . . . . . . . . . . A .  7 C HO2' . . . . . . . . . rr_2l5z 1 
       .  5 .  3587 . 1 1  7 C N1   N -19.810   4.035 44.018 . . . 1.0 . . . . . . . . . . . . A .  7 C N1   . . . . . . . . . rr_2l5z 1 
       .  5 .  3588 . 1 1  7 C N3   N -22.069   4.714 44.129 . . . 1.0 . . . . . . . . . . . . A .  7 C N3   . . . . . . . . . rr_2l5z 1 
       .  5 .  3589 . 1 1  7 C N4   N -23.374   4.690 42.228 . . . 1.0 . . . . . . . . . . . . A .  7 C N4   . . . . . . . . . rr_2l5z 1 
       .  5 .  3590 . 1 1  7 C O2   O -20.752   4.721 45.967 . . . 1.0 . . . . . . . . . . . . A .  7 C O2   . . . . . . . . . rr_2l5z 1 
       .  5 .  3591 . 1 1  7 C O2'  O -17.928   2.721 46.834 . . . 1.0 . . . . . . . . . . . . A .  7 C O2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3592 . 1 1  7 C O3'  O -17.272   0.559 45.570 . . . 1.0 . . . . . . . . . . . . A .  7 C O3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3593 . 1 1  7 C O4'  O -17.454   3.610 43.790 . . . 1.0 . . . . . . . . . . . . A .  7 C O4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3594 . 1 1  7 C O5'  O -17.495   1.062 42.025 . . . 1.0 . . . . . . . . . . . . A .  7 C O5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3595 . 1 1  7 C OP1  O -16.318   0.391 39.917 . . . 1.0 . . . . . . . . . . . . A .  7 C OP1  . . . . . . . . . rr_2l5z 1 
       .  5 .  3596 . 1 1  7 C OP2  O -18.877   0.491 40.016 . . . 1.0 . . . . . . . . . . . . A .  7 C OP2  . . . . . . . . . rr_2l5z 1 
       .  5 .  3597 . 1 1  7 C P    P -17.558   1.028 40.416 . . . 1.0 . . . . . . . . . . . . A .  7 C P    . . . . . . . . . rr_2l5z 1 
       .  5 .  3598 . 1 1  8 A C1'  C -22.860   0.270 44.246 . . . 1.0 . . . . . . . . . . . . A .  8 A C1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3599 . 1 1  8 A C2   C -26.068   3.294 43.945 . . . 1.0 . . . . . . . . . . . . A .  8 A C2   . . . . . . . . . rr_2l5z 1 
       .  5 .  3600 . 1 1  8 A C2'  C -21.614   0.635 43.457 . . . 1.0 . . . . . . . . . . . . A .  8 A C2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3601 . 1 1  8 A C3'  C -20.994  -0.728 43.201 . . . 1.0 . . . . . . . . . . . . A .  8 A C3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3602 . 1 1  8 A C4   C -24.339   2.283 44.875 . . . 1.0 . . . . . . . . . . . . A .  8 A C4   . . . . . . . . . rr_2l5z 1 
       .  5 .  3603 . 1 1  8 A C4'  C -21.393  -1.552 44.444 . . . 1.0 . . . . . . . . . . . . A .  8 A C4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3604 . 1 1  8 A C5   C -24.318   3.140 45.951 . . . 1.0 . . . . . . . . . . . . A .  8 A C5   . . . . . . . . . rr_2l5z 1 
       .  5 .  3605 . 1 1  8 A C5'  C -20.242  -1.717 45.449 . . . 1.0 . . . . . . . . . . . . A .  8 A C5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3606 . 1 1  8 A C6   C -25.290   4.146 45.966 . . . 1.0 . . . . . . . . . . . . A .  8 A C6   . . . . . . . . . rr_2l5z 1 
       .  5 .  3607 . 1 1  8 A C8   C -22.754   1.780 46.245 . . . 1.0 . . . . . . . . . . . . A .  8 A C8   . . . . . . . . . rr_2l5z 1 
       .  5 .  3608 . 1 1  8 A H1'  H -23.656  -0.014 43.557 . . . 1.0 . . . . . . . . . . . . A .  8 A H1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3609 . 1 1  8 A H2   H -26.799   3.388 43.142 . . . 1.0 . . . . . . . . . . . . A .  8 A H2   . . . . . . . . . rr_2l5z 1 
       .  5 .  3610 . 1 1  8 A H2'  H -20.947   1.244 44.071 . . . 1.0 . . . . . . . . . . . . A .  8 A H2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3611 . 1 1  8 A H3'  H -19.910  -0.658 43.051 . . . 1.0 . . . . . . . . . . . . A .  8 A H3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3612 . 1 1  8 A H4'  H -21.731  -2.536 44.126 . . . 1.0 . . . . . . . . . . . . A .  8 A H4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3613 . 1 1  8 A H5'  H -20.645  -2.084 46.394 . . . 1.0 . . . . . . . . . . . . A .  8 A H5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3614 . 1 1  8 A H5'' H -19.533  -2.448 45.059 . . . 1.0 . . . . . . . . . . . . A .  8 A H5'' . . . . . . . . . rr_2l5z 1 
       .  5 .  3615 . 1 1  8 A H61  H -26.112   5.756 46.902 . . . 1.0 . . . . . . . . . . . . A .  8 A H61  . . . . . . . . . rr_2l5z 1 
       .  5 .  3616 . 1 1  8 A H62  H -24.746   5.028 47.718 . . . 1.0 . . . . . . . . . . . . A .  8 A H62  . . . . . . . . . rr_2l5z 1 
       .  5 .  3617 . 1 1  8 A H8   H -21.908   1.259 46.665 . . . 1.0 . . . . . . . . . . . . A .  8 A H8   . . . . . . . . . rr_2l5z 1 
       .  5 .  3618 . 1 1  8 A HO2' H -22.731   1.827 42.398 . . . 1.0 . . . . . . . . . . . . A .  8 A HO2' . . . . . . . . . rr_2l5z 1 
       .  5 .  3619 . 1 1  8 A N1   N -26.153   4.187 44.933 . . . 1.0 . . . . . . . . . . . . A .  8 A N1   . . . . . . . . . rr_2l5z 1 
       .  5 .  3620 . 1 1  8 A N3   N -25.190   2.302 43.830 . . . 1.0 . . . . . . . . . . . . A .  8 A N3   . . . . . . . . . rr_2l5z 1 
       .  5 .  3621 . 1 1  8 A N6   N -25.391   5.049 46.941 . . . 1.0 . . . . . . . . . . . . A .  8 A N6   . . . . . . . . . rr_2l5z 1 
       .  5 .  3622 . 1 1  8 A N7   N -23.281   2.802 46.838 . . . 1.0 . . . . . . . . . . . . A .  8 A N7   . . . . . . . . . rr_2l5z 1 
       .  5 .  3623 . 1 1  8 A N9   N -23.311   1.400 45.081 . . . 1.0 . . . . . . . . . . . . A .  8 A N9   . . . . . . . . . rr_2l5z 1 
       .  5 .  3624 . 1 1  8 A O2'  O -21.944   1.302 42.234 . . . 1.0 . . . . . . . . . . . . A .  8 A O2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3625 . 1 1  8 A O3'  O -21.649  -1.301 42.066 . . . 1.0 . . . . . . . . . . . . A .  8 A O3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3626 . 1 1  8 A O4'  O -22.496  -0.858 45.049 . . . 1.0 . . . . . . . . . . . . A .  8 A O4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3627 . 1 1  8 A O5'  O -19.559  -0.482 45.680 . . . 1.0 . . . . . . . . . . . . A .  8 A O5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3628 . 1 1  8 A OP1  O -18.358   0.142 47.788 . . . 1.0 . . . . . . . . . . . . A .  8 A OP1  . . . . . . . . . rr_2l5z 1 
       .  5 .  3629 . 1 1  8 A OP2  O -17.540  -1.809 46.343 . . . 1.0 . . . . . . . . . . . . A .  8 A OP2  . . . . . . . . . rr_2l5z 1 
       .  5 .  3630 . 1 1  8 A P    P -18.146  -0.463 46.455 . . . 1.0 . . . . . . . . . . . . A .  8 A P    . . . . . . . . . rr_2l5z 1 
       .  5 .  3631 . 1 1  9 G C1'  C -23.753   1.838 39.847 . . . 1.0 . . . . . . . . . . . . A .  9 G C1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3632 . 1 1  9 G C2   C -24.974   6.079 39.766 . . . 1.0 . . . . . . . . . . . . A .  9 G C2   . . . . . . . . . rr_2l5z 1 
       .  5 .  3633 . 1 1  9 G C2'  C -25.033   0.995 39.782 . . . 1.0 . . . . . . . . . . . . A .  9 G C2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3634 . 1 1  9 G C3'  C -24.539  -0.377 39.336 . . . 1.0 . . . . . . . . . . . . A .  9 G C3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3635 . 1 1  9 G C4   C -24.179   4.189 38.896 . . . 1.0 . . . . . . . . . . . . A .  9 G C4   . . . . . . . . . rr_2l5z 1 
       .  5 .  3636 . 1 1  9 G C4'  C -23.098  -0.395 39.828 . . . 1.0 . . . . . . . . . . . . A .  9 G C4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3637 . 1 1  9 G C5   C -24.017   4.717 37.623 . . . 1.0 . . . . . . . . . . . . A .  9 G C5   . . . . . . . . . rr_2l5z 1 
       .  5 .  3638 . 1 1  9 G C5'  C -22.233  -1.376 39.038 . . . 1.0 . . . . . . . . . . . . A .  9 G C5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3639 . 1 1  9 G C6   C -24.369   6.072 37.380 . . . 1.0 . . . . . . . . . . . . A .  9 G C6   . . . . . . . . . rr_2l5z 1 
       .  5 .  3640 . 1 1  9 G C8   C -23.386   2.721 37.530 . . . 1.0 . . . . . . . . . . . . A .  9 G C8   . . . . . . . . . rr_2l5z 1 
       .  5 .  3641 . 1 1  9 G H1   H -25.138   7.683 38.431 . . . 1.0 . . . . . . . . . . . . A .  9 G H1   . . . . . . . . . rr_2l5z 1 
       .  5 .  3642 . 1 1  9 G H1'  H -23.681   2.306 40.829 . . . 1.0 . . . . . . . . . . . . A .  9 G H1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3643 . 1 1  9 G H2'  H -25.714   1.412 39.034 . . . 1.0 . . . . . . . . . . . . A .  9 G H2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3644 . 1 1  9 G H21  H -25.689   7.800 40.583 . . . 1.0 . . . . . . . . . . . . A .  9 G H21  . . . . . . . . . rr_2l5z 1 
       .  5 .  3645 . 1 1  9 G H22  H -25.546   6.447 41.684 . . . 1.0 . . . . . . . . . . . . A .  9 G H22  . . . . . . . . . rr_2l5z 1 
       .  5 .  3646 . 1 1  9 G H3'  H -24.610  -0.506 38.252 . . . 1.0 . . . . . . . . . . . . A .  9 G H3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3647 . 1 1  9 G H4'  H -23.076  -0.657 40.884 . . . 1.0 . . . . . . . . . . . . A .  9 G H4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3648 . 1 1  9 G H5'  H -22.751  -2.332 38.972 . . . 1.0 . . . . . . . . . . . . A .  9 G H5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3649 . 1 1  9 G H5'' H -22.079  -0.984 38.032 . . . 1.0 . . . . . . . . . . . . A .  9 G H5'' . . . . . . . . . rr_2l5z 1 
       .  5 .  3650 . 1 1  9 G H8   H -23.007   1.775 37.171 . . . 1.0 . . . . . . . . . . . . A .  9 G H8   . . . . . . . . . rr_2l5z 1 
       .  5 .  3651 . 1 1  9 G HO2' H -26.619   0.993 40.913 . . . 1.0 . . . . . . . . . . . . A .  9 G HO2' . . . . . . . . . rr_2l5z 1 
       .  5 .  3652 . 1 1  9 G N1   N -24.848   6.688 38.532 . . . 1.0 . . . . . . . . . . . . A .  9 G N1   . . . . . . . . . rr_2l5z 1 
       .  5 .  3653 . 1 1  9 G N2   N -25.440   6.837 40.758 . . . 1.0 . . . . . . . . . . . . A .  9 G N2   . . . . . . . . . rr_2l5z 1 
       .  5 .  3654 . 1 1  9 G N3   N -24.646   4.806 40.000 . . . 1.0 . . . . . . . . . . . . A .  9 G N3   . . . . . . . . . rr_2l5z 1 
       .  5 .  3655 . 1 1  9 G N7   N -23.499   3.745 36.748 . . . 1.0 . . . . . . . . . . . . A .  9 G N7   . . . . . . . . . rr_2l5z 1 
       .  5 .  3656 . 1 1  9 G N9   N -23.763   2.887 38.810 . . . 1.0 . . . . . . . . . . . . A .  9 G N9   . . . . . . . . . rr_2l5z 1 
       .  5 .  3657 . 1 1  9 G O2'  O -25.673   0.925 41.062 . . . 1.0 . . . . . . . . . . . . A .  9 G O2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3658 . 1 1  9 G O3'  O -25.277  -1.374 40.049 . . . 1.0 . . . . . . . . . . . . A .  9 G O3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3659 . 1 1  9 G O4'  O -22.644   0.943 39.669 . . . 1.0 . . . . . . . . . . . . A .  9 G O4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3660 . 1 1  9 G O5'  O -20.963  -1.576 39.662 . . . 1.0 . . . . . . . . . . . . A .  9 G O5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3661 . 1 1  9 G O6   O -24.293   6.703 36.328 . . . 1.0 . . . . . . . . . . . . A .  9 G O6   . . . . . . . . . rr_2l5z 1 
       .  5 .  3662 . 1 1  9 G OP1  O -21.628  -3.575 41.016 . . . 1.0 . . . . . . . . . . . . A .  9 G OP1  . . . . . . . . . rr_2l5z 1 
       .  5 .  3663 . 1 1  9 G OP2  O -19.439  -2.335 41.499 . . . 1.0 . . . . . . . . . . . . A .  9 G OP2  . . . . . . . . . rr_2l5z 1 
       .  5 .  3664 . 1 1  9 G P    P -20.860  -2.312 41.091 . . . 1.0 . . . . . . . . . . . . A .  9 G P    . . . . . . . . . rr_2l5z 1 
       .  5 .  3665 . 1 1 10 C C1'  C -29.048   2.369 40.641 . . . 1.0 . . . . . . . . . . . . A . 10 C C1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3666 . 1 1 10 C C2   C -29.856   3.393 38.553 . . . 1.0 . . . . . . . . . . . . A . 10 C C2   . . . . . . . . . rr_2l5z 1 
       .  5 .  3667 . 1 1 10 C C2'  C -30.343   1.832 41.245 . . . 1.0 . . . . . . . . . . . . A . 10 C C2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3668 . 1 1 10 C C3'  C -30.018   0.364 41.449 . . . 1.0 . . . . . . . . . . . . A . 10 C C3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3669 . 1 1 10 C C4   C -29.298   2.490 36.458 . . . 1.0 . . . . . . . . . . . . A . 10 C C4   . . . . . . . . . rr_2l5z 1 
       .  5 .  3670 . 1 1 10 C C4'  C -28.540   0.403 41.826 . . . 1.0 . . . . . . . . . . . . A . 10 C C4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3671 . 1 1 10 C C5   C -28.544   1.442 37.076 . . . 1.0 . . . . . . . . . . . . A . 10 C C5   . . . . . . . . . rr_2l5z 1 
       .  5 .  3672 . 1 1 10 C C5'  C -27.822  -0.904 41.480 . . . 1.0 . . . . . . . . . . . . A . 10 C C5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3673 . 1 1 10 C C6   C -28.483   1.424 38.423 . . . 1.0 . . . . . . . . . . . . A . 10 C C6   . . . . . . . . . rr_2l5z 1 
       .  5 .  3674 . 1 1 10 C H1'  H -28.862   3.381 41.007 . . . 1.0 . . . . . . . . . . . . A . 10 C H1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3675 . 1 1 10 C H2'  H -31.163   1.940 40.531 . . . 1.0 . . . . . . . . . . . . A . 10 C H2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3676 . 1 1 10 C H3'  H -30.206  -0.220 40.546 . . . 1.0 . . . . . . . . . . . . A . 10 C H3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3677 . 1 1 10 C H4'  H -28.443   0.599 42.892 . . . 1.0 . . . . . . . . . . . . A . 10 C H4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3678 . 1 1 10 C H41  H -29.910   3.290 34.690 . . . 1.0 . . . . . . . . . . . . A . 10 C H41  . . . . . . . . . rr_2l5z 1 
       .  5 .  3679 . 1 1 10 C H42  H -28.908   1.862 34.562 . . . 1.0 . . . . . . . . . . . . A . 10 C H42  . . . . . . . . . rr_2l5z 1 
       .  5 .  3680 . 1 1 10 C H5   H -28.041   0.692 36.484 . . . 1.0 . . . . . . . . . . . . A . 10 C H5   . . . . . . . . . rr_2l5z 1 
       .  5 .  3681 . 1 1 10 C H5'  H -26.802  -0.860 41.861 . . . 1.0 . . . . . . . . . . . . A . 10 C H5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3682 . 1 1 10 C H5'' H -28.344  -1.733 41.957 . . . 1.0 . . . . . . . . . . . . A . 10 C H5'' . . . . . . . . . rr_2l5z 1 
       .  5 .  3683 . 1 1 10 C H6   H -27.929   0.640 38.922 . . . 1.0 . . . . . . . . . . . . A . 10 C H6   . . . . . . . . . rr_2l5z 1 
       .  5 .  3684 . 1 1 10 C HO2' H -31.011   1.812 43.074 . . . 1.0 . . . . . . . . . . . . A . 10 C HO2' . . . . . . . . . rr_2l5z 1 
       .  5 .  3685 . 1 1 10 C N1   N -29.122   2.379 39.161 . . . 1.0 . . . . . . . . . . . . A . 10 C N1   . . . . . . . . . rr_2l5z 1 
       .  5 .  3686 . 1 1 10 C N3   N -29.923   3.417 37.194 . . . 1.0 . . . . . . . . . . . . A . 10 C N3   . . . . . . . . . rr_2l5z 1 
       .  5 .  3687 . 1 1 10 C N4   N -29.379   2.553 35.130 . . . 1.0 . . . . . . . . . . . . A . 10 C N4   . . . . . . . . . rr_2l5z 1 
       .  5 .  3688 . 1 1 10 C O2   O -30.427   4.239 39.239 . . . 1.0 . . . . . . . . . . . . A . 10 C O2   . . . . . . . . . rr_2l5z 1 
       .  5 .  3689 . 1 1 10 C O2'  O -30.653   2.480 42.485 . . . 1.0 . . . . . . . . . . . . A . 10 C O2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3690 . 1 1 10 C O3'  O -30.764  -0.112 42.572 . . . 1.0 . . . . . . . . . . . . A . 10 C O3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3691 . 1 1 10 C O4'  O -27.991   1.504 41.096 . . . 1.0 . . . . . . . . . . . . A . 10 C O4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3692 . 1 1 10 C O5'  O -27.783  -1.128 40.067 . . . 1.0 . . . . . . . . . . . . A . 10 C O5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3693 . 1 1 10 C OP1  O -26.743  -3.402 39.917 . . . 1.0 . . . . . . . . . . . . A . 10 C OP1  . . . . . . . . . rr_2l5z 1 
       .  5 .  3694 . 1 1 10 C OP2  O -26.596  -1.761 37.955 . . . 1.0 . . . . . . . . . . . . A . 10 C OP2  . . . . . . . . . rr_2l5z 1 
       .  5 .  3695 . 1 1 10 C P    P -26.610  -2.017 39.412 . . . 1.0 . . . . . . . . . . . . A . 10 C P    . . . . . . . . . rr_2l5z 1 
       .  5 .  3696 . 1 1 11 A C1'  C -35.514   2.618 40.206 . . . 1.0 . . . . . . . . . . . . A . 11 A C1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3697 . 1 1 11 A C2   C -35.360   4.195 36.070 . . . 1.0 . . . . . . . . . . . . A . 11 A C2   . . . . . . . . . rr_2l5z 1 
       .  5 .  3698 . 1 1 11 A C2'  C -36.591   1.558 40.419 . . . 1.0 . . . . . . . . . . . . A . 11 A C2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3699 . 1 1 11 A C3'  C -35.926   0.607 41.395 . . . 1.0 . . . . . . . . . . . . A . 11 A C3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3700 . 1 1 11 A C4   C -34.765   2.893 37.752 . . . 1.0 . . . . . . . . . . . . A . 11 A C4   . . . . . . . . . rr_2l5z 1 
       .  5 .  3701 . 1 1 11 A C4'  C -35.085   1.548 42.255 . . . 1.0 . . . . . . . . . . . . A . 11 A C4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3702 . 1 1 11 A C5   C -33.809   2.239 37.008 . . . 1.0 . . . . . . . . . . . . A . 11 A C5   . . . . . . . . . rr_2l5z 1 
       .  5 .  3703 . 1 1 11 A C5'  C -33.870   0.840 42.863 . . . 1.0 . . . . . . . . . . . . A . 11 A C5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3704 . 1 1 11 A C6   C -33.666   2.649 35.678 . . . 1.0 . . . . . . . . . . . . A . 11 A C6   . . . . . . . . . rr_2l5z 1 
       .  5 .  3705 . 1 1 11 A C8   C -33.752   1.390 38.919 . . . 1.0 . . . . . . . . . . . . A . 11 A C8   . . . . . . . . . rr_2l5z 1 
       .  5 .  3706 . 1 1 11 A H1'  H -35.985   3.595 40.098 . . . 1.0 . . . . . . . . . . . . A . 11 A H1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3707 . 1 1 11 A H2   H -35.966   5.003 35.657 . . . 1.0 . . . . . . . . . . . . A . 11 A H2   . . . . . . . . . rr_2l5z 1 
       .  5 .  3708 . 1 1 11 A H2'  H -36.800   1.044 39.478 . . . 1.0 . . . . . . . . . . . . A . 11 A H2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3709 . 1 1 11 A H3'  H -35.324  -0.145 40.879 . . . 1.0 . . . . . . . . . . . . A . 11 A H3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3710 . 1 1 11 A H4'  H -35.702   1.955 43.054 . . . 1.0 . . . . . . . . . . . . A . 11 A H4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3711 . 1 1 11 A H5'  H -33.186   1.590 43.263 . . . 1.0 . . . . . . . . . . . . A . 11 A H5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3712 . 1 1 11 A H5'' H -34.206   0.195 43.676 . . . 1.0 . . . . . . . . . . . . A . 11 A H5'' . . . . . . . . . rr_2l5z 1 
       .  5 .  3713 . 1 1 11 A H61  H -32.715   2.440 33.892 . . . 1.0 . . . . . . . . . . . . A . 11 A H61  . . . . . . . . . rr_2l5z 1 
       .  5 .  3714 . 1 1 11 A H62  H -32.171   1.369 35.163 . . . 1.0 . . . . . . . . . . . . A . 11 A H62  . . . . . . . . . rr_2l5z 1 
       .  5 .  3715 . 1 1 11 A H8   H -33.475   0.787 39.770 . . . 1.0 . . . . . . . . . . . . A . 11 A H8   . . . . . . . . . rr_2l5z 1 
       .  5 .  3716 . 1 1 11 A HO2' H -38.519   1.574 40.688 . . . 1.0 . . . . . . . . . . . . A . 11 A HO2' . . . . . . . . . rr_2l5z 1 
       .  5 .  3717 . 1 1 11 A N1   N -34.469   3.639 35.245 . . . 1.0 . . . . . . . . . . . . A . 11 A N1   . . . . . . . . . rr_2l5z 1 
       .  5 .  3718 . 1 1 11 A N3   N -35.580   3.885 37.346 . . . 1.0 . . . . . . . . . . . . A . 11 A N3   . . . . . . . . . rr_2l5z 1 
       .  5 .  3719 . 1 1 11 A N6   N -32.780   2.108 34.844 . . . 1.0 . . . . . . . . . . . . A . 11 A N6   . . . . . . . . . rr_2l5z 1 
       .  5 .  3720 . 1 1 11 A N7   N -33.156   1.262 37.779 . . . 1.0 . . . . . . . . . . . . A . 11 A N7   . . . . . . . . . rr_2l5z 1 
       .  5 .  3721 . 1 1 11 A N9   N -34.715   2.324 39.001 . . . 1.0 . . . . . . . . . . . . A . 11 A N9   . . . . . . . . . rr_2l5z 1 
       .  5 .  3722 . 1 1 11 A O2'  O -37.785   2.126 40.969 . . . 1.0 . . . . . . . . . . . . A . 11 A O2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3723 . 1 1 11 A O3'  O -36.937   0.021 42.219 . . . 1.0 . . . . . . . . . . . . A . 11 A O3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3724 . 1 1 11 A O4'  O -34.688   2.612 41.384 . . . 1.0 . . . . . . . . . . . . A . 11 A O4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3725 . 1 1 11 A O5'  O -33.181   0.048 41.893 . . . 1.0 . . . . . . . . . . . . A . 11 A O5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3726 . 1 1 11 A OP1  O -32.478  -1.576 43.665 . . . 1.0 . . . . . . . . . . . . A . 11 A OP1  . . . . . . . . . rr_2l5z 1 
       .  5 .  3727 . 1 1 11 A OP2  O -31.814  -1.940 41.217 . . . 1.0 . . . . . . . . . . . . A . 11 A OP2  . . . . . . . . . rr_2l5z 1 
       .  5 .  3728 . 1 1 11 A P    P -32.072  -1.026 42.353 . . . 1.0 . . . . . . . . . . . . A . 11 A P    . . . . . . . . . rr_2l5z 1 
       .  5 .  3729 . 1 1 12 C C1'  C -39.328   0.282 37.160 . . . 1.0 . . . . . . . . . . . . A . 12 C C1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3730 . 1 1 12 C C2   C -37.985   0.220 35.077 . . . 1.0 . . . . . . . . . . . . A . 12 C C2   . . . . . . . . . rr_2l5z 1 
       .  5 .  3731 . 1 1 12 C C2'  C -40.389  -0.812 36.968 . . . 1.0 . . . . . . . . . . . . A . 12 C C2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3732 . 1 1 12 C C3'  C -40.553  -1.405 38.366 . . . 1.0 . . . . . . . . . . . . A . 12 C C3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3733 . 1 1 12 C C4   C -35.808  -0.661 35.070 . . . 1.0 . . . . . . . . . . . . A . 12 C C4   . . . . . . . . . rr_2l5z 1 
       .  5 .  3734 . 1 1 12 C C4'  C -40.133  -0.260 39.275 . . . 1.0 . . . . . . . . . . . . A . 12 C C4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3735 . 1 1 12 C C5   C -35.889  -0.958 36.467 . . . 1.0 . . . . . . . . . . . . A . 12 C C5   . . . . . . . . . rr_2l5z 1 
       .  5 .  3736 . 1 1 12 C C5'  C -39.658  -0.750 40.645 . . . 1.0 . . . . . . . . . . . . A . 12 C C5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3737 . 1 1 12 C C6   C -37.031  -0.646 37.109 . . . 1.0 . . . . . . . . . . . . A . 12 C C6   . . . . . . . . . rr_2l5z 1 
       .  5 .  3738 . 1 1 12 C H1'  H -39.720   1.234 36.796 . . . 1.0 . . . . . . . . . . . . A . 12 C H1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3739 . 1 1 12 C H2'  H -40.016  -1.575 36.277 . . . 1.0 . . . . . . . . . . . . A . 12 C H2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3740 . 1 1 12 C H3'  H -39.937  -2.297 38.509 . . . 1.0 . . . . . . . . . . . . A . 12 C H3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3741 . 1 1 12 C H4'  H -40.964   0.429 39.400 . . . 1.0 . . . . . . . . . . . . A . 12 C H4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3742 . 1 1 12 C H41  H -34.630  -0.744 33.411 . . . 1.0 . . . . . . . . . . . . A . 12 C H41  . . . . . . . . . rr_2l5z 1 
       .  5 .  3743 . 1 1 12 C H42  H -33.913  -1.379 34.875 . . . 1.0 . . . . . . . . . . . . A . 12 C H42  . . . . . . . . . rr_2l5z 1 
       .  5 .  3744 . 1 1 12 C H5   H -35.062  -1.417 36.988 . . . 1.0 . . . . . . . . . . . . A . 12 C H5   . . . . . . . . . rr_2l5z 1 
       .  5 .  3745 . 1 1 12 C H5'  H -39.672   0.087 41.344 . . . 1.0 . . . . . . . . . . . . A . 12 C H5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3746 . 1 1 12 C H5'' H -40.335  -1.525 41.007 . . . 1.0 . . . . . . . . . . . . A . 12 C H5'' . . . . . . . . . rr_2l5z 1 
       .  5 .  3747 . 1 1 12 C H6   H -37.132  -0.872 38.162 . . . 1.0 . . . . . . . . . . . . A . 12 C H6   . . . . . . . . . rr_2l5z 1 
       .  5 .  3748 . 1 1 12 C HO2' H -41.988  -0.882 35.858 . . . 1.0 . . . . . . . . . . . . A . 12 C HO2' . . . . . . . . . rr_2l5z 1 
       .  5 .  3749 . 1 1 12 C N1   N -38.072  -0.064 36.441 . . . 1.0 . . . . . . . . . . . . A . 12 C N1   . . . . . . . . . rr_2l5z 1 
       .  5 .  3750 . 1 1 12 C N3   N -36.834  -0.093 34.424 . . . 1.0 . . . . . . . . . . . . A . 12 C N3   . . . . . . . . . rr_2l5z 1 
       .  5 .  3751 . 1 1 12 C N4   N -34.694  -0.951 34.397 . . . 1.0 . . . . . . . . . . . . A . 12 C N4   . . . . . . . . . rr_2l5z 1 
       .  5 .  3752 . 1 1 12 C O2   O -38.933   0.745 34.496 . . . 1.0 . . . . . . . . . . . . A . 12 C O2   . . . . . . . . . rr_2l5z 1 
       .  5 .  3753 . 1 1 12 C O2'  O -41.622  -0.260 36.492 . . . 1.0 . . . . . . . . . . . . A . 12 C O2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3754 . 1 1 12 C O3'  O -41.942  -1.665 38.587 . . . 1.0 . . . . . . . . . . . . A . 12 C O3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3755 . 1 1 12 C O4'  O -39.088   0.393 38.569 . . . 1.0 . . . . . . . . . . . . A . 12 C O4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3756 . 1 1 12 C O5'  O -38.331  -1.279 40.582 . . . 1.0 . . . . . . . . . . . . A . 12 C O5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3757 . 1 1 12 C OP1  O -38.384  -1.862 43.018 . . . 1.0 . . . . . . . . . . . . A . 12 C OP1  . . . . . . . . . rr_2l5z 1 
       .  5 .  3758 . 1 1 12 C OP2  O -36.296  -2.323 41.605 . . . 1.0 . . . . . . . . . . . . A . 12 C OP2  . . . . . . . . . rr_2l5z 1 
       .  5 .  3759 . 1 1 12 C P    P -37.465  -1.472 41.926 . . . 1.0 . . . . . . . . . . . . A . 12 C P    . . . . . . . . . rr_2l5z 1 
       .  5 .  3760 . 1 1 13 G C1'  C -39.744  -3.360 33.323 . . . 1.0 . . . . . . . . . . . . A . 13 G C1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3761 . 1 1 13 G C2   C -36.209  -3.036 30.677 . . . 1.0 . . . . . . . . . . . . A . 13 G C2   . . . . . . . . . rr_2l5z 1 
       .  5 .  3762 . 1 1 13 G C2'  C -40.177  -4.746 32.830 . . . 1.0 . . . . . . . . . . . . A . 13 G C2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3763 . 1 1 13 G C3'  C -40.886  -5.343 34.035 . . . 1.0 . . . . . . . . . . . . A . 13 G C3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3764 . 1 1 13 G C4   C -37.267  -3.215 32.633 . . . 1.0 . . . . . . . . . . . . A . 13 G C4   . . . . . . . . . rr_2l5z 1 
       .  5 .  3765 . 1 1 13 G C4'  C -41.436  -4.116 34.749 . . . 1.0 . . . . . . . . . . . . A . 13 G C4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3766 . 1 1 13 G C5   C -36.098  -3.233 33.381 . . . 1.0 . . . . . . . . . . . . A . 13 G C5   . . . . . . . . . rr_2l5z 1 
       .  5 .  3767 . 1 1 13 G C5'  C -41.669  -4.371 36.240 . . . 1.0 . . . . . . . . . . . . A . 13 G C5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3768 . 1 1 13 G C6   C -34.844  -3.144 32.721 . . . 1.0 . . . . . . . . . . . . A . 13 G C6   . . . . . . . . . rr_2l5z 1 
       .  5 .  3769 . 1 1 13 G C8   C -37.683  -3.385 34.743 . . . 1.0 . . . . . . . . . . . . A . 13 G C8   . . . . . . . . . rr_2l5z 1 
       .  5 .  3770 . 1 1 13 G H1   H -34.122  -2.976 30.789 . . . 1.0 . . . . . . . . . . . . A . 13 G H1   . . . . . . . . . rr_2l5z 1 
       .  5 .  3771 . 1 1 13 G H1'  H -40.022  -2.614 32.580 . . . 1.0 . . . . . . . . . . . . A . 13 G H1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3772 . 1 1 13 G H2'  H -39.295  -5.343 32.579 . . . 1.0 . . . . . . . . . . . . A . 13 G H2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3773 . 1 1 13 G H21  H -35.255  -2.873 28.886 . . . 1.0 . . . . . . . . . . . . A . 13 G H21  . . . . . . . . . rr_2l5z 1 
       .  5 .  3774 . 1 1 13 G H22  H -37.002  -2.924 28.806 . . . 1.0 . . . . . . . . . . . . A . 13 G H22  . . . . . . . . . rr_2l5z 1 
       .  5 .  3775 . 1 1 13 G H3'  H -40.204  -5.921 34.665 . . . 1.0 . . . . . . . . . . . . A . 13 G H3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3776 . 1 1 13 G H4'  H -42.371  -3.811 34.281 . . . 1.0 . . . . . . . . . . . . A . 13 G H4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3777 . 1 1 13 G H5'  H -42.153  -5.339 36.367 . . . 1.0 . . . . . . . . . . . . A . 13 G H5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3778 . 1 1 13 G H5'' H -40.708  -4.383 36.753 . . . 1.0 . . . . . . . . . . . . A . 13 G H5'' . . . . . . . . . rr_2l5z 1 
       .  5 .  3779 . 1 1 13 G H8   H -38.251  -3.470 35.656 . . . 1.0 . . . . . . . . . . . . A . 13 G H8   . . . . . . . . . rr_2l5z 1 
       .  5 .  3780 . 1 1 13 G HO2' H -41.926  -4.417 32.042 . . . 1.0 . . . . . . . . . . . . A . 13 G HO2' . . . . . . . . . rr_2l5z 1 
       .  5 .  3781 . 1 1 13 G N1   N -34.999  -3.046 31.343 . . . 1.0 . . . . . . . . . . . . A . 13 G N1   . . . . . . . . . rr_2l5z 1 
       .  5 .  3782 . 1 1 13 G N2   N -36.151  -2.936 29.350 . . . 1.0 . . . . . . . . . . . . A . 13 G N2   . . . . . . . . . rr_2l5z 1 
       .  5 .  3783 . 1 1 13 G N3   N -37.394  -3.120 31.291 . . . 1.0 . . . . . . . . . . . . A . 13 G N3   . . . . . . . . . rr_2l5z 1 
       .  5 .  3784 . 1 1 13 G N7   N -36.390  -3.344 34.751 . . . 1.0 . . . . . . . . . . . . A . 13 G N7   . . . . . . . . . rr_2l5z 1 
       .  5 .  3785 . 1 1 13 G N9   N -38.287  -3.316 33.543 . . . 1.0 . . . . . . . . . . . . A . 13 G N9   . . . . . . . . . rr_2l5z 1 
       .  5 .  3786 . 1 1 13 G O2'  O -41.057  -4.646 31.704 . . . 1.0 . . . . . . . . . . . . A . 13 G O2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3787 . 1 1 13 G O3'  O -41.988  -6.127 33.569 . . . 1.0 . . . . . . . . . . . . A . 13 G O3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3788 . 1 1 13 G O4'  O -40.459  -3.101 34.543 . . . 1.0 . . . . . . . . . . . . A . 13 G O4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3789 . 1 1 13 G O5'  O -42.496  -3.359 36.819 . . . 1.0 . . . . . . . . . . . . A . 13 G O5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3790 . 1 1 13 G O6   O -33.719  -3.144 33.216 . . . 1.0 . . . . . . . . . . . . A . 13 G O6   . . . . . . . . . rr_2l5z 1 
       .  5 .  3791 . 1 1 13 G OP1  O -43.948  -3.142 38.847 . . . 1.0 . . . . . . . . . . . . A . 13 G OP1  . . . . . . . . . rr_2l5z 1 
       .  5 .  3792 . 1 1 13 G OP2  O -41.579  -4.103 39.029 . . . 1.0 . . . . . . . . . . . . A . 13 G OP2  . . . . . . . . . rr_2l5z 1 
       .  5 .  3793 . 1 1 13 G P    P -42.533  -3.152 38.415 . . . 1.0 . . . . . . . . . . . . A . 13 G P    . . . . . . . . . rr_2l5z 1 
       .  5 .  3794 . 1 1 14 A C1'  C -42.153  -8.926 28.378 . . . 1.0 . . . . . . . . . . . . A . 14 A C1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3795 . 1 1 14 A C2   C -43.860  -6.093 25.441 . . . 1.0 . . . . . . . . . . . . A . 14 A C2   . . . . . . . . . rr_2l5z 1 
       .  5 .  3796 . 1 1 14 A C2'  C -40.754  -8.379 28.101 . . . 1.0 . . . . . . . . . . . . A . 14 A C2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3797 . 1 1 14 A C3'  C -40.147  -8.301 29.490 . . . 1.0 . . . . . . . . . . . . A . 14 A C3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3798 . 1 1 14 A C4   C -43.598  -7.011 27.432 . . . 1.0 . . . . . . . . . . . . A . 14 A C4   . . . . . . . . . rr_2l5z 1 
       .  5 .  3799 . 1 1 14 A C4'  C -40.787  -9.488 30.204 . . . 1.0 . . . . . . . . . . . . A . 14 A C4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3800 . 1 1 14 A C5   C -44.512  -6.171 28.026 . . . 1.0 . . . . . . . . . . . . A . 14 A C5   . . . . . . . . . rr_2l5z 1 
       .  5 .  3801 . 1 1 14 A C5'  C -40.860  -9.277 31.719 . . . 1.0 . . . . . . . . . . . . A . 14 A C5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3802 . 1 1 14 A C6   C -45.122  -5.227 27.193 . . . 1.0 . . . . . . . . . . . . A . 14 A C6   . . . . . . . . . rr_2l5z 1 
       .  5 .  3803 . 1 1 14 A C8   C -43.805  -7.437 29.535 . . . 1.0 . . . . . . . . . . . . A . 14 A C8   . . . . . . . . . rr_2l5z 1 
       .  5 .  3804 . 1 1 14 A H1'  H -42.430  -9.626 27.589 . . . 1.0 . . . . . . . . . . . . A . 14 A H1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3805 . 1 1 14 A H2   H -43.616  -6.029 24.380 . . . 1.0 . . . . . . . . . . . . A . 14 A H2   . . . . . . . . . rr_2l5z 1 
       .  5 .  3806 . 1 1 14 A H2'  H -40.821  -7.379 27.666 . . . 1.0 . . . . . . . . . . . . A . 14 A H2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3807 . 1 1 14 A H3'  H -40.369  -7.346 29.973 . . . 1.0 . . . . . . . . . . . . A . 14 A H3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3808 . 1 1 14 A H4'  H -40.213 -10.389 29.994 . . . 1.0 . . . . . . . . . . . . A . 14 A H4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3809 . 1 1 14 A H5'  H -41.352 -10.136 32.174 . . . 1.0 . . . . . . . . . . . . A . 14 A H5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3810 . 1 1 14 A H5'' H -39.847  -9.195 32.116 . . . 1.0 . . . . . . . . . . . . A . 14 A H5'' . . . . . . . . . rr_2l5z 1 
       .  5 .  3811 . 1 1 14 A H61  H -46.436  -3.686 26.983 . . . 1.0 . . . . . . . . . . . . A . 14 A H61  . . . . . . . . . rr_2l5z 1 
       .  5 .  3812 . 1 1 14 A H62  H -46.299  -4.343 28.599 . . . 1.0 . . . . . . . . . . . . A . 14 A H62  . . . . . . . . . rr_2l5z 1 
       .  5 .  3813 . 1 1 14 A H8   H -43.645  -7.911 30.492 . . . 1.0 . . . . . . . . . . . . A . 14 A H8   . . . . . . . . . rr_2l5z 1 
       .  5 .  3814 . 1 1 14 A HO2' H -40.372 -10.139 27.360 . . . 1.0 . . . . . . . . . . . . A . 14 A HO2' . . . . . . . . . rr_2l5z 1 
       .  5 .  3815 . 1 1 14 A N1   N -44.765  -5.222 25.896 . . . 1.0 . . . . . . . . . . . . A . 14 A N1   . . . . . . . . . rr_2l5z 1 
       .  5 .  3816 . 1 1 14 A N3   N -43.222  -7.028 26.139 . . . 1.0 . . . . . . . . . . . . A . 14 A N3   . . . . . . . . . rr_2l5z 1 
       .  5 .  3817 . 1 1 14 A N6   N -46.025  -4.347 27.627 . . . 1.0 . . . . . . . . . . . . A . 14 A N6   . . . . . . . . . rr_2l5z 1 
       .  5 .  3818 . 1 1 14 A N7   N -44.638  -6.457 29.395 . . . 1.0 . . . . . . . . . . . . A . 14 A N7   . . . . . . . . . rr_2l5z 1 
       .  5 .  3819 . 1 1 14 A N9   N -43.144  -7.833 28.431 . . . 1.0 . . . . . . . . . . . . A . 14 A N9   . . . . . . . . . rr_2l5z 1 
       .  5 .  3820 . 1 1 14 A O2'  O -40.007  -9.257 27.251 . . . 1.0 . . . . . . . . . . . . A . 14 A O2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3821 . 1 1 14 A O3'  O -38.741  -8.541 29.383 . . . 1.0 . . . . . . . . . . . . A . 14 A O3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3822 . 1 1 14 A O4'  O -42.090  -9.622 29.635 . . . 1.0 . . . . . . . . . . . . A . 14 A O4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3823 . 1 1 14 A O5'  O -41.587  -8.091 32.051 . . . 1.0 . . . . . . . . . . . . A . 14 A O5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3824 . 1 1 14 A OP1  O -43.260  -8.258 33.907 . . . 1.0 . . . . . . . . . . . . A . 14 A OP1  . . . . . . . . . rr_2l5z 1 
       .  5 .  3825 . 1 1 14 A OP2  O -40.752  -8.136 34.412 . . . 1.0 . . . . . . . . . . . . A . 14 A OP2  . . . . . . . . . rr_2l5z 1 
       .  5 .  3826 . 1 1 14 A P    P -41.913  -7.735 33.587 . . . 1.0 . . . . . . . . . . . . A . 14 A P    . . . . . . . . . rr_2l5z 1 
       .  5 .  3827 . 1 1 15 A C1'  C -40.613  -4.963 26.029 . . . 1.0 . . . . . . . . . . . . A . 15 A C1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3828 . 1 1 15 A C2   C -43.238  -1.410 26.255 . . . 1.0 . . . . . . . . . . . . A . 15 A C2   . . . . . . . . . rr_2l5z 1 
       .  5 .  3829 . 1 1 15 A C2'  C -39.503  -4.132 25.374 . . . 1.0 . . . . . . . . . . . . A . 15 A C2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3830 . 1 1 15 A C3'  C -38.222  -4.835 25.810 . . . 1.0 . . . . . . . . . . . . A . 15 A C3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3831 . 1 1 15 A C4   C -42.075  -3.107 27.059 . . . 1.0 . . . . . . . . . . . . A . 15 A C4   . . . . . . . . . rr_2l5z 1 
       .  5 .  3832 . 1 1 15 A C4'  C -38.678  -6.271 26.039 . . . 1.0 . . . . . . . . . . . . A . 15 A C4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3833 . 1 1 15 A C5   C -42.426  -2.832 28.361 . . . 1.0 . . . . . . . . . . . . A . 15 A C5   . . . . . . . . . rr_2l5z 1 
       .  5 .  3834 . 1 1 15 A C5'  C -37.775  -7.010 27.031 . . . 1.0 . . . . . . . . . . . . A . 15 A C5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3835 . 1 1 15 A C6   C -43.266  -1.730 28.560 . . . 1.0 . . . . . . . . . . . . A . 15 A C6   . . . . . . . . . rr_2l5z 1 
       .  5 .  3836 . 1 1 15 A C8   C -41.182  -4.513 28.427 . . . 1.0 . . . . . . . . . . . . A . 15 A C8   . . . . . . . . . rr_2l5z 1 
       .  5 .  3837 . 1 1 15 A H1'  H -41.358  -5.221 25.277 . . . 1.0 . . . . . . . . . . . . A . 15 A H1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3838 . 1 1 15 A H2   H -43.570  -0.790 25.423 . . . 1.0 . . . . . . . . . . . . A . 15 A H2   . . . . . . . . . rr_2l5z 1 
       .  5 .  3839 . 1 1 15 A H2'  H -39.525  -3.110 25.766 . . . 1.0 . . . . . . . . . . . . A . 15 A H2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3840 . 1 1 15 A H3'  H -37.793  -4.381 26.708 . . . 1.0 . . . . . . . . . . . . A . 15 A H3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3841 . 1 1 15 A H4'  H -38.688  -6.806 25.090 . . . 1.0 . . . . . . . . . . . . A . 15 A H4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3842 . 1 1 15 A H5'  H -38.084  -8.055 27.081 . . . 1.0 . . . . . . . . . . . . A . 15 A H5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3843 . 1 1 15 A H5'' H -36.745  -6.960 26.680 . . . 1.0 . . . . . . . . . . . . A . 15 A H5'' . . . . . . . . . rr_2l5z 1 
       .  5 .  3844 . 1 1 15 A H61  H -44.294  -0.541 29.853 . . . 1.0 . . . . . . . . . . . . A . 15 A H61  . . . . . . . . . rr_2l5z 1 
       .  5 .  3845 . 1 1 15 A H62  H -43.402  -1.854 30.587 . . . 1.0 . . . . . . . . . . . . A . 15 A H62  . . . . . . . . . rr_2l5z 1 
       .  5 .  3846 . 1 1 15 A H8   H -40.570  -5.328 28.782 . . . 1.0 . . . . . . . . . . . . A . 15 A H8   . . . . . . . . . rr_2l5z 1 
       .  5 .  3847 . 1 1 15 A HO2' H -40.024  -3.288 23.698 . . . 1.0 . . . . . . . . . . . . A . 15 A HO2' . . . . . . . . . rr_2l5z 1 
       .  5 .  3848 . 1 1 15 A N1   N -43.651  -1.042 27.471 . . . 1.0 . . . . . . . . . . . . A . 15 A N1   . . . . . . . . . rr_2l5z 1 
       .  5 .  3849 . 1 1 15 A N3   N -42.448  -2.436 25.952 . . . 1.0 . . . . . . . . . . . . A . 15 A N3   . . . . . . . . . rr_2l5z 1 
       .  5 .  3850 . 1 1 15 A N6   N -43.687  -1.345 29.764 . . . 1.0 . . . . . . . . . . . . A . 15 A N6   . . . . . . . . . rr_2l5z 1 
       .  5 .  3851 . 1 1 15 A N7   N -41.839  -3.755 29.243 . . . 1.0 . . . . . . . . . . . . A . 15 A N7   . . . . . . . . . rr_2l5z 1 
       .  5 .  3852 . 1 1 15 A N9   N -41.263  -4.211 27.118 . . . 1.0 . . . . . . . . . . . . A . 15 A N9   . . . . . . . . . rr_2l5z 1 
       .  5 .  3853 . 1 1 15 A O2'  O -39.633  -4.128 23.947 . . . 1.0 . . . . . . . . . . . . A . 15 A O2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3854 . 1 1 15 A O3'  O -37.309  -4.825 24.708 . . . 1.0 . . . . . . . . . . . . A . 15 A O3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3855 . 1 1 15 A O4'  O -40.009  -6.165 26.530 . . . 1.0 . . . . . . . . . . . . A . 15 A O4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3856 . 1 1 15 A O5'  O -37.851  -6.435 28.339 . . . 1.0 . . . . . . . . . . . . A . 15 A O5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3857 . 1 1 15 A OP1  O -36.325  -7.933 29.644 . . . 1.0 . . . . . . . . . . . . A . 15 A OP1  . . . . . . . . . rr_2l5z 1 
       .  5 .  3858 . 1 1 15 A OP2  O -38.152  -6.577 30.822 . . . 1.0 . . . . . . . . . . . . A . 15 A OP2  . . . . . . . . . rr_2l5z 1 
       .  5 .  3859 . 1 1 15 A P    P -37.686  -7.354 29.652 . . . 1.0 . . . . . . . . . . . . A . 15 A P    . . . . . . . . . rr_2l5z 1 
       .  5 .  3860 . 1 1 16 A C1'  C -39.816  -0.510 25.155 . . . 1.0 . . . . . . . . . . . . A . 16 A C1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3861 . 1 1 16 A C2   C -41.107   0.442 29.274 . . . 1.0 . . . . . . . . . . . . A . 16 A C2   . . . . . . . . . rr_2l5z 1 
       .  5 .  3862 . 1 1 16 A C2'  C -39.292   0.731 24.442 . . . 1.0 . . . . . . . . . . . . A . 16 A C2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3863 . 1 1 16 A C3'  C -38.138   0.179 23.625 . . . 1.0 . . . . . . . . . . . . A . 16 A C3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3864 . 1 1 16 A C4   C -39.728  -0.310 27.722 . . . 1.0 . . . . . . . . . . . . A . 16 A C4   . . . . . . . . . rr_2l5z 1 
       .  5 .  3865 . 1 1 16 A C4'  C -38.611  -1.233 23.269 . . . 1.0 . . . . . . . . . . . . A . 16 A C4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3866 . 1 1 16 A C5   C -38.765  -0.666 28.639 . . . 1.0 . . . . . . . . . . . . A . 16 A C5   . . . . . . . . . rr_2l5z 1 
       .  5 .  3867 . 1 1 16 A C5'  C -37.446  -2.215 23.111 . . . 1.0 . . . . . . . . . . . . A . 16 A C5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3868 . 1 1 16 A C6   C -39.065  -0.417 29.983 . . . 1.0 . . . . . . . . . . . . A . 16 A C6   . . . . . . . . . rr_2l5z 1 
       .  5 .  3869 . 1 1 16 A C8   C -38.004  -1.168 26.756 . . . 1.0 . . . . . . . . . . . . A . 16 A C8   . . . . . . . . . rr_2l5z 1 
       .  5 .  3870 . 1 1 16 A H1'  H -40.898  -0.441 25.251 . . . 1.0 . . . . . . . . . . . . A . 16 A H1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3871 . 1 1 16 A H2   H -42.054   0.892 29.572 . . . 1.0 . . . . . . . . . . . . A . 16 A H2   . . . . . . . . . rr_2l5z 1 
       .  5 .  3872 . 1 1 16 A H2'  H -38.921   1.455 25.173 . . . 1.0 . . . . . . . . . . . . A . 16 A H2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3873 . 1 1 16 A H3'  H -37.204   0.188 24.195 . . . 1.0 . . . . . . . . . . . . A . 16 A H3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3874 . 1 1 16 A H4'  H -39.179  -1.198 22.339 . . . 1.0 . . . . . . . . . . . . A . 16 A H4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3875 . 1 1 16 A H5'  H -37.833  -3.176 22.771 . . . 1.0 . . . . . . . . . . . . A . 16 A H5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3876 . 1 1 16 A H5'' H -36.752  -1.827 22.364 . . . 1.0 . . . . . . . . . . . . A . 16 A H5'' . . . . . . . . . rr_2l5z 1 
       .  5 .  3877 . 1 1 16 A H61  H -38.497  -0.512 31.935 . . . 1.0 . . . . . . . . . . . . A . 16 A H61  . . . . . . . . . rr_2l5z 1 
       .  5 .  3878 . 1 1 16 A H62  H -37.339  -1.141 30.786 . . . 1.0 . . . . . . . . . . . . A . 16 A H62  . . . . . . . . . rr_2l5z 1 
       .  5 .  3879 . 1 1 16 A H8   H -37.362  -1.525 25.965 . . . 1.0 . . . . . . . . . . . . A . 16 A H8   . . . . . . . . . rr_2l5z 1 
       .  5 .  3880 . 1 1 16 A HO2' H -40.618   2.102 24.053 . . . 1.0 . . . . . . . . . . . . A . 16 A HO2' . . . . . . . . . rr_2l5z 1 
       .  5 .  3881 . 1 1 16 A N1   N -40.256   0.143 30.259 . . . 1.0 . . . . . . . . . . . . A . 16 A N1   . . . . . . . . . rr_2l5z 1 
       .  5 .  3882 . 1 1 16 A N3   N -40.927   0.250 27.971 . . . 1.0 . . . . . . . . . . . . A . 16 A N3   . . . . . . . . . rr_2l5z 1 
       .  5 .  3883 . 1 1 16 A N6   N -38.232  -0.713 30.982 . . . 1.0 . . . . . . . . . . . . A . 16 A N6   . . . . . . . . . rr_2l5z 1 
       .  5 .  3884 . 1 1 16 A N7   N -37.646  -1.223 27.997 . . . 1.0 . . . . . . . . . . . . A . 16 A N7   . . . . . . . . . rr_2l5z 1 
       .  5 .  3885 . 1 1 16 A N9   N -39.217  -0.645 26.496 . . . 1.0 . . . . . . . . . . . . A . 16 A N9   . . . . . . . . . rr_2l5z 1 
       .  5 .  3886 . 1 1 16 A O2'  O -40.295   1.318 23.605 . . . 1.0 . . . . . . . . . . . . A . 16 A O2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3887 . 1 1 16 A O3'  O -38.041   0.939 22.416 . . . 1.0 . . . . . . . . . . . . A . 16 A O3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3888 . 1 1 16 A O4'  O -39.481  -1.636 24.330 . . . 1.0 . . . . . . . . . . . . A . 16 A O4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3889 . 1 1 16 A O5'  O -36.748  -2.401 24.345 . . . 1.0 . . . . . . . . . . . . A . 16 A O5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3890 . 1 1 16 A OP1  O -35.175  -4.187 23.564 . . . 1.0 . . . . . . . . . . . . A . 16 A OP1  . . . . . . . . . rr_2l5z 1 
       .  5 .  3891 . 1 1 16 A OP2  O -35.505  -3.735 26.064 . . . 1.0 . . . . . . . . . . . . A . 16 A OP2  . . . . . . . . . rr_2l5z 1 
       .  5 .  3892 . 1 1 16 A P    P -36.056  -3.814 24.692 . . . 1.0 . . . . . . . . . . . . A . 16 A P    . . . . . . . . . rr_2l5z 1 
       .  5 .  3893 . 1 1 17 G C1'  C -37.287   2.865 26.923 . . . 1.0 . . . . . . . . . . . . A . 17 G C1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3894 . 1 1 17 G C2   C -37.928   2.023 31.219 . . . 1.0 . . . . . . . . . . . . A . 17 G C2   . . . . . . . . . rr_2l5z 1 
       .  5 .  3895 . 1 1 17 G C2'  C -36.976   4.348 26.751 . . . 1.0 . . . . . . . . . . . . A . 17 G C2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3896 . 1 1 17 G C3'  C -35.916   4.316 25.668 . . . 1.0 . . . . . . . . . . . . A . 17 G C3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3897 . 1 1 17 G C4   C -36.769   2.063 29.315 . . . 1.0 . . . . . . . . . . . . A . 17 G C4   . . . . . . . . . rr_2l5z 1 
       .  5 .  3898 . 1 1 17 G C4'  C -36.418   3.196 24.769 . . . 1.0 . . . . . . . . . . . . A . 17 G C4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3899 . 1 1 17 G C5   C -35.634   1.490 29.872 . . . 1.0 . . . . . . . . . . . . A . 17 G C5   . . . . . . . . . rr_2l5z 1 
       .  5 .  3900 . 1 1 17 G C5'  C -35.290   2.578 23.944 . . . 1.0 . . . . . . . . . . . . A . 17 G C5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3901 . 1 1 17 G C6   C -35.630   1.143 31.249 . . . 1.0 . . . . . . . . . . . . A . 17 G C6   . . . . . . . . . rr_2l5z 1 
       .  5 .  3902 . 1 1 17 G C8   C -35.201   1.834 27.852 . . . 1.0 . . . . . . . . . . . . A . 17 G C8   . . . . . . . . . rr_2l5z 1 
       .  5 .  3903 . 1 1 17 G H1   H -36.917   1.223 32.865 . . . 1.0 . . . . . . . . . . . . A . 17 G H1   . . . . . . . . . rr_2l5z 1 
       .  5 .  3904 . 1 1 17 G H1'  H -38.342   2.735 27.167 . . . 1.0 . . . . . . . . . . . . A . 17 G H1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3905 . 1 1 17 G H2'  H -36.560   4.756 27.675 . . . 1.0 . . . . . . . . . . . . A . 17 G H2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3906 . 1 1 17 G H21  H -38.996   1.991 32.953 . . . 1.0 . . . . . . . . . . . . A . 17 G H21  . . . . . . . . . rr_2l5z 1 
       .  5 .  3907 . 1 1 17 G H22  H -39.831   2.656 31.567 . . . 1.0 . . . . . . . . . . . . A . 17 G H22  . . . . . . . . . rr_2l5z 1 
       .  5 .  3908 . 1 1 17 G H3'  H -34.925   4.109 26.077 . . . 1.0 . . . . . . . . . . . . A . 17 G H3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3909 . 1 1 17 G H4'  H -37.187   3.584 24.105 . . . 1.0 . . . . . . . . . . . . A . 17 G H4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3910 . 1 1 17 G H5'  H -34.941   3.311 23.215 . . . 1.0 . . . . . . . . . . . . A . 17 G H5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3911 . 1 1 17 G H5'' H -34.467   2.317 24.607 . . . 1.0 . . . . . . . . . . . . A . 17 G H5'' . . . . . . . . . rr_2l5z 1 
       .  5 .  3912 . 1 1 17 G H8   H -34.693   1.880 26.902 . . . 1.0 . . . . . . . . . . . . A . 17 G H8   . . . . . . . . . rr_2l5z 1 
       .  5 .  3913 . 1 1 17 G HO2' H -38.889   4.710 26.792 . . . 1.0 . . . . . . . . . . . . A . 17 G HO2' . . . . . . . . . rr_2l5z 1 
       .  5 .  3914 . 1 1 17 G N1   N -36.842   1.451 31.855 . . . 1.0 . . . . . . . . . . . . A . 17 G N1   . . . . . . . . . rr_2l5z 1 
       .  5 .  3915 . 1 1 17 G N2   N -39.005   2.242 31.974 . . . 1.0 . . . . . . . . . . . . A . 17 G N2   . . . . . . . . . rr_2l5z 1 
       .  5 .  3916 . 1 1 17 G N3   N -37.939   2.354 29.924 . . . 1.0 . . . . . . . . . . . . A . 17 G N3   . . . . . . . . . rr_2l5z 1 
       .  5 .  3917 . 1 1 17 G N7   N -34.626   1.351 28.904 . . . 1.0 . . . . . . . . . . . . A . 17 G N7   . . . . . . . . . rr_2l5z 1 
       .  5 .  3918 . 1 1 17 G N9   N -36.463   2.278 27.997 . . . 1.0 . . . . . . . . . . . . A . 17 G N9   . . . . . . . . . rr_2l5z 1 
       .  5 .  3919 . 1 1 17 G O2'  O -38.132   5.085 26.336 . . . 1.0 . . . . . . . . . . . . A . 17 G O2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3920 . 1 1 17 G O3'  O -35.961   5.544 24.937 . . . 1.0 . . . . . . . . . . . . A . 17 G O3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3921 . 1 1 17 G O4'  O -37.007   2.240 25.658 . . . 1.0 . . . . . . . . . . . . A . 17 G O4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3922 . 1 1 17 G O5'  O -35.723   1.403 23.255 . . . 1.0 . . . . . . . . . . . . A . 17 G O5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3923 . 1 1 17 G O6   O -34.724   0.632 31.904 . . . 1.0 . . . . . . . . . . . . A . 17 G O6   . . . . . . . . . rr_2l5z 1 
       .  5 .  3924 . 1 1 17 G OP1  O -36.794   2.955 21.607 . . . 1.0 . . . . . . . . . . . . A . 17 G OP1  . . . . . . . . . rr_2l5z 1 
       .  5 .  3925 . 1 1 17 G OP2  O -36.070   0.598 20.909 . . . 1.0 . . . . . . . . . . . . A . 17 G OP2  . . . . . . . . . rr_2l5z 1 
       .  5 .  3926 . 1 1 17 G P    P -36.623   1.520 21.926 . . . 1.0 . . . . . . . . . . . . A . 17 G P    . . . . . . . . . rr_2l5z 1 
       .  5 .  3927 . 1 1 18 U C1'  C -36.290   7.070 30.280 . . . 1.0 . . . . . . . . . . . . A . 18 U C1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3928 . 1 1 18 U C2   C -35.559   5.542 32.088 . . . 1.0 . . . . . . . . . . . . A . 18 U C2   . . . . . . . . . rr_2l5z 1 
       .  5 .  3929 . 1 1 18 U C2'  C -35.531   8.382 30.540 . . . 1.0 . . . . . . . . . . . . A . 18 U C2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3930 . 1 1 18 U C3'  C -35.208   8.889 29.138 . . . 1.0 . . . . . . . . . . . . A . 18 U C3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3931 . 1 1 18 U C4   C -33.976   3.704 31.639 . . . 1.0 . . . . . . . . . . . . A . 18 U C4   . . . . . . . . . rr_2l5z 1 
       .  5 .  3932 . 1 1 18 U C4'  C -36.322   8.289 28.303 . . . 1.0 . . . . . . . . . . . . A . 18 U C4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3933 . 1 1 18 U C5   C -33.966   4.147 30.263 . . . 1.0 . . . . . . . . . . . . A . 18 U C5   . . . . . . . . . rr_2l5z 1 
       .  5 .  3934 . 1 1 18 U C5'  C -35.952   8.207 26.825 . . . 1.0 . . . . . . . . . . . . A . 18 U C5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3935 . 1 1 18 U C6   C -34.707   5.209 29.866 . . . 1.0 . . . . . . . . . . . . A . 18 U C6   . . . . . . . . . rr_2l5z 1 
       .  5 .  3936 . 1 1 18 U H1'  H -37.254   7.103 30.791 . . . 1.0 . . . . . . . . . . . . A . 18 U H1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3937 . 1 1 18 U H2'  H -34.606   8.174 31.085 . . . 1.0 . . . . . . . . . . . . A . 18 U H2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3938 . 1 1 18 U H3   H -34.835   4.174 33.468 . . . 1.0 . . . . . . . . . . . . A . 18 U H3   . . . . . . . . . rr_2l5z 1 
       .  5 .  3939 . 1 1 18 U H3'  H -34.219   8.565 28.803 . . . 1.0 . . . . . . . . . . . . A . 18 U H3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3940 . 1 1 18 U H4'  H -37.229   8.878 28.423 . . . 1.0 . . . . . . . . . . . . A . 18 U H4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3941 . 1 1 18 U H5   H -33.355   3.625 29.540 . . . 1.0 . . . . . . . . . . . . A . 18 U H5   . . . . . . . . . rr_2l5z 1 
       .  5 .  3942 . 1 1 18 U H5'  H -36.851   8.007 26.243 . . . 1.0 . . . . . . . . . . . . A . 18 U H5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3943 . 1 1 18 U H5'' H -35.529   9.162 26.510 . . . 1.0 . . . . . . . . . . . . A . 18 U H5'' . . . . . . . . . rr_2l5z 1 
       .  5 .  3944 . 1 1 18 U H6   H -34.668   5.523 28.835 . . . 1.0 . . . . . . . . . . . . A . 18 U H6   . . . . . . . . . rr_2l5z 1 
       .  5 .  3945 . 1 1 18 U HO2' H -36.065   9.292 32.175 . . . 1.0 . . . . . . . . . . . . A . 18 U HO2' . . . . . . . . . rr_2l5z 1 
       .  5 .  3946 . 1 1 18 U N1   N -35.493   5.901 30.746 . . . 1.0 . . . . . . . . . . . . A . 18 U N1   . . . . . . . . . rr_2l5z 1 
       .  5 .  3947 . 1 1 18 U N3   N -34.792   4.454 32.468 . . . 1.0 . . . . . . . . . . . . A . 18 U N3   . . . . . . . . . rr_2l5z 1 
       .  5 .  3948 . 1 1 18 U O2   O -36.259   6.153 32.893 . . . 1.0 . . . . . . . . . . . . A . 18 U O2   . . . . . . . . . rr_2l5z 1 
       .  5 .  3949 . 1 1 18 U O2'  O -36.343   9.318 31.257 . . . 1.0 . . . . . . . . . . . . A . 18 U O2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3950 . 1 1 18 U O3'  O -35.344  10.313 29.125 . . . 1.0 . . . . . . . . . . . . A . 18 U O3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3951 . 1 1 18 U O4   O -33.338   2.752 32.082 . . . 1.0 . . . . . . . . . . . . A . 18 U O4   . . . . . . . . . rr_2l5z 1 
       .  5 .  3952 . 1 1 18 U O4'  O -36.523   7.000 28.865 . . . 1.0 . . . . . . . . . . . . A . 18 U O4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3953 . 1 1 18 U O5'  O -34.997   7.173 26.578 . . . 1.0 . . . . . . . . . . . . A . 18 U O5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3954 . 1 1 18 U OP1  O -35.022   7.725 24.136 . . . 1.0 . . . . . . . . . . . . A . 18 U OP1  . . . . . . . . . rr_2l5z 1 
       .  5 .  3955 . 1 1 18 U OP2  O -33.483   5.892 25.051 . . . 1.0 . . . . . . . . . . . . A . 18 U OP2  . . . . . . . . . rr_2l5z 1 
       .  5 .  3956 . 1 1 18 U P    P -34.771   6.618 25.085 . . . 1.0 . . . . . . . . . . . . A . 18 U P    . . . . . . . . . rr_2l5z 1 
       .  5 .  3957 . 1 1 19 G C1'  C -34.102   9.754 34.534 . . . 1.0 . . . . . . . . . . . . A . 19 G C1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3958 . 1 1 19 G C2   C -32.017   6.692 36.947 . . . 1.0 . . . . . . . . . . . . A . 19 G C2   . . . . . . . . . rr_2l5z 1 
       .  5 .  3959 . 1 1 19 G C2'  C -33.469  11.058 35.035 . . . 1.0 . . . . . . . . . . . . A . 19 G C2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3960 . 1 1 19 G C3'  C -33.647  12.005 33.856 . . . 1.0 . . . . . . . . . . . . A . 19 G C3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3961 . 1 1 19 G C4   C -32.485   7.829 35.088 . . . 1.0 . . . . . . . . . . . . A . 19 G C4   . . . . . . . . . rr_2l5z 1 
       .  5 .  3962 . 1 1 19 G C4'  C -34.916  11.487 33.200 . . . 1.0 . . . . . . . . . . . . A . 19 G C4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3963 . 1 1 19 G C5   C -31.587   7.122 34.302 . . . 1.0 . . . . . . . . . . . . A . 19 G C5   . . . . . . . . . rr_2l5z 1 
       .  5 .  3964 . 1 1 19 G C5'  C -35.006  11.893 31.730 . . . 1.0 . . . . . . . . . . . . A . 19 G C5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3965 . 1 1 19 G C6   C -30.813   6.083 34.888 . . . 1.0 . . . . . . . . . . . . A . 19 G C6   . . . . . . . . . rr_2l5z 1 
       .  5 .  3966 . 1 1 19 G C8   C -32.495   8.534 33.050 . . . 1.0 . . . . . . . . . . . . A . 19 G C8   . . . . . . . . . rr_2l5z 1 
       .  5 .  3967 . 1 1 19 G H1   H -30.578   5.190 36.738 . . . 1.0 . . . . . . . . . . . . A . 19 G H1   . . . . . . . . . rr_2l5z 1 
       .  5 .  3968 . 1 1 19 G H1'  H -34.780   9.367 35.294 . . . 1.0 . . . . . . . . . . . . A . 19 G H1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3969 . 1 1 19 G H2'  H -32.406  10.903 35.234 . . . 1.0 . . . . . . . . . . . . A . 19 G H2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3970 . 1 1 19 G H21  H -31.595   5.661 38.652 . . . 1.0 . . . . . . . . . . . . A . 19 G H21  . . . . . . . . . rr_2l5z 1 
       .  5 .  3971 . 1 1 19 G H22  H -32.800   6.919 38.813 . . . 1.0 . . . . . . . . . . . . A . 19 G H22  . . . . . . . . . rr_2l5z 1 
       .  5 .  3972 . 1 1 19 G H3'  H -32.789  11.978 33.182 . . . 1.0 . . . . . . . . . . . . A . 19 G H3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3973 . 1 1 19 G H4'  H -35.785  11.864 33.737 . . . 1.0 . . . . . . . . . . . . A . 19 G H4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3974 . 1 1 19 G H5'  H -35.964  11.563 31.328 . . . 1.0 . . . . . . . . . . . . A . 19 G H5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3975 . 1 1 19 G H5'' H -34.946  12.980 31.658 . . . 1.0 . . . . . . . . . . . . A . 19 G H5'' . . . . . . . . . rr_2l5z 1 
       .  5 .  3976 . 1 1 19 G H8   H -32.762   9.124 32.186 . . . 1.0 . . . . . . . . . . . . A . 19 G H8   . . . . . . . . . rr_2l5z 1 
       .  5 .  3977 . 1 1 19 G HO2' H -33.556  11.396 36.949 . . . 1.0 . . . . . . . . . . . . A . 19 G HO2' . . . . . . . . . rr_2l5z 1 
       .  5 .  3978 . 1 1 19 G N1   N -31.101   5.936 36.240 . . . 1.0 . . . . . . . . . . . . A . 19 G N1   . . . . . . . . . rr_2l5z 1 
       .  5 .  3979 . 1 1 19 G N2   N -32.147   6.400 38.242 . . . 1.0 . . . . . . . . . . . . A . 19 G N2   . . . . . . . . . rr_2l5z 1 
       .  5 .  3980 . 1 1 19 G N3   N -32.748   7.670 36.404 . . . 1.0 . . . . . . . . . . . . A . 19 G N3   . . . . . . . . . rr_2l5z 1 
       .  5 .  3981 . 1 1 19 G N7   N -31.608   7.594 32.979 . . . 1.0 . . . . . . . . . . . . A . 19 G N7   . . . . . . . . . rr_2l5z 1 
       .  5 .  3982 . 1 1 19 G N9   N -33.065   8.744 34.250 . . . 1.0 . . . . . . . . . . . . A . 19 G N9   . . . . . . . . . rr_2l5z 1 
       .  5 .  3983 . 1 1 19 G O2'  O -34.139  11.546 36.202 . . . 1.0 . . . . . . . . . . . . A . 19 G O2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3984 . 1 1 19 G O3'  O -33.901  13.318 34.363 . . . 1.0 . . . . . . . . . . . . A . 19 G O3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3985 . 1 1 19 G O4'  O -34.852  10.072 33.350 . . . 1.0 . . . . . . . . . . . . A . 19 G O4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3986 . 1 1 19 G O5'  O -33.951  11.316 30.958 . . . 1.0 . . . . . . . . . . . . A . 19 G O5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3987 . 1 1 19 G O6   O -29.980   5.356 34.353 . . . 1.0 . . . . . . . . . . . . A . 19 G O6   . . . . . . . . . rr_2l5z 1 
       .  5 .  3988 . 1 1 19 G OP1  O -34.385  12.613 28.859 . . . 1.0 . . . . . . . . . . . . A . 19 G OP1  . . . . . . . . . rr_2l5z 1 
       .  5 .  3989 . 1 1 19 G OP2  O -32.867  10.548 28.835 . . . 1.0 . . . . . . . . . . . . A . 19 G OP2  . . . . . . . . . rr_2l5z 1 
       .  5 .  3990 . 1 1 19 G P    P -34.059  11.256 29.352 . . . 1.0 . . . . . . . . . . . . A . 19 G P    . . . . . . . . . rr_2l5z 1 
       .  5 .  3991 . 1 1 20 A C1'  C -30.762  11.487 38.404 . . . 1.0 . . . . . . . . . . . . A . 20 A C1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3992 . 1 1 20 A C2   C -27.736   8.300 38.838 . . . 1.0 . . . . . . . . . . . . A . 20 A C2   . . . . . . . . . rr_2l5z 1 
       .  5 .  3993 . 1 1 20 A C2'  C -30.137  12.763 38.985 . . . 1.0 . . . . . . . . . . . . A . 20 A C2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3994 . 1 1 20 A C3'  C -30.955  13.882 38.349 . . . 1.0 . . . . . . . . . . . . A . 20 A C3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3995 . 1 1 20 A C4   C -28.917   9.815 37.752 . . . 1.0 . . . . . . . . . . . . A . 20 A C4   . . . . . . . . . rr_2l5z 1 
       .  5 .  3996 . 1 1 20 A C4'  C -32.291  13.213 38.067 . . . 1.0 . . . . . . . . . . . . A . 20 A C4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3997 . 1 1 20 A C5   C -28.304   9.545 36.550 . . . 1.0 . . . . . . . . . . . . A . 20 A C5   . . . . . . . . . rr_2l5z 1 
       .  5 .  3998 . 1 1 20 A C5'  C -33.060  13.915 36.949 . . . 1.0 . . . . . . . . . . . . A . 20 A C5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  3999 . 1 1 20 A C6   C -27.321   8.547 36.562 . . . 1.0 . . . . . . . . . . . . A . 20 A C6   . . . . . . . . . rr_2l5z 1 
       .  5 .  4000 . 1 1 20 A C8   C -29.694  11.063 36.178 . . . 1.0 . . . . . . . . . . . . A . 20 A C8   . . . . . . . . . rr_2l5z 1 
       .  5 .  4001 . 1 1 20 A H1'  H -31.023  10.812 39.217 . . . 1.0 . . . . . . . . . . . . A . 20 A H1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4002 . 1 1 20 A H2   H -27.481   7.769 39.753 . . . 1.0 . . . . . . . . . . . . A . 20 A H2   . . . . . . . . . rr_2l5z 1 
       .  5 .  4003 . 1 1 20 A H2'  H -29.088  12.838 38.678 . . . 1.0 . . . . . . . . . . . . A . 20 A H2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4004 . 1 1 20 A H3'  H -30.481  14.269 37.442 . . . 1.0 . . . . . . . . . . . . A . 20 A H3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4005 . 1 1 20 A H4'  H -32.893  13.202 38.973 . . . 1.0 . . . . . . . . . . . . A . 20 A H4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4006 . 1 1 20 A H5'  H -33.806  13.230 36.544 . . . 1.0 . . . . . . . . . . . . A . 20 A H5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4007 . 1 1 20 A H5'' H -33.567  14.788 37.361 . . . 1.0 . . . . . . . . . . . . A . 20 A H5'' . . . . . . . . . rr_2l5z 1 
       .  5 .  4008 . 1 1 20 A H61  H -25.945   7.451 35.540 . . . 1.0 . . . . . . . . . . . . A . 20 A H61  . . . . . . . . . rr_2l5z 1 
       .  5 .  4009 . 1 1 20 A H62  H -26.830   8.623 34.589 . . . 1.0 . . . . . . . . . . . . A . 20 A H62  . . . . . . . . . rr_2l5z 1 
       .  5 .  4010 . 1 1 20 A H8   H -30.290  11.817 35.687 . . . 1.0 . . . . . . . . . . . . A . 20 A H8   . . . . . . . . . rr_2l5z 1 
       .  5 .  4011 . 1 1 20 A HO2' H -31.162  12.599 40.633 . . . 1.0 . . . . . . . . . . . . A . 20 A HO2' . . . . . . . . . rr_2l5z 1 
       .  5 .  4012 . 1 1 20 A N1   N -27.066   7.944 37.739 . . . 1.0 . . . . . . . . . . . . A . 20 A N1   . . . . . . . . . rr_2l5z 1 
       .  5 .  4013 . 1 1 20 A N3   N -28.682   9.228 38.940 . . . 1.0 . . . . . . . . . . . . A . 20 A N3   . . . . . . . . . rr_2l5z 1 
       .  5 .  4014 . 1 1 20 A N6   N -26.644   8.177 35.476 . . . 1.0 . . . . . . . . . . . . A . 20 A N6   . . . . . . . . . rr_2l5z 1 
       .  5 .  4015 . 1 1 20 A N7   N -28.818  10.365 35.531 . . . 1.0 . . . . . . . . . . . . A . 20 A N7   . . . . . . . . . rr_2l5z 1 
       .  5 .  4016 . 1 1 20 A N9   N -29.823  10.809 37.493 . . . 1.0 . . . . . . . . . . . . A . 20 A N9   . . . . . . . . . rr_2l5z 1 
       .  5 .  4017 . 1 1 20 A O2'  O -30.247  12.788 40.414 . . . 1.0 . . . . . . . . . . . . A . 20 A O2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4018 . 1 1 20 A O3'  O -31.162  14.904 39.328 . . . 1.0 . . . . . . . . . . . . A . 20 A O3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4019 . 1 1 20 A O4'  O -31.959  11.876 37.712 . . . 1.0 . . . . . . . . . . . . A . 20 A O4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4020 . 1 1 20 A O5'  O -32.192  14.337 35.894 . . . 1.0 . . . . . . . . . . . . A . 20 A O5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4021 . 1 1 20 A OP1  O -33.350  15.755 34.186 . . . 1.0 . . . . . . . . . . . . A . 20 A OP1  . . . . . . . . . rr_2l5z 1 
       .  5 .  4022 . 1 1 20 A OP2  O -31.651  13.972 33.476 . . . 1.0 . . . . . . . . . . . . A . 20 A OP2  . . . . . . . . . rr_2l5z 1 
       .  5 .  4023 . 1 1 20 A P    P -32.731  14.424 34.381 . . . 1.0 . . . . . . . . . . . . A . 20 A P    . . . . . . . . . rr_2l5z 1 
       .  5 .  4024 . 1 1 21 C C1'  C -25.243  13.132 38.414 . . . 1.0 . . . . . . . . . . . . A . 21 C C1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4025 . 1 1 21 C C2   C -24.081  11.394 37.128 . . . 1.0 . . . . . . . . . . . . A . 21 C C2   . . . . . . . . . rr_2l5z 1 
       .  5 .  4026 . 1 1 21 C C2'  C -24.328  14.334 38.127 . . . 1.0 . . . . . . . . . . . . A . 21 C C2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4027 . 1 1 21 C C3'  C -25.295  15.510 38.039 . . . 1.0 . . . . . . . . . . . . A . 21 C C3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4028 . 1 1 21 C C4   C -25.036  10.456 35.201 . . . 1.0 . . . . . . . . . . . . A . 21 C C4   . . . . . . . . . rr_2l5z 1 
       .  5 .  4029 . 1 1 21 C C4'  C -26.470  15.048 38.885 . . . 1.0 . . . . . . . . . . . . A . 21 C C4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4030 . 1 1 21 C C5   C -26.209  11.260 35.354 . . . 1.0 . . . . . . . . . . . . A . 21 C C5   . . . . . . . . . rr_2l5z 1 
       .  5 .  4031 . 1 1 21 C C5'  C -27.765  15.778 38.522 . . . 1.0 . . . . . . . . . . . . A . 21 C C5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4032 . 1 1 21 C C6   C -26.258  12.103 36.403 . . . 1.0 . . . . . . . . . . . . A . 21 C C6   . . . . . . . . . rr_2l5z 1 
       .  5 .  4033 . 1 1 21 C H1'  H -24.908  12.630 39.323 . . . 1.0 . . . . . . . . . . . . A . 21 C H1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4034 . 1 1 21 C H2'  H -23.818  14.194 37.168 . . . 1.0 . . . . . . . . . . . . A . 21 C H2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4035 . 1 1 21 C H3'  H -25.588  15.725 37.008 . . . 1.0 . . . . . . . . . . . . A . 21 C H3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4036 . 1 1 21 C H4'  H -26.246  15.203 39.939 . . . 1.0 . . . . . . . . . . . . A . 21 C H4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4037 . 1 1 21 C H41  H -24.117   9.044 34.062 . . . 1.0 . . . . . . . . . . . . A . 21 C H41  . . . . . . . . . rr_2l5z 1 
       .  5 .  4038 . 1 1 21 C H42  H -25.698   9.545 33.506 . . . 1.0 . . . . . . . . . . . . A . 21 C H42  . . . . . . . . . rr_2l5z 1 
       .  5 .  4039 . 1 1 21 C H5   H -27.028  11.194 34.653 . . . 1.0 . . . . . . . . . . . . A . 21 C H5   . . . . . . . . . rr_2l5z 1 
       .  5 .  4040 . 1 1 21 C H5'  H -27.559  16.843 38.410 . . . 1.0 . . . . . . . . . . . . A . 21 C H5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4041 . 1 1 21 C H5'' H -28.141  15.386 37.577 . . . 1.0 . . . . . . . . . . . . A . 21 C H5'' . . . . . . . . . rr_2l5z 1 
       .  5 .  4042 . 1 1 21 C H6   H -27.129  12.725 36.551 . . . 1.0 . . . . . . . . . . . . A . 21 C H6   . . . . . . . . . rr_2l5z 1 
       .  5 .  4043 . 1 1 21 C HO2' H -23.793  14.233 39.996 . . . 1.0 . . . . . . . . . . . . A . 21 C HO2' . . . . . . . . . rr_2l5z 1 
       .  5 .  4044 . 1 1 21 C N1   N -25.217  12.179 37.281 . . . 1.0 . . . . . . . . . . . . A . 21 C N1   . . . . . . . . . rr_2l5z 1 
       .  5 .  4045 . 1 1 21 C N3   N -24.024  10.540 36.072 . . . 1.0 . . . . . . . . . . . . A . 21 C N3   . . . . . . . . . rr_2l5z 1 
       .  5 .  4046 . 1 1 21 C N4   N -24.944   9.613 34.174 . . . 1.0 . . . . . . . . . . . . A . 21 C N4   . . . . . . . . . rr_2l5z 1 
       .  5 .  4047 . 1 1 21 C O2   O -23.157  11.479 37.936 . . . 1.0 . . . . . . . . . . . . A . 21 C O2   . . . . . . . . . rr_2l5z 1 
       .  5 .  4048 . 1 1 21 C O2'  O -23.377  14.523 39.181 . . . 1.0 . . . . . . . . . . . . A . 21 C O2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4049 . 1 1 21 C O3'  O -24.689  16.640 38.674 . . . 1.0 . . . . . . . . . . . . A . 21 C O3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4050 . 1 1 21 C O4'  O -26.564  13.654 38.627 . . . 1.0 . . . . . . . . . . . . A . 21 C O4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4051 . 1 1 21 C O5'  O -28.761  15.602 39.532 . . . 1.0 . . . . . . . . . . . . A . 21 C O5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4052 . 1 1 21 C OP1  O -30.566  17.005 40.553 . . . 1.0 . . . . . . . . . . . . A . 21 C OP1  . . . . . . . . . rr_2l5z 1 
       .  5 .  4053 . 1 1 21 C OP2  O -30.306  16.852 38.008 . . . 1.0 . . . . . . . . . . . . A . 21 C OP2  . . . . . . . . . rr_2l5z 1 
       .  5 .  4054 . 1 1 21 C P    P -30.235  16.219 39.343 . . . 1.0 . . . . . . . . . . . . A . 21 C P    . . . . . . . . . rr_2l5z 1 
       .  5 .  4055 . 1 1 22 G C1'  C -19.822  14.289 39.960 . . . 1.0 . . . . . . . . . . . . A . 22 G C1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4056 . 1 1 22 G C2   C -17.575  11.136 37.812 . . . 1.0 . . . . . . . . . . . . A . 22 G C2   . . . . . . . . . rr_2l5z 1 
       .  5 .  4057 . 1 1 22 G C2'  C -18.674  15.297 39.935 . . . 1.0 . . . . . . . . . . . . A . 22 G C2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4058 . 1 1 22 G C3'  C -19.404  16.591 39.634 . . . 1.0 . . . . . . . . . . . . A . 22 G C3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4059 . 1 1 22 G C4   C -19.190  12.652 38.074 . . . 1.0 . . . . . . . . . . . . A . 22 G C4   . . . . . . . . . rr_2l5z 1 
       .  5 .  4060 . 1 1 22 G C4'  C -20.691  16.417 40.422 . . . 1.0 . . . . . . . . . . . . A . 22 G C4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4061 . 1 1 22 G C5   C -19.751  12.424 36.826 . . . 1.0 . . . . . . . . . . . . A . 22 G C5   . . . . . . . . . rr_2l5z 1 
       .  5 .  4062 . 1 1 22 G C5'  C -21.813  17.303 39.881 . . . 1.0 . . . . . . . . . . . . A . 22 G C5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4063 . 1 1 22 G C6   C -19.175  11.451 35.968 . . . 1.0 . . . . . . . . . . . . A . 22 G C6   . . . . . . . . . rr_2l5z 1 
       .  5 .  4064 . 1 1 22 G C8   C -20.901  13.918 37.736 . . . 1.0 . . . . . . . . . . . . A . 22 G C8   . . . . . . . . . rr_2l5z 1 
       .  5 .  4065 . 1 1 22 G H1   H -17.578  10.144 35.971 . . . 1.0 . . . . . . . . . . . . A . 22 G H1   . . . . . . . . . rr_2l5z 1 
       .  5 .  4066 . 1 1 22 G H1'  H -19.634  13.537 40.724 . . . 1.0 . . . . . . . . . . . . A . 22 G H1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4067 . 1 1 22 G H2'  H -17.980  15.058 39.125 . . . 1.0 . . . . . . . . . . . . A . 22 G H2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4068 . 1 1 22 G H21  H -16.097   9.756 37.582 . . . 1.0 . . . . . . . . . . . . A . 22 G H21  . . . . . . . . . rr_2l5z 1 
       .  5 .  4069 . 1 1 22 G H22  H -16.096  10.612 39.107 . . . 1.0 . . . . . . . . . . . . A . 22 G H22  . . . . . . . . . rr_2l5z 1 
       .  5 .  4070 . 1 1 22 G H3'  H -19.586  16.715 38.565 . . . 1.0 . . . . . . . . . . . . A . 22 G H3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4071 . 1 1 22 G H4'  H -20.513  16.652 41.469 . . . 1.0 . . . . . . . . . . . . A . 22 G H4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4072 . 1 1 22 G H5'  H -22.680  17.218 40.537 . . . 1.0 . . . . . . . . . . . . A . 22 G H5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4073 . 1 1 22 G H5'' H -21.474  18.339 39.874 . . . 1.0 . . . . . . . . . . . . A . 22 G H5'' . . . . . . . . . rr_2l5z 1 
       .  5 .  4074 . 1 1 22 G H8   H -21.650  14.671 37.921 . . . 1.0 . . . . . . . . . . . . A . 22 G H8   . . . . . . . . . rr_2l5z 1 
       .  5 .  4075 . 1 1 22 G HO2' H -18.144  14.515 41.637 . . . 1.0 . . . . . . . . . . . . A . 22 G HO2' . . . . . . . . . rr_2l5z 1 
       .  5 .  4076 . 1 1 22 G N1   N -18.068  10.848 36.554 . . . 1.0 . . . . . . . . . . . . A . 22 G N1   . . . . . . . . . rr_2l5z 1 
       .  5 .  4077 . 1 1 22 G N2   N -16.503  10.446 38.198 . . . 1.0 . . . . . . . . . . . . A . 22 G N2   . . . . . . . . . rr_2l5z 1 
       .  5 .  4078 . 1 1 22 G N3   N -18.113  12.051 38.627 . . . 1.0 . . . . . . . . . . . . A . 22 G N3   . . . . . . . . . rr_2l5z 1 
       .  5 .  4079 . 1 1 22 G N7   N -20.864  13.257 36.625 . . . 1.0 . . . . . . . . . . . . A . 22 G N7   . . . . . . . . . rr_2l5z 1 
       .  5 .  4080 . 1 1 22 G N9   N -19.959  13.631 38.648 . . . 1.0 . . . . . . . . . . . . A . 22 G N9   . . . . . . . . . rr_2l5z 1 
       .  5 .  4081 . 1 1 22 G O2'  O -17.996  15.354 41.195 . . . 1.0 . . . . . . . . . . . . A . 22 G O2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4082 . 1 1 22 G O3'  O -18.660  17.679 40.191 . . . 1.0 . . . . . . . . . . . . A . 22 G O3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4083 . 1 1 22 G O4'  O -21.011  15.028 40.298 . . . 1.0 . . . . . . . . . . . . A . 22 G O4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4084 . 1 1 22 G O5'  O -22.193  16.927 38.556 . . . 1.0 . . . . . . . . . . . . A . 22 G O5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4085 . 1 1 22 G O6   O -19.538  11.112 34.843 . . . 1.0 . . . . . . . . . . . . A . 22 G O6   . . . . . . . . . rr_2l5z 1 
       .  5 .  4086 . 1 1 22 G OP1  O -23.702  18.912 38.305 . . . 1.0 . . . . . . . . . . . . A . 22 G OP1  . . . . . . . . . rr_2l5z 1 
       .  5 .  4087 . 1 1 22 G OP2  O -23.581  17.118 36.479 . . . 1.0 . . . . . . . . . . . . A . 22 G OP2  . . . . . . . . . rr_2l5z 1 
       .  5 .  4088 . 1 1 22 G P    P -23.557  17.492 37.910 . . . 1.0 . . . . . . . . . . . . A . 22 G P    . . . . . . . . . rr_2l5z 1 
       .  5 .  4089 . 1 1 23 G C1'  C -15.246  14.591 37.044 . . . 1.0 . . . . . . . . . . . . A . 23 G C1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4090 . 1 1 23 G C2   C -15.577  12.267 33.304 . . . 1.0 . . . . . . . . . . . . A . 23 G C2   . . . . . . . . . rr_2l5z 1 
       .  5 .  4091 . 1 1 23 G C2'  C -14.070  15.392 36.475 . . . 1.0 . . . . . . . . . . . . A . 23 G C2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4092 . 1 1 23 G C3'  C -14.247  16.753 37.128 . . . 1.0 . . . . . . . . . . . . A . 23 G C3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4093 . 1 1 23 G C4   C -16.299  13.655 34.891 . . . 1.0 . . . . . . . . . . . . A . 23 G C4   . . . . . . . . . rr_2l5z 1 
       .  5 .  4094 . 1 1 23 G C4'  C -14.842  16.388 38.473 . . . 1.0 . . . . . . . . . . . . A . 23 G C4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4095 . 1 1 23 G C5   C -17.552  13.827 34.321 . . . 1.0 . . . . . . . . . . . . A . 23 G C5   . . . . . . . . . rr_2l5z 1 
       .  5 .  4096 . 1 1 23 G C5'  C -15.567  17.570 39.116 . . . 1.0 . . . . . . . . . . . . A . 23 G C5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4097 . 1 1 23 G C6   C -17.866  13.150 33.110 . . . 1.0 . . . . . . . . . . . . A . 23 G C6   . . . . . . . . . rr_2l5z 1 
       .  5 .  4098 . 1 1 23 G C8   C -17.521  14.990 36.065 . . . 1.0 . . . . . . . . . . . . A . 23 G C8   . . . . . . . . . rr_2l5z 1 
       .  5 .  4099 . 1 1 23 G H1   H -16.952  11.851 31.783 . . . 1.0 . . . . . . . . . . . . A . 23 G H1   . . . . . . . . . rr_2l5z 1 
       .  5 .  4100 . 1 1 23 G H1'  H -14.906  13.604 37.362 . . . 1.0 . . . . . . . . . . . . A . 23 G H1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4101 . 1 1 23 G H2'  H -14.169  15.482 35.389 . . . 1.0 . . . . . . . . . . . . A . 23 G H2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4102 . 1 1 23 G H21  H -14.902  11.000 31.859 . . . 1.0 . . . . . . . . . . . . A . 23 G H21  . . . . . . . . . rr_2l5z 1 
       .  5 .  4103 . 1 1 23 G H22  H -13.762  11.360 33.135 . . . 1.0 . . . . . . . . . . . . A . 23 G H22  . . . . . . . . . rr_2l5z 1 
       .  5 .  4104 . 1 1 23 G H3'  H -14.909  17.400 36.550 . . . 1.0 . . . . . . . . . . . . A . 23 G H3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4105 . 1 1 23 G H4'  H -14.056  16.034 39.139 . . . 1.0 . . . . . . . . . . . . A . 23 G H4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4106 . 1 1 23 G H5'  H -15.742  17.348 40.168 . . . 1.0 . . . . . . . . . . . . A . 23 G H5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4107 . 1 1 23 G H5'' H -14.938  18.458 39.042 . . . 1.0 . . . . . . . . . . . . A . 23 G H5'' . . . . . . . . . rr_2l5z 1 
       .  5 .  4108 . 1 1 23 G H8   H -17.809  15.660 36.862 . . . 1.0 . . . . . . . . . . . . A . 23 G H8   . . . . . . . . . rr_2l5z 1 
       .  5 .  4109 . 1 1 23 G HO2' H -13.002  13.945 37.219 . . . 1.0 . . . . . . . . . . . . A . 23 G HO2' . . . . . . . . . rr_2l5z 1 
       .  5 .  4110 . 1 1 23 G N1   N -16.798  12.378 32.666 . . . 1.0 . . . . . . . . . . . . A . 23 G N1   . . . . . . . . . rr_2l5z 1 
       .  5 .  4111 . 1 1 23 G N2   N -14.675  11.478 32.718 . . . 1.0 . . . . . . . . . . . . A . 23 G N2   . . . . . . . . . rr_2l5z 1 
       .  5 .  4112 . 1 1 23 G N3   N -15.274  12.898 34.441 . . . 1.0 . . . . . . . . . . . . A . 23 G N3   . . . . . . . . . rr_2l5z 1 
       .  5 .  4113 . 1 1 23 G N7   N -18.333  14.699 35.100 . . . 1.0 . . . . . . . . . . . . A . 23 G N7   . . . . . . . . . rr_2l5z 1 
       .  5 .  4114 . 1 1 23 G N9   N -16.303  14.422 36.028 . . . 1.0 . . . . . . . . . . . . A . 23 G N9   . . . . . . . . . rr_2l5z 1 
       .  5 .  4115 . 1 1 23 G O2'  O -12.814  14.801 36.827 . . . 1.0 . . . . . . . . . . . . A . 23 G O2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4116 . 1 1 23 G O3'  O -12.958  17.336 37.334 . . . 1.0 . . . . . . . . . . . . A . 23 G O3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4117 . 1 1 23 G O4'  O -15.733  15.314 38.188 . . . 1.0 . . . . . . . . . . . . A . 23 G O4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4118 . 1 1 23 G O5'  O -16.821  17.834 38.483 . . . 1.0 . . . . . . . . . . . . A . 23 G O5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4119 . 1 1 23 G O6   O -18.915  13.178 32.469 . . . 1.0 . . . . . . . . . . . . A . 23 G O6   . . . . . . . . . rr_2l5z 1 
       .  5 .  4120 . 1 1 23 G OP1  O -17.229  19.731 40.068 . . . 1.0 . . . . . . . . . . . . A . 23 G OP1  . . . . . . . . . rr_2l5z 1 
       .  5 .  4121 . 1 1 23 G OP2  O -18.909  19.191 38.210 . . . 1.0 . . . . . . . . . . . . A . 23 G OP2  . . . . . . . . . rr_2l5z 1 
       .  5 .  4122 . 1 1 23 G P    P -17.930  18.739 39.223 . . . 1.0 . . . . . . . . . . . . A . 23 G P    . . . . . . . . . rr_2l5z 1 
       .  5 .  4123 . 1 1 24 C C1'  C -12.785  15.616 31.852 . . . 1.0 . . . . . . . . . . . . A . 24 C C1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4124 . 1 1 24 C C2   C -14.836  14.827 30.680 . . . 1.0 . . . . . . . . . . . . A . 24 C C2   . . . . . . . . . rr_2l5z 1 
       .  5 .  4125 . 1 1 24 C C2'  C -12.256  16.825 31.064 . . . 1.0 . . . . . . . . . . . . A . 24 C C2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4126 . 1 1 24 C C3'  C -11.603  17.702 32.133 . . . 1.0 . . . . . . . . . . . . A . 24 C C3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4127 . 1 1 24 C C4   C -16.969  15.432 31.453 . . . 1.0 . . . . . . . . . . . . A . 24 C C4   . . . . . . . . . rr_2l5z 1 
       .  5 .  4128 . 1 1 24 C C4'  C -11.285  16.711 33.239 . . . 1.0 . . . . . . . . . . . . A . 24 C C4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4129 . 1 1 24 C C5   C -16.401  16.157 32.546 . . . 1.0 . . . . . . . . . . . . A . 24 C C5   . . . . . . . . . rr_2l5z 1 
       .  5 .  4130 . 1 1 24 C C5'  C -11.142  17.392 34.603 . . . 1.0 . . . . . . . . . . . . A . 24 C C5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4131 . 1 1 24 C C6   C -15.057  16.185 32.652 . . . 1.0 . . . . . . . . . . . . A . 24 C C6   . . . . . . . . . rr_2l5z 1 
       .  5 .  4132 . 1 1 24 C H1'  H -12.320  14.701 31.470 . . . 1.0 . . . . . . . . . . . . A . 24 C H1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4133 . 1 1 24 C H2'  H -13.091  17.359 30.599 . . . 1.0 . . . . . . . . . . . . A . 24 C H2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4134 . 1 1 24 C H3'  H -12.270  18.500 32.475 . . . 1.0 . . . . . . . . . . . . A . 24 C H3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4135 . 1 1 24 C H4'  H -10.368  16.177 33.000 . . . 1.0 . . . . . . . . . . . . A . 24 C H4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4136 . 1 1 24 C H41  H -18.698  14.873 30.536 . . . 1.0 . . . . . . . . . . . . A . 24 C H41  . . . . . . . . . rr_2l5z 1 
       .  5 .  4137 . 1 1 24 C H42  H -18.890  15.859 31.970 . . . 1.0 . . . . . . . . . . . . A . 24 C H42  . . . . . . . . . rr_2l5z 1 
       .  5 .  4138 . 1 1 24 C H5   H -17.027  16.666 33.262 . . . 1.0 . . . . . . . . . . . . A . 24 C H5   . . . . . . . . . rr_2l5z 1 
       .  5 .  4139 . 1 1 24 C H5'  H -10.886  16.641 35.350 . . . 1.0 . . . . . . . . . . . . A . 24 C H5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4140 . 1 1 24 C H5'' H -10.339  18.128 34.549 . . . 1.0 . . . . . . . . . . . . A . 24 C H5'' . . . . . . . . . rr_2l5z 1 
       .  5 .  4141 . 1 1 24 C H6   H -14.594  16.743 33.453 . . . 1.0 . . . . . . . . . . . . A . 24 C H6   . . . . . . . . . rr_2l5z 1 
       .  5 .  4142 . 1 1 24 C HO2' H -10.705  15.796 30.492 . . . 1.0 . . . . . . . . . . . . A . 24 C HO2' . . . . . . . . . rr_2l5z 1 
       .  5 .  4143 . 1 1 24 C N1   N -14.272  15.537 31.745 . . . 1.0 . . . . . . . . . . . . A . 24 C N1   . . . . . . . . . rr_2l5z 1 
       .  5 .  4144 . 1 1 24 C N3   N -16.191  14.798 30.567 . . . 1.0 . . . . . . . . . . . . A . 24 C N3   . . . . . . . . . rr_2l5z 1 
       .  5 .  4145 . 1 1 24 C N4   N -18.292  15.384 31.307 . . . 1.0 . . . . . . . . . . . . A . 24 C N4   . . . . . . . . . rr_2l5z 1 
       .  5 .  4146 . 1 1 24 C O2   O -14.110  14.250 29.871 . . . 1.0 . . . . . . . . . . . . A . 24 C O2   . . . . . . . . . rr_2l5z 1 
       .  5 .  4147 . 1 1 24 C O2'  O -11.302  16.421 30.074 . . . 1.0 . . . . . . . . . . . . A . 24 C O2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4148 . 1 1 24 C O3'  O -10.377  18.215 31.607 . . . 1.0 . . . . . . . . . . . . A . 24 C O3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4149 . 1 1 24 C O4'  O -12.376  15.802 33.216 . . . 1.0 . . . . . . . . . . . . A . 24 C O4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4150 . 1 1 24 C O5'  O -12.349  18.048 34.998 . . . 1.0 . . . . . . . . . . . . A . 24 C O5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4151 . 1 1 24 C OP1  O -11.172  19.054 36.967 . . . 1.0 . . . . . . . . . . . . A . 24 C OP1  . . . . . . . . . rr_2l5z 1 
       .  5 .  4152 . 1 1 24 C OP2  O -13.630  19.598 36.493 . . . 1.0 . . . . . . . . . . . . A . 24 C OP2  . . . . . . . . . rr_2l5z 1 
       .  5 .  4153 . 1 1 24 C P    P -12.508  18.632 36.490 . . . 1.0 . . . . . . . . . . . . A . 24 C P    . . . . . . . . . rr_2l5z 1 
       .  5 .  4154 . 1 1 25 U C1'  C -11.881  16.299 26.535 . . . 1.0 . . . . . . . . . . . . A . 25 U C1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4155 . 1 1 25 U C2   C -14.352  16.046 26.379 . . . 1.0 . . . . . . . . . . . . A . 25 U C2   . . . . . . . . . rr_2l5z 1 
       .  5 .  4156 . 1 1 25 U C2'  C -11.433  17.253 25.427 . . . 1.0 . . . . . . . . . . . . A . 25 U C2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4157 . 1 1 25 U C3'  C -10.649  18.294 26.201 . . . 1.0 . . . . . . . . . . . . A . 25 U C3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4158 . 1 1 25 U C4   C -15.853  17.403 27.790 . . . 1.0 . . . . . . . . . . . . A . 25 U C4   . . . . . . . . . rr_2l5z 1 
       .  5 .  4159 . 1 1 25 U C4'  C  -9.960  17.443 27.246 . . . 1.0 . . . . . . . . . . . . A . 25 U C4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4160 . 1 1 25 U C5   C -14.664  17.981 28.374 . . . 1.0 . . . . . . . . . . . . A . 25 U C5   . . . . . . . . . rr_2l5z 1 
       .  5 .  4161 . 1 1 25 U C5'  C  -9.512  18.268 28.450 . . . 1.0 . . . . . . . . . . . . A . 25 U C5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4162 . 1 1 25 U C6   C -13.430  17.594 27.970 . . . 1.0 . . . . . . . . . . . . A . 25 U C6   . . . . . . . . . rr_2l5z 1 
       .  5 .  4163 . 1 1 25 U H1'  H -11.838  15.272 26.159 . . . 1.0 . . . . . . . . . . . . A . 25 U H1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4164 . 1 1 25 U H2'  H -12.301  17.708 24.951 . . . 1.0 . . . . . . . . . . . . A . 25 U H2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4165 . 1 1 25 U H3   H -16.424  16.037 26.338 . . . 1.0 . . . . . . . . . . . . A . 25 U H3   . . . . . . . . . rr_2l5z 1 
       .  5 .  4166 . 1 1 25 U H3'  H -11.297  19.050 26.648 . . . 1.0 . . . . . . . . . . . . A . 25 U H3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4167 . 1 1 25 U H4'  H  -9.099  16.954 26.797 . . . 1.0 . . . . . . . . . . . . A . 25 U H4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4168 . 1 1 25 U H5   H -14.760  18.765 29.111 . . . 1.0 . . . . . . . . . . . . A . 25 U H5   . . . . . . . . . rr_2l5z 1 
       .  5 .  4169 . 1 1 25 U H5'  H  -8.933  17.631 29.120 . . . 1.0 . . . . . . . . . . . . A . 25 U H5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4170 . 1 1 25 U H5'' H  -8.879  19.085 28.104 . . . 1.0 . . . . . . . . . . . . A . 25 U H5'' . . . . . . . . . rr_2l5z 1 
       .  5 .  4171 . 1 1 25 U H6   H -12.562  18.048 28.422 . . . 1.0 . . . . . . . . . . . . A . 25 U H6   . . . . . . . . . rr_2l5z 1 
       .  5 .  4172 . 1 1 25 U HO2' H -11.064  16.632 23.619 . . . 1.0 . . . . . . . . . . . . A . 25 U HO2' . . . . . . . . . rr_2l5z 1 
       .  5 .  4173 . 1 1 25 U N1   N -13.257  16.651 26.993 . . . 1.0 . . . . . . . . . . . . A . 25 U N1   . . . . . . . . . rr_2l5z 1 
       .  5 .  4174 . 1 1 25 U N3   N -15.600  16.458 26.812 . . . 1.0 . . . . . . . . . . . . A . 25 U N3   . . . . . . . . . rr_2l5z 1 
       .  5 .  4175 . 1 1 25 U O2   O -14.220  15.196 25.502 . . . 1.0 . . . . . . . . . . . . A . 25 U O2   . . . . . . . . . rr_2l5z 1 
       .  5 .  4176 . 1 1 25 U O2'  O -10.609  16.587 24.463 . . . 1.0 . . . . . . . . . . . . A . 25 U O2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4177 . 1 1 25 U O3'  O  -9.656  18.859 25.341 . . . 1.0 . . . . . . . . . . . . A . 25 U O3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4178 . 1 1 25 U O4   O -17.008  17.690 28.100 . . . 1.0 . . . . . . . . . . . . A . 25 U O4   . . . . . . . . . rr_2l5z 1 
       .  5 .  4179 . 1 1 25 U O4'  O -10.927  16.452 27.606 . . . 1.0 . . . . . . . . . . . . A . 25 U O4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4180 . 1 1 25 U O5'  O -10.618  18.814 29.174 . . . 1.0 . . . . . . . . . . . . A . 25 U O5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4181 . 1 1 25 U OP1  O  -9.034  20.094 30.634 . . . 1.0 . . . . . . . . . . . . A . 25 U OP1  . . . . . . . . . rr_2l5z 1 
       .  5 .  4182 . 1 1 25 U OP2  O -11.568  20.316 30.940 . . . 1.0 . . . . . . . . . . . . A . 25 U OP2  . . . . . . . . . rr_2l5z 1 
       .  5 .  4183 . 1 1 25 U P    P -10.384  19.488 30.619 . . . 1.0 . . . . . . . . . . . . A . 25 U P    . . . . . . . . . rr_2l5z 1 
       .  5 .  4184 . 1 1 26 C C1'  C -14.391  19.170 22.326 . . . 1.0 . . . . . . . . . . . . A . 26 C C1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4185 . 1 1 26 C C2   C -16.535  19.876 23.280 . . . 1.0 . . . . . . . . . . . . A . 26 C C2   . . . . . . . . . rr_2l5z 1 
       .  5 .  4186 . 1 1 26 C C2'  C -14.224  20.269 21.272 . . . 1.0 . . . . . . . . . . . . A . 26 C C2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4187 . 1 1 26 C C3'  C -12.762  20.677 21.419 . . . 1.0 . . . . . . . . . . . . A . 26 C C3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4188 . 1 1 26 C C4   C -16.706  20.551 25.524 . . . 1.0 . . . . . . . . . . . . A . 26 C C4   . . . . . . . . . rr_2l5z 1 
       .  5 .  4189 . 1 1 26 C C4'  C -12.121  19.374 21.864 . . . 1.0 . . . . . . . . . . . . A . 26 C C4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4190 . 1 1 26 C C5   C -15.308  20.327 25.730 . . . 1.0 . . . . . . . . . . . . A . 26 C C5   . . . . . . . . . rr_2l5z 1 
       .  5 .  4191 . 1 1 26 C C5'  C -10.783  19.607 22.568 . . . 1.0 . . . . . . . . . . . . A . 26 C C5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4192 . 1 1 26 C C6   C -14.585  19.883 24.685 . . . 1.0 . . . . . . . . . . . . A . 26 C C6   . . . . . . . . . rr_2l5z 1 
       .  5 .  4193 . 1 1 26 C H1'  H -14.901  18.315 21.878 . . . 1.0 . . . . . . . . . . . . A . 26 C H1'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4194 . 1 1 26 C H2'  H -14.879  21.114 21.508 . . . 1.0 . . . . . . . . . . . . A . 26 C H2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4195 . 1 1 26 C H3'  H -12.660  21.442 22.198 . . . 1.0 . . . . . . . . . . . . A . 26 C H3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4196 . 1 1 26 C H4'  H -11.970  18.728 21.001 . . . 1.0 . . . . . . . . . . . . A . 26 C H4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4197 . 1 1 26 C H41  H -18.447  21.152 26.392 . . . 1.0 . . . . . . . . . . . . A . 26 C H41  . . . . . . . . . rr_2l5z 1 
       .  5 .  4198 . 1 1 26 C H42  H -17.042  21.166 27.436 . . . 1.0 . . . . . . . . . . . . A . 26 C H42  . . . . . . . . . rr_2l5z 1 
       .  5 .  4199 . 1 1 26 C H5   H -14.850  20.509 26.691 . . . 1.0 . . . . . . . . . . . . A . 26 C H5   . . . . . . . . . rr_2l5z 1 
       .  5 .  4200 . 1 1 26 C H5'  H -10.330  18.643 22.798 . . . 1.0 . . . . . . . . . . . . A . 26 C H5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4201 . 1 1 26 C H5'' H -10.123  20.161 21.901 . . . 1.0 . . . . . . . . . . . . A . 26 C H5'' . . . . . . . . . rr_2l5z 1 
       .  5 .  4202 . 1 1 26 C H6   H -13.526  19.703 24.805 . . . 1.0 . . . . . . . . . . . . A . 26 C H6   . . . . . . . . . rr_2l5z 1 
       .  5 .  4203 . 1 1 26 C HO2' H -15.044  20.423 19.512 . . . 1.0 . . . . . . . . . . . . A . 26 C HO2' . . . . . . . . . rr_2l5z 1 
       .  5 .  4204 . 1 1 26 C HO3' H -11.385  20.673 20.043 . . . 1.0 . . . . . . . . . . . . A . 26 C HO3' . . . . . . . . . rr_2l5z 1 
       .  5 .  4205 . 1 1 26 C N1   N -15.177  19.657 23.476 . . . 1.0 . . . . . . . . . . . . A . 26 C N1   . . . . . . . . . rr_2l5z 1 
       .  5 .  4206 . 1 1 26 C N3   N -17.273  20.325 24.332 . . . 1.0 . . . . . . . . . . . . A . 26 C N3   . . . . . . . . . rr_2l5z 1 
       .  5 .  4207 . 1 1 26 C N4   N -17.459  20.992 26.533 . . . 1.0 . . . . . . . . . . . . A . 26 C N4   . . . . . . . . . rr_2l5z 1 
       .  5 .  4208 . 1 1 26 C O2   O -17.044  19.665 22.181 . . . 1.0 . . . . . . . . . . . . A . 26 C O2   . . . . . . . . . rr_2l5z 1 
       .  5 .  4209 . 1 1 26 C O2'  O -14.494  19.772 19.956 . . . 1.0 . . . . . . . . . . . . A . 26 C O2'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4210 . 1 1 26 C O3'  O -12.218  21.133 20.175 . . . 1.0 . . . . . . . . . . . . A . 26 C O3'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4211 . 1 1 26 C O4'  O -13.074  18.775 22.733 . . . 1.0 . . . . . . . . . . . . A . 26 C O4'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4212 . 1 1 26 C O5'  O -10.946  20.346 23.781 . . . 1.0 . . . . . . . . . . . . A . 26 C O5'  . . . . . . . . . rr_2l5z 1 
       .  5 .  4213 . 1 1 26 C OP1  O  -8.508  20.755 24.175 . . . 1.0 . . . . . . . . . . . . A . 26 C OP1  . . . . . . . . . rr_2l5z 1 
       .  5 .  4214 . 1 1 26 C OP2  O -10.227  21.201 26.022 . . . 1.0 . . . . . . . . . . . . A . 26 C OP2  . . . . . . . . . rr_2l5z 1 
       .  5 .  4215 . 1 1 26 C P    P  -9.763  20.395 24.871 . . . 1.0 . . . . . . . . . . . . A . 26 C P    . . . . . . . . . rr_2l5z 1 
       .  6 .  4216 . 1 1  1 G C1'  C -24.860  21.115 24.038 . . . 1.0 . . . . . . . . . . . . A .  1 G C1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4217 . 1 1  1 G C2   C -20.466  21.524 23.666 . . . 1.0 . . . . . . . . . . . . A .  1 G C2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4218 . 1 1  1 G C2'  C -25.116  19.674 23.608 . . . 1.0 . . . . . . . . . . . . A .  1 G C2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4219 . 1 1  1 G C3'  C -26.226  19.245 24.549 . . . 1.0 . . . . . . . . . . . . A .  1 G C3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4220 . 1 1  1 G C4   C -22.395  21.315 24.765 . . . 1.0 . . . . . . . . . . . . A .  1 G C4   . . . . . . . . . rr_2l5z 1 
       .  6 .  4221 . 1 1  1 G C4'  C -27.029  20.531 24.728 . . . 1.0 . . . . . . . . . . . . A .  1 G C4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4222 . 1 1  1 G C5   C -21.802  21.324 26.019 . . . 1.0 . . . . . . . . . . . . A .  1 G C5   . . . . . . . . . rr_2l5z 1 
       .  6 .  4223 . 1 1  1 G C5'  C -27.771  20.566 26.066 . . . 1.0 . . . . . . . . . . . . A .  1 G C5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4224 . 1 1  1 G C6   C -20.390  21.446 26.123 . . . 1.0 . . . . . . . . . . . . A .  1 G C6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4225 . 1 1  1 G C8   C -23.863  21.131 26.335 . . . 1.0 . . . . . . . . . . . . A .  1 G C8   . . . . . . . . . rr_2l5z 1 
       .  6 .  4226 . 1 1  1 G H1   H -18.757  21.633 24.867 . . . 1.0 . . . . . . . . . . . . A .  1 G H1   . . . . . . . . . rr_2l5z 1 
       .  6 .  4227 . 1 1  1 G H1'  H -24.625  21.717 23.161 . . . 1.0 . . . . . . . . . . . . A .  1 G H1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4228 . 1 1  1 G H2'  H -24.223  19.068 23.781 . . . 1.0 . . . . . . . . . . . . A .  1 G H2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4229 . 1 1  1 G H21  H -18.712  21.716 22.651 . . . 1.0 . . . . . . . . . . . . A .  1 G H21  . . . . . . . . . rr_2l5z 1 
       .  6 .  4230 . 1 1  1 G H22  H -20.149  21.623 21.657 . . . 1.0 . . . . . . . . . . . . A .  1 G H22  . . . . . . . . . rr_2l5z 1 
       .  6 .  4231 . 1 1  1 G H3'  H -25.828  18.860 25.491 . . . 1.0 . . . . . . . . . . . . A .  1 G H3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4232 . 1 1  1 G H4'  H -27.747  20.624 23.915 . . . 1.0 . . . . . . . . . . . . A .  1 G H4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4233 . 1 1  1 G H5'  H -28.341  21.492 26.133 . . . 1.0 . . . . . . . . . . . . A .  1 G H5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4234 . 1 1  1 G H5'' H -28.458  19.720 26.114 . . . 1.0 . . . . . . . . . . . . A .  1 G H5'' . . . . . . . . . rr_2l5z 1 
       .  6 .  4235 . 1 1  1 G H8   H -24.828  21.031 26.809 . . . 1.0 . . . . . . . . . . . . A .  1 G H8   . . . . . . . . . rr_2l5z 1 
       .  6 .  4236 . 1 1  1 G HO2' H -25.734  18.680 22.052 . . . 1.0 . . . . . . . . . . . . A .  1 G HO2' . . . . . . . . . rr_2l5z 1 
       .  6 .  4237 . 1 1  1 G HO5' H -27.108  21.192 27.784 . . . 1.0 . . . . . . . . . . . . A .  1 G HO5' . . . . . . . . . rr_2l5z 1 
       .  6 .  4238 . 1 1  1 G N1   N -19.793  21.541 24.872 . . . 1.0 . . . . . . . . . . . . A .  1 G N1   . . . . . . . . . rr_2l5z 1 
       .  6 .  4239 . 1 1  1 G N2   N -19.715  21.630 22.569 . . . 1.0 . . . . . . . . . . . . A .  1 G N2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4240 . 1 1  1 G N3   N -21.795  21.410 23.558 . . . 1.0 . . . . . . . . . . . . A .  1 G N3   . . . . . . . . . rr_2l5z 1 
       .  6 .  4241 . 1 1  1 G N7   N -22.774  21.204 27.027 . . . 1.0 . . . . . . . . . . . . A .  1 G N7   . . . . . . . . . rr_2l5z 1 
       .  6 .  4242 . 1 1  1 G N9   N -23.740  21.188 24.997 . . . 1.0 . . . . . . . . . . . . A .  1 G N9   . . . . . . . . . rr_2l5z 1 
       .  6 .  4243 . 1 1  1 G O2'  O -25.530  19.600 22.240 . . . 1.0 . . . . . . . . . . . . A .  1 G O2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4244 . 1 1  1 G O3'  O -27.046  18.287 23.874 . . . 1.0 . . . . . . . . . . . . A .  1 G O3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4245 . 1 1  1 G O4'  O -26.078  21.595 24.634 . . . 1.0 . . . . . . . . . . . . A .  1 G O4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4246 . 1 1  1 G O5'  O -26.866  20.494 27.171 . . . 1.0 . . . . . . . . . . . . A .  1 G O5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4247 . 1 1  1 G O6   O -19.699  21.470 27.140 . . . 1.0 . . . . . . . . . . . . A .  1 G O6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4248 . 1 1  2 A C1'  C -22.116  15.482 22.385 . . . 1.0 . . . . . . . . . . . . A .  2 A C1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4249 . 1 1  2 A C2   C -18.287  15.886 24.574 . . . 1.0 . . . . . . . . . . . . A .  2 A C2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4250 . 1 1  2 A C2'  C -22.445  14.006 22.599 . . . 1.0 . . . . . . . . . . . . A .  2 A C2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4251 . 1 1  2 A C3'  C -23.948  14.038 22.790 . . . 1.0 . . . . . . . . . . . . A .  2 A C3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4252 . 1 1  2 A C4   C -20.453  16.168 24.233 . . . 1.0 . . . . . . . . . . . . A .  2 A C4   . . . . . . . . . rr_2l5z 1 
       .  6 .  4253 . 1 1  2 A C4'  C -24.374  15.147 21.836 . . . 1.0 . . . . . . . . . . . . A .  2 A C4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4254 . 1 1  2 A C5   C -20.624  16.863 25.409 . . . 1.0 . . . . . . . . . . . . A .  2 A C5   . . . . . . . . . rr_2l5z 1 
       .  6 .  4255 . 1 1  2 A C5'  C -25.706  15.776 22.249 . . . 1.0 . . . . . . . . . . . . A .  2 A C5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4256 . 1 1  2 A C6   C -19.483  17.054 26.194 . . . 1.0 . . . . . . . . . . . . A .  2 A C6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4257 . 1 1  2 A C8   C -22.506  16.763 24.502 . . . 1.0 . . . . . . . . . . . . A .  2 A C8   . . . . . . . . . rr_2l5z 1 
       .  6 .  4258 . 1 1  2 A H1'  H -21.315  15.574 21.650 . . . 1.0 . . . . . . . . . . . . A .  2 A H1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4259 . 1 1  2 A H2   H -17.316  15.493 24.272 . . . 1.0 . . . . . . . . . . . . A .  2 A H2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4260 . 1 1  2 A H2'  H -21.957  13.641 23.506 . . . 1.0 . . . . . . . . . . . . A .  2 A H2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4261 . 1 1  2 A H3'  H -24.218  14.252 23.827 . . . 1.0 . . . . . . . . . . . . A .  2 A H3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4262 . 1 1  2 A H4'  H -24.459  14.746 20.827 . . . 1.0 . . . . . . . . . . . . A .  2 A H4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4263 . 1 1  2 A H5'  H -25.902  16.644 21.617 . . . 1.0 . . . . . . . . . . . . A .  2 A H5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4264 . 1 1  2 A H5'' H -26.503  15.046 22.106 . . . 1.0 . . . . . . . . . . . . A .  2 A H5'' . . . . . . . . . rr_2l5z 1 
       .  6 .  4265 . 1 1  2 A H61  H -18.648  17.816 27.886 . . . 1.0 . . . . . . . . . . . . A .  2 A H61  . . . . . . . . . rr_2l5z 1 
       .  6 .  4266 . 1 1  2 A H62  H -20.367  18.088 27.707 . . . 1.0 . . . . . . . . . . . . A .  2 A H62  . . . . . . . . . rr_2l5z 1 
       .  6 .  4267 . 1 1  2 A H8   H -23.560  16.875 24.302 . . . 1.0 . . . . . . . . . . . . A .  2 A H8   . . . . . . . . . rr_2l5z 1 
       .  6 .  4268 . 1 1  2 A HO2' H -22.132  13.783 20.689 . . . 1.0 . . . . . . . . . . . . A .  2 A HO2' . . . . . . . . . rr_2l5z 1 
       .  6 .  4269 . 1 1  2 A N1   N -18.324  16.544 25.736 . . . 1.0 . . . . . . . . . . . . A .  2 A N1   . . . . . . . . . rr_2l5z 1 
       .  6 .  4270 . 1 1  2 A N3   N -19.306  15.649 23.750 . . . 1.0 . . . . . . . . . . . . A .  2 A N3   . . . . . . . . . rr_2l5z 1 
       .  6 .  4271 . 1 1  2 A N6   N -19.501  17.706 27.356 . . . 1.0 . . . . . . . . . . . . A .  2 A N6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4272 . 1 1  2 A N7   N -21.966  17.246 25.572 . . . 1.0 . . . . . . . . . . . . A .  2 A N7   . . . . . . . . . rr_2l5z 1 
       .  6 .  4273 . 1 1  2 A N9   N -21.693  16.111 23.651 . . . 1.0 . . . . . . . . . . . . A .  2 A N9   . . . . . . . . . rr_2l5z 1 
       .  6 .  4274 . 1 1  2 A O2'  O -22.076  13.215 21.463 . . . 1.0 . . . . . . . . . . . . A .  2 A O2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4275 . 1 1  2 A O3'  O -24.493  12.799 22.330 . . . 1.0 . . . . . . . . . . . . A .  2 A O3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4276 . 1 1  2 A O4'  O -23.309  16.102 21.872 . . . 1.0 . . . . . . . . . . . . A .  2 A O4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4277 . 1 1  2 A O5'  O -25.691  16.186 23.619 . . . 1.0 . . . . . . . . . . . . A .  2 A O5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4278 . 1 1  2 A OP1  O -28.191  16.067 23.701 . . . 1.0 . . . . . . . . . . . . A .  2 A OP1  . . . . . . . . . rr_2l5z 1 
       .  6 .  4279 . 1 1  2 A OP2  O -26.840  16.684 25.788 . . . 1.0 . . . . . . . . . . . . A .  2 A OP2  . . . . . . . . . rr_2l5z 1 
       .  6 .  4280 . 1 1  2 A P    P -27.029  16.740 24.321 . . . 1.0 . . . . . . . . . . . . A .  2 A P    . . . . . . . . . rr_2l5z 1 
       .  6 .  4281 . 1 1  3 G C1'  C -19.587  11.320 24.523 . . . 1.0 . . . . . . . . . . . . A .  3 G C1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4282 . 1 1  3 G C2   C -16.786  13.219 27.361 . . . 1.0 . . . . . . . . . . . . A .  3 G C2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4283 . 1 1  3 G C2'  C -19.665   9.877 25.036 . . . 1.0 . . . . . . . . . . . . A .  3 G C2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4284 . 1 1  3 G C3'  C -21.018   9.403 24.530 . . . 1.0 . . . . . . . . . . . . A .  3 G C3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4285 . 1 1  3 G C4   C -18.784  12.803 26.465 . . . 1.0 . . . . . . . . . . . . A .  3 G C4   . . . . . . . . . rr_2l5z 1 
       .  6 .  4286 . 1 1  3 G C4'  C -21.190  10.202 23.251 . . . 1.0 . . . . . . . . . . . . A .  3 G C4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4287 . 1 1  3 G C5   C -19.470  13.627 27.345 . . . 1.0 . . . . . . . . . . . . A .  3 G C5   . . . . . . . . . rr_2l5z 1 
       .  6 .  4288 . 1 1  3 G C5'  C -22.657  10.306 22.836 . . . 1.0 . . . . . . . . . . . . A .  3 G C5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4289 . 1 1  3 G C6   C -18.749  14.330 28.349 . . . 1.0 . . . . . . . . . . . . A .  3 G C6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4290 . 1 1  3 G C8   C -20.902  12.802 26.058 . . . 1.0 . . . . . . . . . . . . A .  3 G C8   . . . . . . . . . rr_2l5z 1 
       .  6 .  4291 . 1 1  3 G H1   H -16.791  14.540 28.986 . . . 1.0 . . . . . . . . . . . . A .  3 G H1   . . . . . . . . . rr_2l5z 1 
       .  6 .  4292 . 1 1  3 G H1'  H -18.621  11.481 24.041 . . . 1.0 . . . . . . . . . . . . A .  3 G H1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4293 . 1 1  3 G H2'  H -19.651   9.869 26.127 . . . 1.0 . . . . . . . . . . . . A .  3 G H2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4294 . 1 1  3 G H21  H -14.955  13.588 28.170 . . . 1.0 . . . . . . . . . . . . A .  3 G H21  . . . . . . . . . rr_2l5z 1 
       .  6 .  4295 . 1 1  3 G H22  H -14.969  12.485 26.812 . . . 1.0 . . . . . . . . . . . . A .  3 G H22  . . . . . . . . . rr_2l5z 1 
       .  6 .  4296 . 1 1  3 G H3'  H -21.814   9.600 25.251 . . . 1.0 . . . . . . . . . . . . A .  3 G H3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4297 . 1 1  3 G H4'  H -20.615   9.739 22.450 . . . 1.0 . . . . . . . . . . . . A .  3 G H4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4298 . 1 1  3 G H5'  H -22.717  10.799 21.866 . . . 1.0 . . . . . . . . . . . . A .  3 G H5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4299 . 1 1  3 G H5'' H -23.073   9.303 22.751 . . . 1.0 . . . . . . . . . . . . A .  3 G H5'' . . . . . . . . . rr_2l5z 1 
       .  6 .  4300 . 1 1  3 G H8   H -21.840  12.554 25.584 . . . 1.0 . . . . . . . . . . . . A .  3 G H8   . . . . . . . . . rr_2l5z 1 
       .  6 .  4301 . 1 1  3 G HO2' H -18.008   8.875 25.235 . . . 1.0 . . . . . . . . . . . . A .  3 G HO2' . . . . . . . . . rr_2l5z 1 
       .  6 .  4302 . 1 1  3 G N1   N -17.387  14.060 28.280 . . . 1.0 . . . . . . . . . . . . A .  3 G N1   . . . . . . . . . rr_2l5z 1 
       .  6 .  4303 . 1 1  3 G N2   N -15.463  13.087 27.456 . . . 1.0 . . . . . . . . . . . . A .  3 G N2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4304 . 1 1  3 G N3   N -17.457  12.555 26.416 . . . 1.0 . . . . . . . . . . . . A .  3 G N3   . . . . . . . . . rr_2l5z 1 
       .  6 .  4305 . 1 1  3 G N7   N -20.847  13.613 27.065 . . . 1.0 . . . . . . . . . . . . A .  3 G N7   . . . . . . . . . rr_2l5z 1 
       .  6 .  4306 . 1 1  3 G N9   N -19.738  12.276 25.636 . . . 1.0 . . . . . . . . . . . . A .  3 G N9   . . . . . . . . . rr_2l5z 1 
       .  6 .  4307 . 1 1  3 G O2'  O -18.601   9.078 24.508 . . . 1.0 . . . . . . . . . . . . A .  3 G O2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4308 . 1 1  3 G O3'  O -20.918   8.016 24.196 . . . 1.0 . . . . . . . . . . . . A .  3 G O3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4309 . 1 1  3 G O4'  O -20.633  11.479 23.549 . . . 1.0 . . . . . . . . . . . . A .  3 G O4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4310 . 1 1  3 G O5'  O -23.425  11.050 23.785 . . . 1.0 . . . . . . . . . . . . A .  3 G O5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4311 . 1 1  3 G O6   O -19.183  15.096 29.208 . . . 1.0 . . . . . . . . . . . . A .  3 G O6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4312 . 1 1  3 G OP1  O -25.611  10.581 22.654 . . . 1.0 . . . . . . . . . . . . A .  3 G OP1  . . . . . . . . . rr_2l5z 1 
       .  6 .  4313 . 1 1  3 G OP2  O -25.466  12.269 24.576 . . . 1.0 . . . . . . . . . . . . A .  3 G OP2  . . . . . . . . . rr_2l5z 1 
       .  6 .  4314 . 1 1  3 G P    P -24.869  11.637 23.379 . . . 1.0 . . . . . . . . . . . . A .  3 G P    . . . . . . . . . rr_2l5z 1 
       .  6 .  4315 . 1 1  4 C C1'  C -17.173   7.902 28.243 . . . 1.0 . . . . . . . . . . . . A .  4 C C1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4316 . 1 1  4 C C2   C -17.441   9.761 29.891 . . . 1.0 . . . . . . . . . . . . A .  4 C C2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4317 . 1 1  4 C C2'  C -17.206   6.571 29.002 . . . 1.0 . . . . . . . . . . . . A .  4 C C2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4318 . 1 1  4 C C3'  C -18.159   5.728 28.170 . . . 1.0 . . . . . . . . . . . . A .  4 C C3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4319 . 1 1  4 C C4   C -19.531  10.782 30.215 . . . 1.0 . . . . . . . . . . . . A .  4 C C4   . . . . . . . . . rr_2l5z 1 
       .  6 .  4320 . 1 1  4 C C4'  C -17.904   6.238 26.763 . . . 1.0 . . . . . . . . . . . . A .  4 C C4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4321 . 1 1  4 C C5   C -20.135   9.931 29.238 . . . 1.0 . . . . . . . . . . . . A .  4 C C5   . . . . . . . . . rr_2l5z 1 
       .  6 .  4322 . 1 1  4 C C5'  C -19.086   5.966 25.832 . . . 1.0 . . . . . . . . . . . . A .  4 C C5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4323 . 1 1  4 C C6   C -19.352   9.021 28.625 . . . 1.0 . . . . . . . . . . . . A .  4 C C6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4324 . 1 1  4 C H1'  H -16.137   8.250 28.164 . . . 1.0 . . . . . . . . . . . . A .  4 C H1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4325 . 1 1  4 C H2'  H -17.618   6.722 30.003 . . . 1.0 . . . . . . . . . . . . A .  4 C H2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4326 . 1 1  4 C H3'  H -19.196   5.862 28.481 . . . 1.0 . . . . . . . . . . . . A .  4 C H3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4327 . 1 1  4 C H4'  H -17.008   5.770 26.361 . . . 1.0 . . . . . . . . . . . . A .  4 C H4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4328 . 1 1  4 C H41  H -19.850  12.295 31.537 . . . 1.0 . . . . . . . . . . . . A .  4 C H41  . . . . . . . . . rr_2l5z 1 
       .  6 .  4329 . 1 1  4 C H42  H -21.255  11.776 30.637 . . . 1.0 . . . . . . . . . . . . A .  4 C H42  . . . . . . . . . rr_2l5z 1 
       .  6 .  4330 . 1 1  4 C H5   H -21.185  10.015 29.000 . . . 1.0 . . . . . . . . . . . . A .  4 C H5   . . . . . . . . . rr_2l5z 1 
       .  6 .  4331 . 1 1  4 C H5'  H -18.815   6.258 24.819 . . . 1.0 . . . . . . . . . . . . A .  4 C H5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4332 . 1 1  4 C H5'' H -19.311   4.899 25.847 . . . 1.0 . . . . . . . . . . . . A .  4 C H5'' . . . . . . . . . rr_2l5z 1 
       .  6 .  4333 . 1 1  4 C H6   H -19.788   8.339 27.906 . . . 1.0 . . . . . . . . . . . . A .  4 C H6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4334 . 1 1  4 C HO2' H -15.995   5.060 28.797 . . . 1.0 . . . . . . . . . . . . A .  4 C HO2' . . . . . . . . . rr_2l5z 1 
       .  6 .  4335 . 1 1  4 C N1   N -18.024   8.922 28.930 . . . 1.0 . . . . . . . . . . . . A .  4 C N1   . . . . . . . . . rr_2l5z 1 
       .  6 .  4336 . 1 1  4 C N3   N -18.230  10.679 30.511 . . . 1.0 . . . . . . . . . . . . A .  4 C N3   . . . . . . . . . rr_2l5z 1 
       .  6 .  4337 . 1 1  4 C N4   N -20.272  11.692 30.847 . . . 1.0 . . . . . . . . . . . . A .  4 C N4   . . . . . . . . . rr_2l5z 1 
       .  6 .  4338 . 1 1  4 C O2   O -16.245   9.656 30.162 . . . 1.0 . . . . . . . . . . . . A .  4 C O2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4339 . 1 1  4 C O2'  O -15.904   5.976 29.070 . . . 1.0 . . . . . . . . . . . . A .  4 C O2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4340 . 1 1  4 C O3'  O -17.740   4.362 28.241 . . . 1.0 . . . . . . . . . . . . A .  4 C O3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4341 . 1 1  4 C O4'  O -17.672   7.636 26.918 . . . 1.0 . . . . . . . . . . . . A .  4 C O4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4342 . 1 1  4 C O5'  O -20.252   6.693 26.231 . . . 1.0 . . . . . . . . . . . . A .  4 C O5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4343 . 1 1  4 C OP1  O -21.656   5.634 24.447 . . . 1.0 . . . . . . . . . . . . A .  4 C OP1  . . . . . . . . . rr_2l5z 1 
       .  6 .  4344 . 1 1  4 C OP2  O -22.618   7.469 25.954 . . . 1.0 . . . . . . . . . . . . A .  4 C OP2  . . . . . . . . . rr_2l5z 1 
       .  6 .  4345 . 1 1  4 C P    P -21.478   6.892 25.206 . . . 1.0 . . . . . . . . . . . . A .  4 C P    . . . . . . . . . rr_2l5z 1 
       .  6 .  4346 . 1 1  5 U C1'  C -16.064   6.243 33.097 . . . 1.0 . . . . . . . . . . . . A .  5 U C1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4347 . 1 1  5 U C2   C -17.770   7.726 34.117 . . . 1.0 . . . . . . . . . . . . A .  5 U C2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4348 . 1 1  5 U C2'  C -15.743   5.184 34.151 . . . 1.0 . . . . . . . . . . . . A .  5 U C2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4349 . 1 1  5 U C3'  C -15.965   3.887 33.395 . . . 1.0 . . . . . . . . . . . . A .  5 U C3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4350 . 1 1  5 U C4   C -20.148   7.556 33.484 . . . 1.0 . . . . . . . . . . . . A .  5 U C4   . . . . . . . . . rr_2l5z 1 
       .  6 .  4351 . 1 1  5 U C4'  C -15.521   4.246 31.979 . . . 1.0 . . . . . . . . . . . . A .  5 U C4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4352 . 1 1  5 U C5   C -19.757   6.499 32.579 . . . 1.0 . . . . . . . . . . . . A .  5 U C5   . . . . . . . . . rr_2l5z 1 
       .  6 .  4353 . 1 1  5 U C5'  C -16.217   3.390 30.918 . . . 1.0 . . . . . . . . . . . . A .  5 U C5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4354 . 1 1  5 U C6   C -18.462   6.113 32.475 . . . 1.0 . . . . . . . . . . . . A .  5 U C6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4355 . 1 1  5 U H1'  H -15.375   7.087 33.205 . . . 1.0 . . . . . . . . . . . . A .  5 U H1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4356 . 1 1  5 U H2'  H -16.449   5.258 34.986 . . . 1.0 . . . . . . . . . . . . A .  5 U H2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4357 . 1 1  5 U H3   H -19.331   8.859 34.876 . . . 1.0 . . . . . . . . . . . . A .  5 U H3   . . . . . . . . . rr_2l5z 1 
       .  6 .  4358 . 1 1  5 U H3'  H -17.008   3.565 33.440 . . . 1.0 . . . . . . . . . . . . A .  5 U H3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4359 . 1 1  5 U H4'  H -14.443   4.120 31.895 . . . 1.0 . . . . . . . . . . . . A .  5 U H4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4360 . 1 1  5 U H5   H -20.511   5.995 31.993 . . . 1.0 . . . . . . . . . . . . A .  5 U H5   . . . . . . . . . rr_2l5z 1 
       .  6 .  4361 . 1 1  5 U H5'  H -15.657   3.457 29.985 . . . 1.0 . . . . . . . . . . . . A .  5 U H5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4362 . 1 1  5 U H5'' H -16.233   2.350 31.248 . . . 1.0 . . . . . . . . . . . . A .  5 U H5'' . . . . . . . . . rr_2l5z 1 
       .  6 .  4363 . 1 1  5 U H6   H -18.202   5.318 31.792 . . . 1.0 . . . . . . . . . . . . A .  5 U H6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4364 . 1 1  5 U HO2' H -13.819   5.162 33.855 . . . 1.0 . . . . . . . . . . . . A .  5 U HO2' . . . . . . . . . rr_2l5z 1 
       .  6 .  4365 . 1 1  5 U N1   N -17.477   6.703 33.221 . . . 1.0 . . . . . . . . . . . . A .  5 U N1   . . . . . . . . . rr_2l5z 1 
       .  6 .  4366 . 1 1  5 U N3   N -19.098   8.101 34.202 . . . 1.0 . . . . . . . . . . . . A .  5 U N3   . . . . . . . . . rr_2l5z 1 
       .  6 .  4367 . 1 1  5 U O2   O -16.900   8.266 34.796 . . . 1.0 . . . . . . . . . . . . A .  5 U O2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4368 . 1 1  5 U O2'  O -14.391   5.297 34.613 . . . 1.0 . . . . . . . . . . . . A .  5 U O2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4369 . 1 1  5 U O3'  O -15.068   2.899 33.913 . . . 1.0 . . . . . . . . . . . . A .  5 U O3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4370 . 1 1  5 U O4   O -21.294   7.972 33.637 . . . 1.0 . . . . . . . . . . . . A .  5 U O4   . . . . . . . . . rr_2l5z 1 
       .  6 .  4371 . 1 1  5 U O4'  O -15.843   5.628 31.815 . . . 1.0 . . . . . . . . . . . . A .  5 U O4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4372 . 1 1  5 U O5'  O -17.558   3.829 30.689 . . . 1.0 . . . . . . . . . . . . A .  5 U O5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4373 . 1 1  5 U OP1  O -17.949   1.992 29.030 . . . 1.0 . . . . . . . . . . . . A .  5 U OP1  . . . . . . . . . rr_2l5z 1 
       .  6 .  4374 . 1 1  5 U OP2  O -19.782   3.710 29.540 . . . 1.0 . . . . . . . . . . . . A .  5 U OP2  . . . . . . . . . rr_2l5z 1 
       .  6 .  4375 . 1 1  5 U P    P -18.350   3.378 29.362 . . . 1.0 . . . . . . . . . . . . A .  5 U P    . . . . . . . . . rr_2l5z 1 
       .  6 .  4376 . 1 1  6 G C1'  C -17.788   4.946 38.486 . . . 1.0 . . . . . . . . . . . . A .  6 G C1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4377 . 1 1  6 G C2   C -20.483   8.433 38.115 . . . 1.0 . . . . . . . . . . . . A .  6 G C2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4378 . 1 1  6 G C2'  C -18.117   3.823 39.479 . . . 1.0 . . . . . . . . . . . . A .  6 G C2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4379 . 1 1  6 G C3'  C -17.248   2.659 39.009 . . . 1.0 . . . . . . . . . . . . A .  6 G C3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4380 . 1 1  6 G C4   C -19.728   6.396 37.613 . . . 1.0 . . . . . . . . . . . . A .  6 G C4   . . . . . . . . . rr_2l5z 1 
       .  6 .  4381 . 1 1  6 G C4'  C -16.097   3.355 38.293 . . . 1.0 . . . . . . . . . . . . A .  6 G C4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4382 . 1 1  6 G C5   C -20.690   6.163 36.641 . . . 1.0 . . . . . . . . . . . . A .  6 G C5   . . . . . . . . . rr_2l5z 1 
       .  6 .  4383 . 1 1  6 G C5'  C -15.433   2.451 37.254 . . . 1.0 . . . . . . . . . . . . A .  6 G C5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4384 . 1 1  6 G C6   C -21.660   7.163 36.364 . . . 1.0 . . . . . . . . . . . . A .  6 G C6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4385 . 1 1  6 G C8   C -19.487   4.449 36.715 . . . 1.0 . . . . . . . . . . . . A .  6 G C8   . . . . . . . . . rr_2l5z 1 
       .  6 .  4386 . 1 1  6 G H1   H -22.149   9.064 37.019 . . . 1.0 . . . . . . . . . . . . A .  6 G H1   . . . . . . . . . rr_2l5z 1 
       .  6 .  4387 . 1 1  6 G H1'  H -17.493   5.837 39.037 . . . 1.0 . . . . . . . . . . . . A .  6 G H1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4388 . 1 1  6 G H2'  H -19.176   3.559 39.402 . . . 1.0 . . . . . . . . . . . . A .  6 G H2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4389 . 1 1  6 G H21  H -21.164  10.294 38.581 . . . 1.0 . . . . . . . . . . . . A .  6 G H21  . . . . . . . . . rr_2l5z 1 
       .  6 .  4390 . 1 1  6 G H22  H -19.772   9.753 39.490 . . . 1.0 . . . . . . . . . . . . A .  6 G H22  . . . . . . . . . rr_2l5z 1 
       .  6 .  4391 . 1 1  6 G H3'  H -17.797   1.978 38.352 . . . 1.0 . . . . . . . . . . . . A .  6 G H3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4392 . 1 1  6 G H4'  H -15.356   3.677 39.023 . . . 1.0 . . . . . . . . . . . . A .  6 G H4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4393 . 1 1  6 G H5'  H -14.461   2.869 36.989 . . . 1.0 . . . . . . . . . . . . A .  6 G H5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4394 . 1 1  6 G H5'' H -15.288   1.459 37.682 . . . 1.0 . . . . . . . . . . . . A .  6 G H5'' . . . . . . . . . rr_2l5z 1 
       .  6 .  4395 . 1 1  6 G H8   H -19.074   3.470 36.518 . . . 1.0 . . . . . . . . . . . . A .  6 G H8   . . . . . . . . . rr_2l5z 1 
       .  6 .  4396 . 1 1  6 G HO2' H -17.591   3.406 41.307 . . . 1.0 . . . . . . . . . . . . A .  6 G HO2' . . . . . . . . . rr_2l5z 1 
       .  6 .  4397 . 1 1  6 G N1   N -21.476   8.286 37.164 . . . 1.0 . . . . . . . . . . . . A .  6 G N1   . . . . . . . . . rr_2l5z 1 
       .  6 .  4398 . 1 1  6 G N2   N -20.472   9.586 38.782 . . . 1.0 . . . . . . . . . . . . A .  6 G N2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4399 . 1 1  6 G N3   N -19.567   7.496 38.381 . . . 1.0 . . . . . . . . . . . . A .  6 G N3   . . . . . . . . . rr_2l5z 1 
       .  6 .  4400 . 1 1  6 G N7   N -20.517   4.890 36.069 . . . 1.0 . . . . . . . . . . . . A .  6 G N7   . . . . . . . . . rr_2l5z 1 
       .  6 .  4401 . 1 1  6 G N9   N -18.956   5.264 37.643 . . . 1.0 . . . . . . . . . . . . A .  6 G N9   . . . . . . . . . rr_2l5z 1 
       .  6 .  4402 . 1 1  6 G O2'  O -17.789   4.208 40.820 . . . 1.0 . . . . . . . . . . . . A .  6 G O2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4403 . 1 1  6 G O3'  O -16.723   1.992 40.161 . . . 1.0 . . . . . . . . . . . . A .  6 G O3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4404 . 1 1  6 G O4'  O -16.683   4.500 37.687 . . . 1.0 . . . . . . . . . . . . A .  6 G O4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4405 . 1 1  6 G O5'  O -16.227   2.337 36.070 . . . 1.0 . . . . . . . . . . . . A .  6 G O5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4406 . 1 1  6 G O6   O -22.578   7.133 35.548 . . . 1.0 . . . . . . . . . . . . A .  6 G O6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4407 . 1 1  6 G OP1  O -14.477   0.803 35.148 . . . 1.0 . . . . . . . . . . . . A .  6 G OP1  . . . . . . . . . rr_2l5z 1 
       .  6 .  4408 . 1 1  6 G OP2  O -16.750   1.045 33.989 . . . 1.0 . . . . . . . . . . . . A .  6 G OP2  . . . . . . . . . rr_2l5z 1 
       .  6 .  4409 . 1 1  6 G P    P -15.628   1.643 34.747 . . . 1.0 . . . . . . . . . . . . A .  6 G P    . . . . . . . . . rr_2l5z 1 
       .  6 .  4410 . 1 1  7 C C1'  C -18.748   4.938 44.934 . . . 1.0 . . . . . . . . . . . . A .  7 C C1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4411 . 1 1  7 C C2   C -20.933   6.022 44.658 . . . 1.0 . . . . . . . . . . . . A .  7 C C2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4412 . 1 1  7 C C2'  C -19.128   3.812 45.899 . . . 1.0 . . . . . . . . . . . . A .  7 C C2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4413 . 1 1  7 C C3'  C -18.499   2.585 45.259 . . . 1.0 . . . . . . . . . . . . A .  7 C C3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4414 . 1 1  7 C C4   C -22.044   6.016 42.588 . . . 1.0 . . . . . . . . . . . . A .  7 C C4   . . . . . . . . . rr_2l5z 1 
       .  6 .  4415 . 1 1  7 C C4'  C -17.268   3.156 44.564 . . . 1.0 . . . . . . . . . . . . A .  7 C C4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4416 . 1 1  7 C C5   C -20.978   5.277 41.985 . . . 1.0 . . . . . . . . . . . . A .  7 C C5   . . . . . . . . . rr_2l5z 1 
       .  6 .  4417 . 1 1  7 C C5'  C -16.825   2.292 43.378 . . . 1.0 . . . . . . . . . . . . A .  7 C C5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4418 . 1 1  7 C C6   C -19.929   4.944 42.761 . . . 1.0 . . . . . . . . . . . . A .  7 C C6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4419 . 1 1  7 C H1'  H -18.428   5.811 45.505 . . . 1.0 . . . . . . . . . . . . A .  7 C H1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4420 . 1 1  7 C H2'  H -20.216   3.702 45.933 . . . 1.0 . . . . . . . . . . . . A .  7 C H2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4421 . 1 1  7 C H3'  H -19.185   2.096 44.564 . . . 1.0 . . . . . . . . . . . . A .  7 C H3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4422 . 1 1  7 C H4'  H -16.451   3.236 45.279 . . . 1.0 . . . . . . . . . . . . A .  7 C H4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4423 . 1 1  7 C H41  H -23.856   6.888 42.276 . . . 1.0 . . . . . . . . . . . . A .  7 C H41  . . . . . . . . . rr_2l5z 1 
       .  6 .  4424 . 1 1  7 C H42  H -23.146   6.109 40.880 . . . 1.0 . . . . . . . . . . . . A .  7 C H42  . . . . . . . . . rr_2l5z 1 
       .  6 .  4425 . 1 1  7 C H5   H -21.013   4.995 40.943 . . . 1.0 . . . . . . . . . . . . A .  7 C H5   . . . . . . . . . rr_2l5z 1 
       .  6 .  4426 . 1 1  7 C H5'  H -15.943   2.742 42.921 . . . 1.0 . . . . . . . . . . . . A .  7 C H5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4427 . 1 1  7 C H5'' H -16.570   1.296 43.740 . . . 1.0 . . . . . . . . . . . . A .  7 C H5'' . . . . . . . . . rr_2l5z 1 
       .  6 .  4428 . 1 1  7 C H6   H -19.108   4.383 42.339 . . . 1.0 . . . . . . . . . . . . A .  7 C H6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4429 . 1 1  7 C HO2' H -17.695   4.353 47.102 . . . 1.0 . . . . . . . . . . . . A .  7 C HO2' . . . . . . . . . rr_2l5z 1 
       .  6 .  4430 . 1 1  7 C N1   N -19.896   5.305 44.077 . . . 1.0 . . . . . . . . . . . . A .  7 C N1   . . . . . . . . . rr_2l5z 1 
       .  6 .  4431 . 1 1  7 C N3   N -21.997   6.362 43.881 . . . 1.0 . . . . . . . . . . . . A .  7 C N3   . . . . . . . . . rr_2l5z 1 
       .  6 .  4432 . 1 1  7 C N4   N -23.101   6.365 41.855 . . . 1.0 . . . . . . . . . . . . A .  7 C N4   . . . . . . . . . rr_2l5z 1 
       .  6 .  4433 . 1 1  7 C O2   O -20.876   6.335 45.846 . . . 1.0 . . . . . . . . . . . . A .  7 C O2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4434 . 1 1  7 C O2'  O -18.599   4.047 47.208 . . . 1.0 . . . . . . . . . . . . A .  7 C O2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4435 . 1 1  7 C O3'  O -18.065   1.706 46.300 . . . 1.0 . . . . . . . . . . . . A .  7 C O3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4436 . 1 1  7 C O4'  O -17.647   4.464 44.139 . . . 1.0 . . . . . . . . . . . . A .  7 C O4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4437 . 1 1  7 C O5'  O -17.857   2.182 42.395 . . . 1.0 . . . . . . . . . . . . A .  7 C O5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4438 . 1 1  7 C OP1  O -16.977  -0.030 41.618 . . . 1.0 . . . . . . . . . . . . A .  7 C OP1  . . . . . . . . . rr_2l5z 1 
       .  6 .  4439 . 1 1  7 C OP2  O -19.015   1.039 40.490 . . . 1.0 . . . . . . . . . . . . A .  7 C OP2  . . . . . . . . . rr_2l5z 1 
       .  6 .  4440 . 1 1  7 C P    P -17.697   1.175 41.149 . . . 1.0 . . . . . . . . . . . . A .  7 C P    . . . . . . . . . rr_2l5z 1 
       .  6 .  4441 . 1 1  8 A C1'  C -23.931   1.813 44.594 . . . 1.0 . . . . . . . . . . . . A .  8 A C1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4442 . 1 1  8 A C2   C -26.131   5.334 43.071 . . . 1.0 . . . . . . . . . . . . A .  8 A C2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4443 . 1 1  8 A C2'  C -23.226   1.555 43.255 . . . 1.0 . . . . . . . . . . . . A .  8 A C2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4444 . 1 1  8 A C3'  C -22.078   0.602 43.614 . . . 1.0 . . . . . . . . . . . . A .  8 A C3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4445 . 1 1  8 A C4   C -24.692   4.264 44.360 . . . 1.0 . . . . . . . . . . . . A .  8 A C4   . . . . . . . . . rr_2l5z 1 
       .  6 .  4446 . 1 1  8 A C4'  C -22.494   0.032 44.968 . . . 1.0 . . . . . . . . . . . . A .  8 A C4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4447 . 1 1  8 A C5   C -24.323   5.409 45.029 . . . 1.0 . . . . . . . . . . . . A .  8 A C5   . . . . . . . . . rr_2l5z 1 
       .  6 .  4448 . 1 1  8 A C5'  C -21.292  -0.402 45.813 . . . 1.0 . . . . . . . . . . . . A .  8 A C5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4449 . 1 1  8 A C6   C -24.955   6.593 44.635 . . . 1.0 . . . . . . . . . . . . A .  8 A C6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4450 . 1 1  8 A C8   C -23.201   3.849 45.859 . . . 1.0 . . . . . . . . . . . . A .  8 A C8   . . . . . . . . . rr_2l5z 1 
       .  6 .  4451 . 1 1  8 A H1'  H -24.956   1.446 44.537 . . . 1.0 . . . . . . . . . . . . A .  8 A H1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4452 . 1 1  8 A H2   H -26.875   5.342 42.274 . . . 1.0 . . . . . . . . . . . . A .  8 A H2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4453 . 1 1  8 A H2'  H -22.831   2.498 42.859 . . . 1.0 . . . . . . . . . . . . A .  8 A H2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4454 . 1 1  8 A H3'  H -21.113   1.117 43.651 . . . 1.0 . . . . . . . . . . . . A .  8 A H3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4455 . 1 1  8 A H4'  H -23.156  -0.820 44.815 . . . 1.0 . . . . . . . . . . . . A .  8 A H4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4456 . 1 1  8 A H5'  H -21.607  -0.506 46.852 . . . 1.0 . . . . . . . . . . . . A .  8 A H5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4457 . 1 1  8 A H5'' H -20.932  -1.364 45.452 . . . 1.0 . . . . . . . . . . . . A .  8 A H5'' . . . . . . . . . rr_2l5z 1 
       .  6 .  4458 . 1 1  8 A H61  H -25.186   8.602 44.869 . . . 1.0 . . . . . . . . . . . . A .  8 A H61  . . . . . . . . . rr_2l5z 1 
       .  6 .  4459 . 1 1  8 A H62  H -24.023   7.848 45.938 . . . 1.0 . . . . . . . . . . . . A .  8 A H62  . . . . . . . . . rr_2l5z 1 
       .  6 .  4460 . 1 1  8 A H8   H -22.508   3.287 46.467 . . . 1.0 . . . . . . . . . . . . A .  8 A H8   . . . . . . . . . rr_2l5z 1 
       .  6 .  4461 . 1 1  8 A HO2' H -24.957   1.419 42.374 . . . 1.0 . . . . . . . . . . . . A .  8 A HO2' . . . . . . . . . rr_2l5z 1 
       .  6 .  4462 . 1 1  8 A N1   N -25.861   6.510 43.643 . . . 1.0 . . . . . . . . . . . . A .  8 A N1   . . . . . . . . . rr_2l5z 1 
       .  6 .  4463 . 1 1  8 A N3   N -25.593   4.153 43.365 . . . 1.0 . . . . . . . . . . . . A .  8 A N3   . . . . . . . . . rr_2l5z 1 
       .  6 .  4464 . 1 1  8 A N6   N -24.701   7.776 45.192 . . . 1.0 . . . . . . . . . . . . A .  8 A N6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4465 . 1 1  8 A N7   N -23.350   5.125 46.004 . . . 1.0 . . . . . . . . . . . . A .  8 A N7   . . . . . . . . . rr_2l5z 1 
       .  6 .  4466 . 1 1  8 A N9   N -23.949   3.253 44.913 . . . 1.0 . . . . . . . . . . . . A .  8 A N9   . . . . . . . . . rr_2l5z 1 
       .  6 .  4467 . 1 1  8 A O2'  O -24.120   0.953 42.312 . . . 1.0 . . . . . . . . . . . . A .  8 A O2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4468 . 1 1  8 A O3'  O -22.075  -0.468 42.662 . . . 1.0 . . . . . . . . . . . . A .  8 A O3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4469 . 1 1  8 A O4'  O -23.221   1.077 45.595 . . . 1.0 . . . . . . . . . . . . A .  8 A O4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4470 . 1 1  8 A O5'  O -20.228   0.552 45.742 . . . 1.0 . . . . . . . . . . . . A .  8 A O5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4471 . 1 1  8 A OP1  O -19.538   0.840 48.133 . . . 1.0 . . . . . . . . . . . . A .  8 A OP1  . . . . . . . . . rr_2l5z 1 
       .  6 .  4472 . 1 1  8 A OP2  O -18.279  -0.773 46.591 . . . 1.0 . . . . . . . . . . . . A .  8 A OP2  . . . . . . . . . rr_2l5z 1 
       .  6 .  4473 . 1 1  8 A P    P -19.009   0.497 46.793 . . . 1.0 . . . . . . . . . . . . A .  8 A P    . . . . . . . . . rr_2l5z 1 
       .  6 .  4474 . 1 1  9 G C1'  C -23.802   1.816 39.406 . . . 1.0 . . . . . . . . . . . . A .  9 G C1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4475 . 1 1  9 G C2   C -26.720   4.788 37.968 . . . 1.0 . . . . . . . . . . . . A .  9 G C2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4476 . 1 1  9 G C2'  C -24.852   0.721 39.181 . . . 1.0 . . . . . . . . . . . . A .  9 G C2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4477 . 1 1  9 G C3'  C -24.089  -0.590 39.428 . . . 1.0 . . . . . . . . . . . . A .  9 G C3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4478 . 1 1  9 G C4   C -24.793   3.670 37.932 . . . 1.0 . . . . . . . . . . . . A .  9 G C4   . . . . . . . . . rr_2l5z 1 
       .  6 .  4479 . 1 1  9 G C4'  C -22.780  -0.128 40.073 . . . 1.0 . . . . . . . . . . . . A .  9 G C4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4480 . 1 1  9 G C5   C -24.309   4.324 36.810 . . . 1.0 . . . . . . . . . . . . A .  9 G C5   . . . . . . . . . rr_2l5z 1 
       .  6 .  4481 . 1 1  9 G C5'  C -21.616  -1.085 39.799 . . . 1.0 . . . . . . . . . . . . A .  9 G C5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4482 . 1 1  9 G C6   C -25.108   5.322 36.186 . . . 1.0 . . . . . . . . . . . . A .  9 G C6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4483 . 1 1  9 G C8   C -22.832   2.957 37.392 . . . 1.0 . . . . . . . . . . . . A .  9 G C8   . . . . . . . . . rr_2l5z 1 
       .  6 .  4484 . 1 1  9 G H1   H -26.964   6.197 36.446 . . . 1.0 . . . . . . . . . . . . A .  9 G H1   . . . . . . . . . rr_2l5z 1 
       .  6 .  4485 . 1 1  9 G H1'  H -24.018   2.336 40.339 . . . 1.0 . . . . . . . . . . . . A .  9 G H1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4486 . 1 1  9 G H2'  H -25.213   0.767 38.147 . . . 1.0 . . . . . . . . . . . . A .  9 G H2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4487 . 1 1  9 G H21  H -28.482   5.806 38.013 . . . 1.0 . . . . . . . . . . . . A .  9 G H21  . . . . . . . . . rr_2l5z 1 
       .  6 .  4488 . 1 1  9 G H22  H -28.264   4.621 39.281 . . . 1.0 . . . . . . . . . . . . A .  9 G H22  . . . . . . . . . rr_2l5z 1 
       .  6 .  4489 . 1 1  9 G H3'  H -23.924  -1.154 38.503 . . . 1.0 . . . . . . . . . . . . A .  9 G H3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4490 . 1 1  9 G H4'  H -22.921  -0.030 41.147 . . . 1.0 . . . . . . . . . . . . A .  9 G H4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4491 . 1 1  9 G H5'  H -21.967  -2.112 39.901 . . . 1.0 . . . . . . . . . . . . A .  9 G H5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4492 . 1 1  9 G H5'' H -21.259  -0.929 38.781 . . . 1.0 . . . . . . . . . . . . A .  9 G H5'' . . . . . . . . . rr_2l5z 1 
       .  6 .  4493 . 1 1  9 G H8   H -21.920   2.378 37.431 . . . 1.0 . . . . . . . . . . . . A .  9 G H8   . . . . . . . . . rr_2l5z 1 
       .  6 .  4494 . 1 1  9 G HO2' H -25.593   0.713 40.980 . . . 1.0 . . . . . . . . . . . . A .  9 G HO2' . . . . . . . . . rr_2l5z 1 
       .  6 .  4495 . 1 1  9 G N1   N -26.320   5.488 36.847 . . . 1.0 . . . . . . . . . . . . A .  9 G N1   . . . . . . . . . rr_2l5z 1 
       .  6 .  4496 . 1 1  9 G N2   N -27.919   5.096 38.460 . . . 1.0 . . . . . . . . . . . . A .  9 G N2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4497 . 1 1  9 G N3   N -25.977   3.850 38.558 . . . 1.0 . . . . . . . . . . . . A .  9 G N3   . . . . . . . . . rr_2l5z 1 
       .  6 .  4498 . 1 1  9 G N7   N -23.031   3.846 36.472 . . . 1.0 . . . . . . . . . . . . A .  9 G N7   . . . . . . . . . rr_2l5z 1 
       .  6 .  4499 . 1 1  9 G N9   N -23.815   2.784 38.294 . . . 1.0 . . . . . . . . . . . . A .  9 G N9   . . . . . . . . . rr_2l5z 1 
       .  6 .  4500 . 1 1  9 G O2'  O -25.941   0.861 40.098 . . . 1.0 . . . . . . . . . . . . A .  9 G O2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4501 . 1 1  9 G O3'  O -24.823  -1.349 40.394 . . . 1.0 . . . . . . . . . . . . A .  9 G O3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4502 . 1 1  9 G O4'  O -22.543   1.155 39.517 . . . 1.0 . . . . . . . . . . . . A .  9 G O4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4503 . 1 1  9 G O5'  O -20.536  -0.870 40.711 . . . 1.0 . . . . . . . . . . . . A .  9 G O5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4504 . 1 1  9 G O6   O -24.848   6.002 35.194 . . . 1.0 . . . . . . . . . . . . A .  9 G O6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4505 . 1 1  9 G OP1  O -20.918  -2.675 42.406 . . . 1.0 . . . . . . . . . . . . A .  9 G OP1  . . . . . . . . . rr_2l5z 1 
       .  6 .  4506 . 1 1  9 G OP2  O -19.596  -0.567 43.015 . . . 1.0 . . . . . . . . . . . . A .  9 G OP2  . . . . . . . . . rr_2l5z 1 
       .  6 .  4507 . 1 1  9 G P    P -20.702  -1.217 42.275 . . . 1.0 . . . . . . . . . . . . A .  9 G P    . . . . . . . . . rr_2l5z 1 
       .  6 .  4508 . 1 1 10 C C1'  C -28.995   2.312 40.701 . . . 1.0 . . . . . . . . . . . . A . 10 C C1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4509 . 1 1 10 C C2   C -29.856   3.127 38.553 . . . 1.0 . . . . . . . . . . . . A . 10 C C2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4510 . 1 1 10 C C2'  C -30.263   1.673 41.259 . . . 1.0 . . . . . . . . . . . . A . 10 C C2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4511 . 1 1 10 C C3'  C -29.800   0.258 41.558 . . . 1.0 . . . . . . . . . . . . A . 10 C C3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4512 . 1 1 10 C C4   C -29.071   2.270 36.513 . . . 1.0 . . . . . . . . . . . . A . 10 C C4   . . . . . . . . . rr_2l5z 1 
       .  6 .  4513 . 1 1 10 C C4'  C -28.367   0.478 42.026 . . . 1.0 . . . . . . . . . . . . A . 10 C C4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4514 . 1 1 10 C C5   C -28.183   1.377 37.194 . . . 1.0 . . . . . . . . . . . . A . 10 C C5   . . . . . . . . . rr_2l5z 1 
       .  6 .  4515 . 1 1 10 C C5'  C -27.499  -0.767 41.828 . . . 1.0 . . . . . . . . . . . . A . 10 C C5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4516 . 1 1 10 C C6   C -28.176   1.406 38.543 . . . 1.0 . . . . . . . . . . . . A . 10 C C6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4517 . 1 1 10 C H1'  H -28.929   3.352 41.028 . . . 1.0 . . . . . . . . . . . . A . 10 C H1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4518 . 1 1 10 C H2'  H -31.044   1.659 40.494 . . . 1.0 . . . . . . . . . . . . A . 10 C H2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4519 . 1 1 10 C H3'  H -29.857  -0.383 40.675 . . . 1.0 . . . . . . . . . . . . A . 10 C H3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4520 . 1 1 10 C H4'  H -28.366   0.759 43.077 . . . 1.0 . . . . . . . . . . . . A . 10 C H4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4521 . 1 1 10 C H41  H -29.727   2.911 34.696 . . . 1.0 . . . . . . . . . . . . A . 10 C H41  . . . . . . . . . rr_2l5z 1 
       .  6 .  4522 . 1 1 10 C H42  H -28.502   1.663 34.655 . . . 1.0 . . . . . . . . . . . . A . 10 C H42  . . . . . . . . . rr_2l5z 1 
       .  6 .  4523 . 1 1 10 C H5   H -27.546   0.699 36.646 . . . 1.0 . . . . . . . . . . . . A . 10 C H5   . . . . . . . . . rr_2l5z 1 
       .  6 .  4524 . 1 1 10 C H5'  H -26.520  -0.591 42.273 . . . 1.0 . . . . . . . . . . . . A . 10 C H5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4525 . 1 1 10 C H5'' H -27.971  -1.611 42.331 . . . 1.0 . . . . . . . . . . . . A . 10 C H5'' . . . . . . . . . rr_2l5z 1 
       .  6 .  4526 . 1 1 10 C H6   H -27.518   0.745 39.090 . . . 1.0 . . . . . . . . . . . . A . 10 C H6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4527 . 1 1 10 C HO2' H -30.143   2.060 43.163 . . . 1.0 . . . . . . . . . . . . A . 10 C HO2' . . . . . . . . . rr_2l5z 1 
       .  6 .  4528 . 1 1 10 C N1   N -28.994   2.265 39.222 . . . 1.0 . . . . . . . . . . . . A . 10 C N1   . . . . . . . . . rr_2l5z 1 
       .  6 .  4529 . 1 1 10 C N3   N -29.867   3.102 37.193 . . . 1.0 . . . . . . . . . . . . A . 10 C N3   . . . . . . . . . rr_2l5z 1 
       .  6 .  4530 . 1 1 10 C N4   N -29.103   2.283 35.180 . . . 1.0 . . . . . . . . . . . . A . 10 C N4   . . . . . . . . . rr_2l5z 1 
       .  6 .  4531 . 1 1 10 C O2   O -30.584   3.891 39.187 . . . 1.0 . . . . . . . . . . . . A . 10 C O2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4532 . 1 1 10 C O2'  O -30.712   2.340 42.443 . . . 1.0 . . . . . . . . . . . . A . 10 C O2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4533 . 1 1 10 C O3'  O -30.570  -0.250 42.652 . . . 1.0 . . . . . . . . . . . . A . 10 C O3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4534 . 1 1 10 C O4'  O -27.885   1.576 41.247 . . . 1.0 . . . . . . . . . . . . A . 10 C O4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4535 . 1 1 10 C O5'  O -27.331  -1.084 40.444 . . . 1.0 . . . . . . . . . . . . A . 10 C O5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4536 . 1 1 10 C OP1  O -26.294  -3.338 40.793 . . . 1.0 . . . . . . . . . . . . A . 10 C OP1  . . . . . . . . . rr_2l5z 1 
       .  6 .  4537 . 1 1 10 C OP2  O -26.220  -2.204 38.497 . . . 1.0 . . . . . . . . . . . . A . 10 C OP2  . . . . . . . . . rr_2l5z 1 
       .  6 .  4538 . 1 1 10 C P    P -26.181  -2.111 39.974 . . . 1.0 . . . . . . . . . . . . A . 10 C P    . . . . . . . . . rr_2l5z 1 
       .  6 .  4539 . 1 1 11 A C1'  C -35.261   2.408 40.091 . . . 1.0 . . . . . . . . . . . . A . 11 A C1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4540 . 1 1 11 A C2   C -35.071   3.989 35.954 . . . 1.0 . . . . . . . . . . . . A . 11 A C2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4541 . 1 1 11 A C2'  C -36.371   1.382 40.312 . . . 1.0 . . . . . . . . . . . . A . 11 A C2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4542 . 1 1 11 A C3'  C -35.744   0.430 41.314 . . . 1.0 . . . . . . . . . . . . A . 11 A C3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4543 . 1 1 11 A C4   C -34.518   2.659 37.631 . . . 1.0 . . . . . . . . . . . . A . 11 A C4   . . . . . . . . . rr_2l5z 1 
       .  6 .  4544 . 1 1 11 A C4'  C -34.891   1.364 42.163 . . . 1.0 . . . . . . . . . . . . A . 11 A C4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4545 . 1 1 11 A C5   C -33.599   1.964 36.877 . . . 1.0 . . . . . . . . . . . . A . 11 A C5   . . . . . . . . . rr_2l5z 1 
       .  6 .  4546 . 1 1 11 A C5'  C -33.726   0.629 42.829 . . . 1.0 . . . . . . . . . . . . A . 11 A C5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4547 . 1 1 11 A C6   C -33.451   2.367 35.546 . . . 1.0 . . . . . . . . . . . . A . 11 A C6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4548 . 1 1 11 A C8   C -33.561   1.110 38.786 . . . 1.0 . . . . . . . . . . . . A . 11 A C8   . . . . . . . . . rr_2l5z 1 
       .  6 .  4549 . 1 1 11 A H1'  H -35.701   3.400 39.986 . . . 1.0 . . . . . . . . . . . . A . 11 A H1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4550 . 1 1 11 A H2   H -35.642   4.824 35.547 . . . 1.0 . . . . . . . . . . . . A . 11 A H2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4551 . 1 1 11 A H2'  H -36.587   0.857 39.378 . . . 1.0 . . . . . . . . . . . . A . 11 A H2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4552 . 1 1 11 A H3'  H -35.154  -0.345 40.820 . . . 1.0 . . . . . . . . . . . . A . 11 A H3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4553 . 1 1 11 A H4'  H -35.512   1.827 42.928 . . . 1.0 . . . . . . . . . . . . A . 11 A H4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4554 . 1 1 11 A H5'  H -33.075   1.359 43.311 . . . 1.0 . . . . . . . . . . . . A . 11 A H5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4555 . 1 1 11 A H5'' H -34.121  -0.049 43.585 . . . 1.0 . . . . . . . . . . . . A . 11 A H5'' . . . . . . . . . rr_2l5z 1 
       .  6 .  4556 . 1 1 11 A H61  H -32.529   2.115 33.751 . . . 1.0 . . . . . . . . . . . . A . 11 A H61  . . . . . . . . . rr_2l5z 1 
       .  6 .  4557 . 1 1 11 A H62  H -32.023   1.018 35.017 . . . 1.0 . . . . . . . . . . . . A . 11 A H62  . . . . . . . . . rr_2l5z 1 
       .  6 .  4558 . 1 1 11 A H8   H -33.308   0.490 39.633 . . . 1.0 . . . . . . . . . . . . A . 11 A H8   . . . . . . . . . rr_2l5z 1 
       .  6 .  4559 . 1 1 11 A HO2' H -38.031   1.319 41.327 . . . 1.0 . . . . . . . . . . . . A . 11 A HO2' . . . . . . . . . rr_2l5z 1 
       .  6 .  4560 . 1 1 11 A N1   N -34.213   3.393 35.119 . . . 1.0 . . . . . . . . . . . . A . 11 A N1   . . . . . . . . . rr_2l5z 1 
       .  6 .  4561 . 1 1 11 A N3   N -35.293   3.687 37.231 . . . 1.0 . . . . . . . . . . . . A . 11 A N3   . . . . . . . . . rr_2l5z 1 
       .  6 .  4562 . 1 1 11 A N6   N -32.599   1.786 34.703 . . . 1.0 . . . . . . . . . . . . A . 11 A N6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4563 . 1 1 11 A N7   N -32.984   0.958 37.641 . . . 1.0 . . . . . . . . . . . . A . 11 A N7   . . . . . . . . . rr_2l5z 1 
       .  6 .  4564 . 1 1 11 A N9   N -34.482   2.086 38.879 . . . 1.0 . . . . . . . . . . . . A . 11 A N9   . . . . . . . . . rr_2l5z 1 
       .  6 .  4565 . 1 1 11 A O2'  O -37.553   1.995 40.840 . . . 1.0 . . . . . . . . . . . . A . 11 A O2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4566 . 1 1 11 A O3'  O -36.781  -0.118 42.134 . . . 1.0 . . . . . . . . . . . . A . 11 A O3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4567 . 1 1 11 A O4'  O -34.426   2.375 41.263 . . . 1.0 . . . . . . . . . . . . A . 11 A O4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4568 . 1 1 11 A O5'  O -32.963  -0.122 41.882 . . . 1.0 . . . . . . . . . . . . A . 11 A O5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4569 . 1 1 11 A OP1  O -32.302  -1.743 43.674 . . . 1.0 . . . . . . . . . . . . A . 11 A OP1  . . . . . . . . . rr_2l5z 1 
       .  6 .  4570 . 1 1 11 A OP2  O -31.542  -2.086 41.252 . . . 1.0 . . . . . . . . . . . . A . 11 A OP2  . . . . . . . . . rr_2l5z 1 
       .  6 .  4571 . 1 1 11 A P    P -31.856  -1.181 42.380 . . . 1.0 . . . . . . . . . . . . A . 11 A P    . . . . . . . . . rr_2l5z 1 
       .  6 .  4572 . 1 1 12 C C1'  C -39.081   0.130 37.026 . . . 1.0 . . . . . . . . . . . . A . 12 C C1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4573 . 1 1 12 C C2   C -37.716   0.027 34.963 . . . 1.0 . . . . . . . . . . . . A . 12 C C2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4574 . 1 1 12 C C2'  C -40.167  -0.934 36.811 . . . 1.0 . . . . . . . . . . . . A . 12 C C2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4575 . 1 1 12 C C3'  C -40.360  -1.534 38.200 . . . 1.0 . . . . . . . . . . . . A . 12 C C3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4576 . 1 1 12 C C4   C -35.553  -0.889 34.985 . . . 1.0 . . . . . . . . . . . . A . 12 C C4   . . . . . . . . . rr_2l5z 1 
       .  6 .  4577 . 1 1 12 C C4'  C -39.939  -0.403 39.122 . . . 1.0 . . . . . . . . . . . . A . 12 C C4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4578 . 1 1 12 C C5   C -35.656  -1.175 36.384 . . . 1.0 . . . . . . . . . . . . A . 12 C C5   . . . . . . . . . rr_2l5z 1 
       .  6 .  4579 . 1 1 12 C C5'  C -39.503  -0.902 40.504 . . . 1.0 . . . . . . . . . . . . A . 12 C C5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4580 . 1 1 12 C C6   C -36.802  -0.841 37.011 . . . 1.0 . . . . . . . . . . . . A . 12 C C6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4581 . 1 1 12 C H1'  H -39.438   1.097 36.660 . . . 1.0 . . . . . . . . . . . . A . 12 C H1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4582 . 1 1 12 C H2'  H -39.806  -1.700 36.118 . . . 1.0 . . . . . . . . . . . . A . 12 C H2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4583 . 1 1 12 C H3'  H -39.756  -2.431 38.349 . . . 1.0 . . . . . . . . . . . . A . 12 C H3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4584 . 1 1 12 C H4'  H -40.758   0.304 39.228 . . . 1.0 . . . . . . . . . . . . A . 12 C H4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4585 . 1 1 12 C H41  H -34.358  -0.999 33.342 . . . 1.0 . . . . . . . . . . . . A . 12 C H41  . . . . . . . . . rr_2l5z 1 
       .  6 .  4586 . 1 1 12 C H42  H -33.667  -1.634 34.819 . . . 1.0 . . . . . . . . . . . . A . 12 C H42  . . . . . . . . . rr_2l5z 1 
       .  6 .  4587 . 1 1 12 C H5   H -34.843  -1.644 36.917 . . . 1.0 . . . . . . . . . . . . A . 12 C H5   . . . . . . . . . rr_2l5z 1 
       .  6 .  4588 . 1 1 12 C H5'  H -39.553  -0.072 41.208 . . . 1.0 . . . . . . . . . . . . A . 12 C H5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4589 . 1 1 12 C H5'' H -40.179  -1.691 40.839 . . . 1.0 . . . . . . . . . . . . A . 12 C H5'' . . . . . . . . . rr_2l5z 1 
       .  6 .  4590 . 1 1 12 C H6   H -36.917  -1.060 38.063 . . . 1.0 . . . . . . . . . . . . A . 12 C H6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4591 . 1 1 12 C HO2' H -42.087  -0.624 36.913 . . . 1.0 . . . . . . . . . . . . A . 12 C HO2' . . . . . . . . . rr_2l5z 1 
       .  6 .  4592 . 1 1 12 C N1   N -37.824  -0.246 36.326 . . . 1.0 . . . . . . . . . . . . A . 12 C N1   . . . . . . . . . rr_2l5z 1 
       .  6 .  4593 . 1 1 12 C N3   N -36.562  -0.309 34.324 . . . 1.0 . . . . . . . . . . . . A . 12 C N3   . . . . . . . . . rr_2l5z 1 
       .  6 .  4594 . 1 1 12 C N4   N -34.436  -1.198 34.330 . . . 1.0 . . . . . . . . . . . . A . 12 C N4   . . . . . . . . . rr_2l5z 1 
       .  6 .  4595 . 1 1 12 C O2   O -38.648   0.564 34.366 . . . 1.0 . . . . . . . . . . . . A . 12 C O2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4596 . 1 1 12 C O2'  O -41.380  -0.347 36.325 . . . 1.0 . . . . . . . . . . . . A . 12 C O2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4597 . 1 1 12 C O3'  O -41.755  -1.781 38.399 . . . 1.0 . . . . . . . . . . . . A . 12 C O3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4598 . 1 1 12 C O4'  O -38.865   0.229 38.441 . . . 1.0 . . . . . . . . . . . . A . 12 C O4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4599 . 1 1 12 C O5'  O -38.166  -1.407 40.481 . . . 1.0 . . . . . . . . . . . . A . 12 C O5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4600 . 1 1 12 C OP1  O -38.306  -1.942 42.925 . . . 1.0 . . . . . . . . . . . . A . 12 C OP1  . . . . . . . . . rr_2l5z 1 
       .  6 .  4601 . 1 1 12 C OP2  O -36.193  -2.490 41.583 . . . 1.0 . . . . . . . . . . . . A . 12 C OP2  . . . . . . . . . rr_2l5z 1 
       .  6 .  4602 . 1 1 12 C P    P -37.345  -1.600 41.853 . . . 1.0 . . . . . . . . . . . . A . 12 C P    . . . . . . . . . rr_2l5z 1 
       .  6 .  4603 . 1 1 13 G C1'  C -39.459  -3.487 33.159 . . . 1.0 . . . . . . . . . . . . A . 13 G C1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4604 . 1 1 13 G C2   C -35.853  -3.252 30.599 . . . 1.0 . . . . . . . . . . . . A . 13 G C2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4605 . 1 1 13 G C2'  C -39.912  -4.859 32.650 . . . 1.0 . . . . . . . . . . . . A . 13 G C2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4606 . 1 1 13 G C3'  C -40.638  -5.453 33.848 . . . 1.0 . . . . . . . . . . . . A . 13 G C3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4607 . 1 1 13 G C4   C -36.962  -3.406 32.529 . . . 1.0 . . . . . . . . . . . . A . 13 G C4   . . . . . . . . . rr_2l5z 1 
       .  6 .  4608 . 1 1 13 G C4'  C -41.189  -4.220 34.550 . . . 1.0 . . . . . . . . . . . . A . 13 G C4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4609 . 1 1 13 G C5   C -35.813  -3.463 33.305 . . . 1.0 . . . . . . . . . . . . A . 13 G C5   . . . . . . . . . rr_2l5z 1 
       .  6 .  4610 . 1 1 13 G C5'  C -41.452  -4.475 36.036 . . . 1.0 . . . . . . . . . . . . A . 13 G C5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4611 . 1 1 13 G C6   C -34.541  -3.411 32.676 . . . 1.0 . . . . . . . . . . . . A . 13 G C6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4612 . 1 1 13 G C8   C -37.434  -3.572 34.627 . . . 1.0 . . . . . . . . . . . . A . 13 G C8   . . . . . . . . . rr_2l5z 1 
       .  6 .  4613 . 1 1 13 G H1   H -33.766  -3.258 30.762 . . . 1.0 . . . . . . . . . . . . A . 13 G H1   . . . . . . . . . rr_2l5z 1 
       .  6 .  4614 . 1 1 13 G H1'  H -39.701  -2.730 32.414 . . . 1.0 . . . . . . . . . . . . A . 13 G H1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4615 . 1 1 13 G H2'  H -39.041  -5.471 32.401 . . . 1.0 . . . . . . . . . . . . A . 13 G H2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4616 . 1 1 13 G H21  H -34.851  -3.110 28.833 . . . 1.0 . . . . . . . . . . . . A . 13 G H21  . . . . . . . . . rr_2l5z 1 
       .  6 .  4617 . 1 1 13 G H22  H -36.595  -3.106 28.710 . . . 1.0 . . . . . . . . . . . . A . 13 G H22  . . . . . . . . . rr_2l5z 1 
       .  6 .  4618 . 1 1 13 G H3'  H -39.965  -6.028 34.487 . . . 1.0 . . . . . . . . . . . . A . 13 G H3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4619 . 1 1 13 G H4'  H -42.112  -3.906 34.065 . . . 1.0 . . . . . . . . . . . . A . 13 G H4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4620 . 1 1 13 G H5'  H -41.952  -5.436 36.153 . . . 1.0 . . . . . . . . . . . . A . 13 G H5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4621 . 1 1 13 G H5'' H -40.501  -4.499 36.568 . . . 1.0 . . . . . . . . . . . . A . 13 G H5'' . . . . . . . . . rr_2l5z 1 
       .  6 .  4622 . 1 1 13 G H8   H -38.026  -3.644 35.527 . . . 1.0 . . . . . . . . . . . . A . 13 G H8   . . . . . . . . . rr_2l5z 1 
       .  6 .  4623 . 1 1 13 G HO2' H -41.034  -3.810 31.453 . . . 1.0 . . . . . . . . . . . . A . 13 G HO2' . . . . . . . . . rr_2l5z 1 
       .  6 .  4624 . 1 1 13 G N1   N -34.659  -3.302 31.294 . . . 1.0 . . . . . . . . . . . . A . 13 G N1   . . . . . . . . . rr_2l5z 1 
       .  6 .  4625 . 1 1 13 G N2   N -35.759  -3.148 29.274 . . . 1.0 . . . . . . . . . . . . A . 13 G N2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4626 . 1 1 13 G N3   N -37.055  -3.301 31.184 . . . 1.0 . . . . . . . . . . . . A . 13 G N3   . . . . . . . . . rr_2l5z 1 
       .  6 .  4627 . 1 1 13 G N7   N -36.142  -3.571 34.668 . . . 1.0 . . . . . . . . . . . . A . 13 G N7   . . . . . . . . . rr_2l5z 1 
       .  6 .  4628 . 1 1 13 G N9   N -38.007  -3.480 33.414 . . . 1.0 . . . . . . . . . . . . A . 13 G N9   . . . . . . . . . rr_2l5z 1 
       .  6 .  4629 . 1 1 13 G O2'  O -40.786  -4.735 31.522 . . . 1.0 . . . . . . . . . . . . A . 13 G O2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4630 . 1 1 13 G O3'  O -41.737  -6.234 33.371 . . . 1.0 . . . . . . . . . . . . A . 13 G O3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4631 . 1 1 13 G O4'  O -40.196  -3.215 34.363 . . . 1.0 . . . . . . . . . . . . A . 13 G O4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4632 . 1 1 13 G O5'  O -42.276  -3.452 36.602 . . . 1.0 . . . . . . . . . . . . A . 13 G O5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4633 . 1 1 13 G O6   O -33.429  -3.447 33.199 . . . 1.0 . . . . . . . . . . . . A . 13 G O6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4634 . 1 1 13 G OP1  O -43.786  -3.233 38.588 . . . 1.0 . . . . . . . . . . . . A . 13 G OP1  . . . . . . . . . rr_2l5z 1 
       .  6 .  4635 . 1 1 13 G OP2  O -41.437  -4.227 38.830 . . . 1.0 . . . . . . . . . . . . A . 13 G OP2  . . . . . . . . . rr_2l5z 1 
       .  6 .  4636 . 1 1 13 G P    P -42.359  -3.258 38.197 . . . 1.0 . . . . . . . . . . . . A . 13 G P    . . . . . . . . . rr_2l5z 1 
       .  6 .  4637 . 1 1 14 A C1'  C -41.870  -9.109 28.256 . . . 1.0 . . . . . . . . . . . . A . 14 A C1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4638 . 1 1 14 A C2   C -43.471  -6.237 25.297 . . . 1.0 . . . . . . . . . . . . A . 14 A C2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4639 . 1 1 14 A C2'  C -40.453  -8.606 27.983 . . . 1.0 . . . . . . . . . . . . A . 14 A C2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4640 . 1 1 14 A C3'  C -39.858  -8.521 29.377 . . . 1.0 . . . . . . . . . . . . A . 14 A C3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4641 . 1 1 14 A C4   C -43.250  -7.156 27.294 . . . 1.0 . . . . . . . . . . . . A . 14 A C4   . . . . . . . . . rr_2l5z 1 
       .  6 .  4642 . 1 1 14 A C4'  C -40.535  -9.680 30.106 . . . 1.0 . . . . . . . . . . . . A . 14 A C4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4643 . 1 1 14 A C5   C -44.144  -6.287 27.877 . . . 1.0 . . . . . . . . . . . . A . 14 A C5   . . . . . . . . . rr_2l5z 1 
       .  6 .  4644 . 1 1 14 A C5'  C -40.628  -9.437 31.613 . . . 1.0 . . . . . . . . . . . . A . 14 A C5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4645 . 1 1 14 A C6   C -44.719  -5.327 27.037 . . . 1.0 . . . . . . . . . . . . A . 14 A C6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4646 . 1 1 14 A C8   C -43.485  -7.568 29.396 . . . 1.0 . . . . . . . . . . . . A . 14 A C8   . . . . . . . . . rr_2l5z 1 
       .  6 .  4647 . 1 1 14 A H1'  H -42.163  -9.806 27.470 . . . 1.0 . . . . . . . . . . . . A . 14 A H1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4648 . 1 1 14 A H2   H -43.218  -6.184 24.238 . . . 1.0 . . . . . . . . . . . . A . 14 A H2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4649 . 1 1 14 A H2'  H -40.489  -7.612 27.530 . . . 1.0 . . . . . . . . . . . . A . 14 A H2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4650 . 1 1 14 A H3'  H -40.060  -7.552 29.841 . . . 1.0 . . . . . . . . . . . . A . 14 A H3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4651 . 1 1 14 A H4'  H -39.977 -10.597 29.922 . . . 1.0 . . . . . . . . . . . . A . 14 A H4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4652 . 1 1 14 A H5'  H -41.123 -10.288 32.082 . . . 1.0 . . . . . . . . . . . . A . 14 A H5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4653 . 1 1 14 A H5'' H -39.622  -9.342 32.022 . . . 1.0 . . . . . . . . . . . . A . 14 A H5'' . . . . . . . . . rr_2l5z 1 
       .  6 .  4654 . 1 1 14 A H61  H -45.986  -3.750 26.813 . . . 1.0 . . . . . . . . . . . . A . 14 A H61  . . . . . . . . . rr_2l5z 1 
       .  6 .  4655 . 1 1 14 A H62  H -45.882  -4.407 28.431 . . . 1.0 . . . . . . . . . . . . A . 14 A H62  . . . . . . . . . rr_2l5z 1 
       .  6 .  4656 . 1 1 14 A H8   H -43.351  -8.048 30.355 . . . 1.0 . . . . . . . . . . . . A . 14 A H8   . . . . . . . . . rr_2l5z 1 
       .  6 .  4657 . 1 1 14 A HO2' H -39.473 -10.266 27.707 . . . 1.0 . . . . . . . . . . . . A . 14 A HO2' . . . . . . . . . rr_2l5z 1 
       .  6 .  4658 . 1 1 14 A N1   N -44.352  -5.338 25.743 . . . 1.0 . . . . . . . . . . . . A . 14 A N1   . . . . . . . . . rr_2l5z 1 
       .  6 .  4659 . 1 1 14 A N3   N -42.865  -7.188 26.003 . . . 1.0 . . . . . . . . . . . . A . 14 A N3   . . . . . . . . . rr_2l5z 1 
       .  6 .  4660 . 1 1 14 A N6   N -45.600  -4.422 27.462 . . . 1.0 . . . . . . . . . . . . A . 14 A N6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4661 . 1 1 14 A N7   N -44.288  -6.566 29.247 . . . 1.0 . . . . . . . . . . . . A . 14 A N7   . . . . . . . . . rr_2l5z 1 
       .  6 .  4662 . 1 1 14 A N9   N -42.827  -7.988 28.299 . . . 1.0 . . . . . . . . . . . . A . 14 A N9   . . . . . . . . . rr_2l5z 1 
       .  6 .  4663 . 1 1 14 A O2'  O -39.723  -9.519 27.157 . . . 1.0 . . . . . . . . . . . . A . 14 A O2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4664 . 1 1 14 A O3'  O -38.457  -8.799 29.287 . . . 1.0 . . . . . . . . . . . . A . 14 A O3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4665 . 1 1 14 A O4'  O -41.833  -9.799 29.518 . . . 1.0 . . . . . . . . . . . . A . 14 A O4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4666 . 1 1 14 A O5'  O -41.366  -8.247 31.911 . . . 1.0 . . . . . . . . . . . . A . 14 A O5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4667 . 1 1 14 A OP1  O -43.038  -8.337 33.774 . . . 1.0 . . . . . . . . . . . . A . 14 A OP1  . . . . . . . . . rr_2l5z 1 
       .  6 .  4668 . 1 1 14 A OP2  O -40.526  -8.234 34.271 . . . 1.0 . . . . . . . . . . . . A . 14 A OP2  . . . . . . . . . rr_2l5z 1 
       .  6 .  4669 . 1 1 14 A P    P -41.684  -7.843 33.437 . . . 1.0 . . . . . . . . . . . . A . 14 A P    . . . . . . . . . rr_2l5z 1 
       .  6 .  4670 . 1 1 15 A C1'  C -40.237  -5.157 25.894 . . . 1.0 . . . . . . . . . . . . A . 15 A C1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4671 . 1 1 15 A C2   C -42.820  -1.569 26.034 . . . 1.0 . . . . . . . . . . . . A . 15 A C2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4672 . 1 1 15 A C2'  C -39.100  -4.330 25.284 . . . 1.0 . . . . . . . . . . . . A . 15 A C2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4673 . 1 1 15 A C3'  C -37.840  -5.054 25.748 . . . 1.0 . . . . . . . . . . . . A . 15 A C3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4674 . 1 1 15 A C4   C -41.715  -3.287 26.875 . . . 1.0 . . . . . . . . . . . . A . 15 A C4   . . . . . . . . . rr_2l5z 1 
       .  6 .  4675 . 1 1 15 A C4'  C -38.319  -6.486 25.945 . . . 1.0 . . . . . . . . . . . . A . 15 A C4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4676 . 1 1 15 A C5   C -42.112  -3.010 28.164 . . . 1.0 . . . . . . . . . . . . A . 15 A C5   . . . . . . . . . rr_2l5z 1 
       .  6 .  4677 . 1 1 15 A C5'  C -37.446  -7.252 26.941 . . . 1.0 . . . . . . . . . . . . A . 15 A C5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4678 . 1 1 15 A C6   C -42.940  -1.895 28.334 . . . 1.0 . . . . . . . . . . . . A . 15 A C6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4679 . 1 1 15 A C8   C -40.899  -4.711 28.270 . . . 1.0 . . . . . . . . . . . . A . 15 A C8   . . . . . . . . . rr_2l5z 1 
       .  6 .  4680 . 1 1 15 A H1'  H -40.955  -5.408 25.114 . . . 1.0 . . . . . . . . . . . . A . 15 A H1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4681 . 1 1 15 A H2   H -43.112  -0.943 25.191 . . . 1.0 . . . . . . . . . . . . A . 15 A H2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4682 . 1 1 15 A H2'  H -39.121  -3.314 25.688 . . . 1.0 . . . . . . . . . . . . A . 15 A H2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4683 . 1 1 15 A H3'  H -37.432  -4.617 26.664 . . . 1.0 . . . . . . . . . . . . A . 15 A H3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4684 . 1 1 15 A H4'  H -38.319  -7.005 24.988 . . . 1.0 . . . . . . . . . . . . A . 15 A H4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4685 . 1 1 15 A H5'  H -37.770  -8.293 26.970 . . . 1.0 . . . . . . . . . . . . A . 15 A H5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4686 . 1 1 15 A H5'' H -36.409  -7.212 26.610 . . . 1.0 . . . . . . . . . . . . A . 15 A H5'' . . . . . . . . . rr_2l5z 1 
       .  6 .  4687 . 1 1 15 A H61  H -43.999  -0.694 29.590 . . . 1.0 . . . . . . . . . . . . A . 15 A H61  . . . . . . . . . rr_2l5z 1 
       .  6 .  4688 . 1 1 15 A H62  H -43.156  -2.022 30.354 . . . 1.0 . . . . . . . . . . . . A . 15 A H62  . . . . . . . . . rr_2l5z 1 
       .  6 .  4689 . 1 1 15 A H8   H -40.330  -5.550 28.644 . . . 1.0 . . . . . . . . . . . . A . 15 A H8   . . . . . . . . . rr_2l5z 1 
       .  6 .  4690 . 1 1 15 A HO2' H -39.298  -5.213 23.559 . . . 1.0 . . . . . . . . . . . . A . 15 A HO2' . . . . . . . . . rr_2l5z 1 
       .  6 .  4691 . 1 1 15 A N1   N -43.273  -1.197 27.233 . . . 1.0 . . . . . . . . . . . . A . 15 A N1   . . . . . . . . . rr_2l5z 1 
       .  6 .  4692 . 1 1 15 A N3   N -42.033  -2.605 25.757 . . . 1.0 . . . . . . . . . . . . A . 15 A N3   . . . . . . . . . rr_2l5z 1 
       .  6 .  4693 . 1 1 15 A N6   N -43.403  -1.505 29.522 . . . 1.0 . . . . . . . . . . . . A . 15 A N6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4694 . 1 1 15 A N7   N -41.574  -3.945 29.064 . . . 1.0 . . . . . . . . . . . . A . 15 A N7   . . . . . . . . . rr_2l5z 1 
       .  6 .  4695 . 1 1 15 A N9   N -40.924  -4.403 26.960 . . . 1.0 . . . . . . . . . . . . A . 15 A N9   . . . . . . . . . rr_2l5z 1 
       .  6 .  4696 . 1 1 15 A O2'  O -39.186  -4.306 23.855 . . . 1.0 . . . . . . . . . . . . A . 15 A O2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4697 . 1 1 15 A O3'  O -36.893  -5.040 24.675 . . . 1.0 . . . . . . . . . . . . A . 15 A O3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4698 . 1 1 15 A O4'  O -39.658  -6.365 26.411 . . . 1.0 . . . . . . . . . . . . A . 15 A O4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4699 . 1 1 15 A O5'  O -37.539  -6.698 28.256 . . . 1.0 . . . . . . . . . . . . A . 15 A O5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4700 . 1 1 15 A OP1  O -36.025  -8.244 29.518 . . . 1.0 . . . . . . . . . . . . A . 15 A OP1  . . . . . . . . . rr_2l5z 1 
       .  6 .  4701 . 1 1 15 A OP2  O -37.805  -6.866 30.742 . . . 1.0 . . . . . . . . . . . . A . 15 A OP2  . . . . . . . . . rr_2l5z 1 
       .  6 .  4702 . 1 1 15 A P    P -37.375  -7.636 29.554 . . . 1.0 . . . . . . . . . . . . A . 15 A P    . . . . . . . . . rr_2l5z 1 
       .  6 .  4703 . 1 1 16 A C1'  C -39.421  -0.705 25.050 . . . 1.0 . . . . . . . . . . . . A . 16 A C1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4704 . 1 1 16 A C2   C -40.775   0.236 29.154 . . . 1.0 . . . . . . . . . . . . A . 16 A C2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4705 . 1 1 16 A C2'  C -38.885   0.531 24.337 . . . 1.0 . . . . . . . . . . . . A . 16 A C2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4706 . 1 1 16 A C3'  C -37.722  -0.028 23.538 . . . 1.0 . . . . . . . . . . . . A . 16 A C3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4707 . 1 1 16 A C4   C -39.370  -0.506 27.619 . . . 1.0 . . . . . . . . . . . . A . 16 A C4   . . . . . . . . . rr_2l5z 1 
       .  6 .  4708 . 1 1 16 A C4'  C -38.187  -1.446 23.190 . . . 1.0 . . . . . . . . . . . . A . 16 A C4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4709 . 1 1 16 A C5   C -38.417  -0.855 28.549 . . . 1.0 . . . . . . . . . . . . A . 16 A C5   . . . . . . . . . rr_2l5z 1 
       .  6 .  4710 . 1 1 16 A C5'  C -37.018  -2.431 23.070 . . . 1.0 . . . . . . . . . . . . A . 16 A C5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4711 . 1 1 16 A C6   C -38.734  -0.610 29.889 . . . 1.0 . . . . . . . . . . . . A . 16 A C6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4712 . 1 1 16 A C8   C -37.628  -1.352 26.676 . . . 1.0 . . . . . . . . . . . . A . 16 A C8   . . . . . . . . . rr_2l5z 1 
       .  6 .  4713 . 1 1 16 A H1'  H -40.504  -0.634 25.133 . . . 1.0 . . . . . . . . . . . . A . 16 A H1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4714 . 1 1 16 A H2   H -41.728   0.679 29.439 . . . 1.0 . . . . . . . . . . . . A . 16 A H2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4715 . 1 1 16 A H2'  H -38.525   1.259 25.069 . . . 1.0 . . . . . . . . . . . . A . 16 A H2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4716 . 1 1 16 A H3'  H -36.792  -0.010 24.116 . . . 1.0 . . . . . . . . . . . . A . 16 A H3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4717 . 1 1 16 A H4'  H -38.733  -1.423 22.249 . . . 1.0 . . . . . . . . . . . . A . 16 A H4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4718 . 1 1 16 A H5'  H -37.397  -3.393 22.728 . . . 1.0 . . . . . . . . . . . . A . 16 A H5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4719 . 1 1 16 A H5'' H -36.304  -2.048 22.339 . . . 1.0 . . . . . . . . . . . . A . 16 A H5'' . . . . . . . . . rr_2l5z 1 
       .  6 .  4720 . 1 1 16 A H61  H -38.192  -0.701 31.849 . . . 1.0 . . . . . . . . . . . . A . 16 A H61  . . . . . . . . . rr_2l5z 1 
       .  6 .  4721 . 1 1 16 A H62  H -37.014  -1.319 30.712 . . . 1.0 . . . . . . . . . . . . A . 16 A H62  . . . . . . . . . rr_2l5z 1 
       .  6 .  4722 . 1 1 16 A H8   H -36.973  -1.708 25.893 . . . 1.0 . . . . . . . . . . . . A . 16 A H8   . . . . . . . . . rr_2l5z 1 
       .  6 .  4723 . 1 1 16 A HO2' H -39.865   2.061 23.637 . . . 1.0 . . . . . . . . . . . . A . 16 A HO2' . . . . . . . . . rr_2l5z 1 
       .  6 .  4724 . 1 1 16 A N1   N -39.934  -0.058 30.149 . . . 1.0 . . . . . . . . . . . . A . 16 A N1   . . . . . . . . . rr_2l5z 1 
       .  6 .  4725 . 1 1 16 A N3   N -40.576   0.047 27.852 . . . 1.0 . . . . . . . . . . . . A . 16 A N3   . . . . . . . . . rr_2l5z 1 
       .  6 .  4726 . 1 1 16 A N6   N -37.914  -0.899 30.898 . . . 1.0 . . . . . . . . . . . . A . 16 A N6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4727 . 1 1 16 A N7   N -37.286  -1.405 27.922 . . . 1.0 . . . . . . . . . . . . A . 16 A N7   . . . . . . . . . rr_2l5z 1 
       .  6 .  4728 . 1 1 16 A N9   N -38.839  -0.837 26.399 . . . 1.0 . . . . . . . . . . . . A . 16 A N9   . . . . . . . . . rr_2l5z 1 
       .  6 .  4729 . 1 1 16 A O2'  O -39.877   1.113 23.483 . . . 1.0 . . . . . . . . . . . . A . 16 A O2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4730 . 1 1 16 A O3'  O -37.616   0.719 22.322 . . . 1.0 . . . . . . . . . . . . A . 16 A O3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4731 . 1 1 16 A O4'  O -39.081  -1.837 24.235 . . . 1.0 . . . . . . . . . . . . A . 16 A O4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4732 . 1 1 16 A O5'  O -36.352  -2.608 24.324 . . . 1.0 . . . . . . . . . . . . A . 16 A O5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4733 . 1 1 16 A OP1  O -34.737  -4.375 23.586 . . . 1.0 . . . . . . . . . . . . A . 16 A OP1  . . . . . . . . . rr_2l5z 1 
       .  6 .  4734 . 1 1 16 A OP2  O -35.140  -3.926 26.076 . . . 1.0 . . . . . . . . . . . . A . 16 A OP2  . . . . . . . . . rr_2l5z 1 
       .  6 .  4735 . 1 1 16 A P    P -35.653  -4.012 24.690 . . . 1.0 . . . . . . . . . . . . A . 16 A P    . . . . . . . . . rr_2l5z 1 
       .  6 .  4736 . 1 1 17 G C1'  C -36.912   2.642 26.814 . . . 1.0 . . . . . . . . . . . . A . 17 G C1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4737 . 1 1 17 G C2   C -37.587   1.837 31.110 . . . 1.0 . . . . . . . . . . . . A . 17 G C2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4738 . 1 1 17 G C2'  C -36.583   4.125 26.664 . . . 1.0 . . . . . . . . . . . . A . 17 G C2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4739 . 1 1 17 G C3'  C -35.514   4.097 25.590 . . . 1.0 . . . . . . . . . . . . A . 17 G C3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4740 . 1 1 17 G C4   C -36.424   1.831 29.208 . . . 1.0 . . . . . . . . . . . . A . 17 G C4   . . . . . . . . . rr_2l5z 1 
       .  6 .  4741 . 1 1 17 G C4'  C -36.012   2.987 24.677 . . . 1.0 . . . . . . . . . . . . A . 17 G C4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4742 . 1 1 17 G C5   C -35.311   1.219 29.768 . . . 1.0 . . . . . . . . . . . . A . 17 G C5   . . . . . . . . . rr_2l5z 1 
       .  6 .  4743 . 1 1 17 G C5'  C -34.877   2.368 23.861 . . . 1.0 . . . . . . . . . . . . A . 17 G C5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4744 . 1 1 17 G C6   C -35.323   0.873 31.146 . . . 1.0 . . . . . . . . . . . . A . 17 G C6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4745 . 1 1 17 G C8   C -34.863   1.544 27.749 . . . 1.0 . . . . . . . . . . . . A . 17 G C8   . . . . . . . . . rr_2l5z 1 
       .  6 .  4746 . 1 1 17 G H1   H -36.609   1.002 32.757 . . . 1.0 . . . . . . . . . . . . A . 17 G H1   . . . . . . . . . rr_2l5z 1 
       .  6 .  4747 . 1 1 17 G H1'  H -37.971   2.521 27.042 . . . 1.0 . . . . . . . . . . . . A . 17 G H1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4748 . 1 1 17 G H2'  H -36.172   4.515 27.597 . . . 1.0 . . . . . . . . . . . . A . 17 G H2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4749 . 1 1 17 G H21  H -38.658   1.847 32.841 . . . 1.0 . . . . . . . . . . . . A . 17 G H21  . . . . . . . . . rr_2l5z 1 
       .  6 .  4750 . 1 1 17 G H22  H -39.467   2.540 31.453 . . . 1.0 . . . . . . . . . . . . A . 17 G H22  . . . . . . . . . rr_2l5z 1 
       .  6 .  4751 . 1 1 17 G H3'  H -34.526   3.886 26.006 . . . 1.0 . . . . . . . . . . . . A . 17 G H3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4752 . 1 1 17 G H4'  H -36.768   3.388 24.006 . . . 1.0 . . . . . . . . . . . . A . 17 G H4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4753 . 1 1 17 G H5'  H -34.523   3.097 23.133 . . . 1.0 . . . . . . . . . . . . A . 17 G H5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4754 . 1 1 17 G H5'' H -34.059   2.110 24.532 . . . 1.0 . . . . . . . . . . . . A . 17 G H5'' . . . . . . . . . rr_2l5z 1 
       .  6 .  4755 . 1 1 17 G H8   H -34.352   1.570 26.799 . . . 1.0 . . . . . . . . . . . . A . 17 G H8   . . . . . . . . . rr_2l5z 1 
       .  6 .  4756 . 1 1 17 G HO2' H -37.572   5.162 25.346 . . . 1.0 . . . . . . . . . . . . A . 17 G HO2' . . . . . . . . . rr_2l5z 1 
       .  6 .  4757 . 1 1 17 G N1   N -36.524   1.227 31.747 . . . 1.0 . . . . . . . . . . . . A . 17 G N1   . . . . . . . . . rr_2l5z 1 
       .  6 .  4758 . 1 1 17 G N2   N -38.658   2.096 31.862 . . . 1.0 . . . . . . . . . . . . A . 17 G N2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4759 . 1 1 17 G N3   N -37.585   2.166 29.815 . . . 1.0 . . . . . . . . . . . . A . 17 G N3   . . . . . . . . . rr_2l5z 1 
       .  6 .  4760 . 1 1 17 G N7   N -34.307   1.041 28.802 . . . 1.0 . . . . . . . . . . . . A . 17 G N7   . . . . . . . . . rr_2l5z 1 
       .  6 .  4761 . 1 1 17 G N9   N -36.108   2.033 27.890 . . . 1.0 . . . . . . . . . . . . A . 17 G N9   . . . . . . . . . rr_2l5z 1 
       .  6 .  4762 . 1 1 17 G O2'  O -37.728   4.879 26.250 . . . 1.0 . . . . . . . . . . . . A . 17 G O2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4763 . 1 1 17 G O3'  O -35.550   5.331 24.866 . . . 1.0 . . . . . . . . . . . . A . 17 G O3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4764 . 1 1 17 G O4'  O -36.620   2.028 25.546 . . . 1.0 . . . . . . . . . . . . A . 17 G O4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4765 . 1 1 17 G O5'  O -35.303   1.189 23.175 . . . 1.0 . . . . . . . . . . . . A . 17 G O5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4766 . 1 1 17 G O6   O -34.438   0.332 31.804 . . . 1.0 . . . . . . . . . . . . A . 17 G O6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4767 . 1 1 17 G OP1  O -36.367   2.734 21.515 . . . 1.0 . . . . . . . . . . . . A . 17 G OP1  . . . . . . . . . rr_2l5z 1 
       .  6 .  4768 . 1 1 17 G OP2  O -35.635   0.376 20.829 . . . 1.0 . . . . . . . . . . . . A . 17 G OP2  . . . . . . . . . rr_2l5z 1 
       .  6 .  4769 . 1 1 17 G P    P -36.195   1.300 21.840 . . . 1.0 . . . . . . . . . . . . A . 17 G P    . . . . . . . . . rr_2l5z 1 
       .  6 .  4770 . 1 1 18 U C1'  C -35.918   6.976 30.147 . . . 1.0 . . . . . . . . . . . . A . 18 U C1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4771 . 1 1 18 U C2   C -35.211   5.455 31.971 . . . 1.0 . . . . . . . . . . . . A . 18 U C2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4772 . 1 1 18 U C2'  C -35.148   8.283 30.394 . . . 1.0 . . . . . . . . . . . . A . 18 U C2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4773 . 1 1 18 U C3'  C -34.798   8.760 28.988 . . . 1.0 . . . . . . . . . . . . A . 18 U C3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4774 . 1 1 18 U C4   C -33.652   3.590 31.537 . . . 1.0 . . . . . . . . . . . . A . 18 U C4   . . . . . . . . . rr_2l5z 1 
       .  6 .  4775 . 1 1 18 U C4'  C -35.913   8.166 28.149 . . . 1.0 . . . . . . . . . . . . A . 18 U C4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4776 . 1 1 18 U C5   C -33.633   4.024 30.158 . . . 1.0 . . . . . . . . . . . . A . 18 U C5   . . . . . . . . . rr_2l5z 1 
       .  6 .  4777 . 1 1 18 U C5'  C -35.523   8.042 26.680 . . . 1.0 . . . . . . . . . . . . A . 18 U C5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4778 . 1 1 18 U C6   C -34.357   5.094 29.753 . . . 1.0 . . . . . . . . . . . . A . 18 U C6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4779 . 1 1 18 U H1'  H -36.884   7.023 30.654 . . . 1.0 . . . . . . . . . . . . A . 18 U H1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4780 . 1 1 18 U H2'  H -34.235   8.075 30.957 . . . 1.0 . . . . . . . . . . . . A . 18 U H2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4781 . 1 1 18 U H3   H -34.516   4.080 33.359 . . . 1.0 . . . . . . . . . . . . A . 18 U H3   . . . . . . . . . rr_2l5z 1 
       .  6 .  4782 . 1 1 18 U H3'  H -33.812   8.413 28.672 . . . 1.0 . . . . . . . . . . . . A . 18 U H3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4783 . 1 1 18 U H4'  H -36.809   8.776 28.242 . . . 1.0 . . . . . . . . . . . . A . 18 U H4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4784 . 1 1 18 U H5   H -33.041   3.480 29.437 . . . 1.0 . . . . . . . . . . . . A . 18 U H5   . . . . . . . . . rr_2l5z 1 
       .  6 .  4785 . 1 1 18 U H5'  H -36.416   7.843 26.089 . . . 1.0 . . . . . . . . . . . . A . 18 U H5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4786 . 1 1 18 U H5'' H -35.079   8.981 26.349 . . . 1.0 . . . . . . . . . . . . A . 18 U H5'' . . . . . . . . . rr_2l5z 1 
       .  6 .  4787 . 1 1 18 U H6   H -34.310   5.401 28.719 . . . 1.0 . . . . . . . . . . . . A . 18 U H6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4788 . 1 1 18 U HO2' H -35.525   9.439 31.914 . . . 1.0 . . . . . . . . . . . . A . 18 U HO2' . . . . . . . . . rr_2l5z 1 
       .  6 .  4789 . 1 1 18 U N1   N -35.135   5.803 30.625 . . . 1.0 . . . . . . . . . . . . A . 18 U N1   . . . . . . . . . rr_2l5z 1 
       .  6 .  4790 . 1 1 18 U N3   N -34.460   4.358 32.360 . . . 1.0 . . . . . . . . . . . . A . 18 U N3   . . . . . . . . . rr_2l5z 1 
       .  6 .  4791 . 1 1 18 U O2   O -35.902   6.082 32.770 . . . 1.0 . . . . . . . . . . . . A . 18 U O2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4792 . 1 1 18 U O2'  O -35.960   9.243 31.081 . . . 1.0 . . . . . . . . . . . . A . 18 U O2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4793 . 1 1 18 U O3'  O -34.909  10.185 28.948 . . . 1.0 . . . . . . . . . . . . A . 18 U O3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4794 . 1 1 18 U O4   O -33.029   2.634 31.988 . . . 1.0 . . . . . . . . . . . . A . 18 U O4   . . . . . . . . . rr_2l5z 1 
       .  6 .  4795 . 1 1 18 U O4'  O -36.151   6.893 28.732 . . . 1.0 . . . . . . . . . . . . A . 18 U O4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4796 . 1 1 18 U O5'  O -34.583   6.986 26.476 . . . 1.0 . . . . . . . . . . . . A . 18 U O5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4797 . 1 1 18 U OP1  O -34.561   7.472 24.020 . . . 1.0 . . . . . . . . . . . . A . 18 U OP1  . . . . . . . . . rr_2l5z 1 
       .  6 .  4798 . 1 1 18 U OP2  O -33.067   5.638 25.008 . . . 1.0 . . . . . . . . . . . . A . 18 U OP2  . . . . . . . . . rr_2l5z 1 
       .  6 .  4799 . 1 1 18 U P    P -34.343   6.387 25.003 . . . 1.0 . . . . . . . . . . . . A . 18 U P    . . . . . . . . . rr_2l5z 1 
       .  6 .  4800 . 1 1 19 G C1'  C -33.738   9.628 34.378 . . . 1.0 . . . . . . . . . . . . A . 19 G C1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4801 . 1 1 19 G C2   C -31.884   6.479 36.863 . . . 1.0 . . . . . . . . . . . . A . 19 G C2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4802 . 1 1 19 G C2'  C -33.063  10.926 34.839 . . . 1.0 . . . . . . . . . . . . A . 19 G C2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4803 . 1 1 19 G C3'  C -33.237  11.854 33.643 . . . 1.0 . . . . . . . . . . . . A . 19 G C3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4804 . 1 1 19 G C4   C -32.229   7.636 34.989 . . . 1.0 . . . . . . . . . . . . A . 19 G C4   . . . . . . . . . rr_2l5z 1 
       .  6 .  4805 . 1 1 19 G C4'  C -34.519  11.344 33.008 . . . 1.0 . . . . . . . . . . . . A . 19 G C4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4806 . 1 1 19 G C5   C -31.331   6.891 34.238 . . . 1.0 . . . . . . . . . . . . A . 19 G C5   . . . . . . . . . rr_2l5z 1 
       .  6 .  4807 . 1 1 19 G C5'  C -34.616  11.725 31.531 . . . 1.0 . . . . . . . . . . . . A . 19 G C5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4808 . 1 1 19 G C6   C -30.626   5.821 34.852 . . . 1.0 . . . . . . . . . . . . A . 19 G C6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4809 . 1 1 19 G C8   C -32.131   8.339 32.953 . . . 1.0 . . . . . . . . . . . . A . 19 G C8   . . . . . . . . . rr_2l5z 1 
       .  6 .  4810 . 1 1 19 G H1   H -30.498   4.924 36.709 . . . 1.0 . . . . . . . . . . . . A . 19 G H1   . . . . . . . . . rr_2l5z 1 
       .  6 .  4811 . 1 1 19 G H1'  H -34.431   9.289 35.149 . . . 1.0 . . . . . . . . . . . . A . 19 G H1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4812 . 1 1 19 G H2'  H -31.999  10.748 35.024 . . . 1.0 . . . . . . . . . . . . A . 19 G H2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4813 . 1 1 19 G H21  H -31.578   5.429 38.580 . . . 1.0 . . . . . . . . . . . . A . 19 G H21  . . . . . . . . . rr_2l5z 1 
       .  6 .  4814 . 1 1 19 G H22  H -32.739   6.733 38.693 . . . 1.0 . . . . . . . . . . . . A . 19 G H22  . . . . . . . . . rr_2l5z 1 
       .  6 .  4815 . 1 1 19 G H3'  H -32.385  11.802 32.962 . . . 1.0 . . . . . . . . . . . . A . 19 G H3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4816 . 1 1 19 G H4'  H -35.378  11.744 33.546 . . . 1.0 . . . . . . . . . . . . A . 19 G H4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4817 . 1 1 19 G H5'  H -35.549  11.335 31.124 . . . 1.0 . . . . . . . . . . . . A . 19 G H5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4818 . 1 1 19 G H5'' H -34.618  12.812 31.444 . . . 1.0 . . . . . . . . . . . . A . 19 G H5'' . . . . . . . . . rr_2l5z 1 
       .  6 .  4819 . 1 1 19 G H8   H -32.355   8.927 32.076 . . . 1.0 . . . . . . . . . . . . A . 19 G H8   . . . . . . . . . rr_2l5z 1 
       .  6 .  4820 . 1 1 19 G HO2' H -33.007  11.669 36.637 . . . 1.0 . . . . . . . . . . . . A . 19 G HO2' . . . . . . . . . rr_2l5z 1 
       .  6 .  4821 . 1 1 19 G N1   N -30.973   5.687 36.191 . . . 1.0 . . . . . . . . . . . . A . 19 G N1   . . . . . . . . . rr_2l5z 1 
       .  6 .  4822 . 1 1 19 G N2   N -32.083   6.190 38.149 . . . 1.0 . . . . . . . . . . . . A . 19 G N2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4823 . 1 1 19 G N3   N -32.551   7.487 36.293 . . . 1.0 . . . . . . . . . . . . A . 19 G N3   . . . . . . . . . rr_2l5z 1 
       .  6 .  4824 . 1 1 19 G N7   N -31.282   7.365 32.916 . . . 1.0 . . . . . . . . . . . . A . 19 G N7   . . . . . . . . . rr_2l5z 1 
       .  6 .  4825 . 1 1 19 G N9   N -32.737   8.574 34.130 . . . 1.0 . . . . . . . . . . . . A . 19 G N9   . . . . . . . . . rr_2l5z 1 
       .  6 .  4826 . 1 1 19 G O2'  O -33.699  11.457 36.007 . . . 1.0 . . . . . . . . . . . . A . 19 G O2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4827 . 1 1 19 G O3'  O -33.466  13.180 34.127 . . . 1.0 . . . . . . . . . . . . A . 19 G O3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4828 . 1 1 19 G O4'  O -34.475   9.932 33.183 . . . 1.0 . . . . . . . . . . . . A . 19 G O4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4829 . 1 1 19 G O5'  O -33.523  11.199 30.778 . . . 1.0 . . . . . . . . . . . . A . 19 G O5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4830 . 1 1 19 G O6   O -29.804   5.057 34.348 . . . 1.0 . . . . . . . . . . . . A . 19 G O6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4831 . 1 1 19 G OP1  O -33.909  12.463 28.651 . . . 1.0 . . . . . . . . . . . . A . 19 G OP1  . . . . . . . . . rr_2l5z 1 
       .  6 .  4832 . 1 1 19 G OP2  O -32.426  10.373 28.683 . . . 1.0 . . . . . . . . . . . . A . 19 G OP2  . . . . . . . . . rr_2l5z 1 
       .  6 .  4833 . 1 1 19 G P    P -33.611  11.111 29.173 . . . 1.0 . . . . . . . . . . . . A . 19 G P    . . . . . . . . . rr_2l5z 1 
       .  6 .  4834 . 1 1 20 A C1'  C -30.206  11.840 38.019 . . . 1.0 . . . . . . . . . . . . A . 20 A C1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4835 . 1 1 20 A C2   C -27.251   8.552 38.097 . . . 1.0 . . . . . . . . . . . . A . 20 A C2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4836 . 1 1 20 A C2'  C -29.476  13.107 38.474 . . . 1.0 . . . . . . . . . . . . A . 20 A C2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4837 . 1 1 20 A C3'  C -30.247  14.217 37.774 . . . 1.0 . . . . . . . . . . . . A . 20 A C3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4838 . 1 1 20 A C4   C -28.519  10.095 37.154 . . . 1.0 . . . . . . . . . . . . A . 20 A C4   . . . . . . . . . rr_2l5z 1 
       .  6 .  4839 . 1 1 20 A C4'  C -31.656  13.647 37.691 . . . 1.0 . . . . . . . . . . . . A . 20 A C4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4840 . 1 1 20 A C5   C -28.080   9.790 35.885 . . . 1.0 . . . . . . . . . . . . A . 20 A C5   . . . . . . . . . rr_2l5z 1 
       .  6 .  4841 . 1 1 20 A C5'  C -32.462  14.279 36.556 . . . 1.0 . . . . . . . . . . . . A . 20 A C5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4842 . 1 1 20 A C6   C -27.140   8.760 35.782 . . . 1.0 . . . . . . . . . . . . A . 20 A C6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4843 . 1 1 20 A C8   C -29.460  11.351 35.678 . . . 1.0 . . . . . . . . . . . . A . 20 A C8   . . . . . . . . . rr_2l5z 1 
       .  6 .  4844 . 1 1 20 A H1'  H -30.365  11.189 38.878 . . . 1.0 . . . . . . . . . . . . A . 20 A H1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4845 . 1 1 20 A H2   H -26.888   8.023 38.978 . . . 1.0 . . . . . . . . . . . . A . 20 A H2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4846 . 1 1 20 A H2'  H -28.441  13.090 38.120 . . . 1.0 . . . . . . . . . . . . A . 20 A H2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4847 . 1 1 20 A H3'  H -29.826  14.442 36.791 . . . 1.0 . . . . . . . . . . . . A . 20 A H3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4848 . 1 1 20 A H4'  H -32.170  13.811 38.637 . . . 1.0 . . . . . . . . . . . . A . 20 A H4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4849 . 1 1 20 A H5'  H -33.322  13.647 36.337 . . . 1.0 . . . . . . . . . . . . A . 20 A H5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4850 . 1 1 20 A H5'' H -32.812  15.262 36.872 . . . 1.0 . . . . . . . . . . . . A . 20 A H5'' . . . . . . . . . rr_2l5z 1 
       .  6 .  4851 . 1 1 20 A H61  H -25.950   7.598 34.607 . . . 1.0 . . . . . . . . . . . . A . 20 A H61  . . . . . . . . . rr_2l5z 1 
       .  6 .  4852 . 1 1 20 A H62  H -26.916   8.786 33.759 . . . 1.0 . . . . . . . . . . . . A . 20 A H62  . . . . . . . . . rr_2l5z 1 
       .  6 .  4853 . 1 1 20 A H8   H -30.095  12.116 35.258 . . . 1.0 . . . . . . . . . . . . A . 20 A H8   . . . . . . . . . rr_2l5z 1 
       .  6 .  4854 . 1 1 20 A HO2' H -30.081  14.015 40.087 . . . 1.0 . . . . . . . . . . . . A . 20 A HO2' . . . . . . . . . rr_2l5z 1 
       .  6 .  4855 . 1 1 20 A N1   N -26.750   8.163 36.923 . . . 1.0 . . . . . . . . . . . . A . 20 A N1   . . . . . . . . . rr_2l5z 1 
       .  6 .  4856 . 1 1 20 A N3   N -28.144   9.514 38.310 . . . 1.0 . . . . . . . . . . . . A . 20 A N3   . . . . . . . . . rr_2l5z 1 
       .  6 .  4857 . 1 1 20 A N6   N -26.627   8.348 34.622 . . . 1.0 . . . . . . . . . . . . A . 20 A N6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4858 . 1 1 20 A N7   N -28.701  10.616 34.931 . . . 1.0 . . . . . . . . . . . . A . 20 A N7   . . . . . . . . . rr_2l5z 1 
       .  6 .  4859 . 1 1 20 A N9   N -29.420  11.117 37.002 . . . 1.0 . . . . . . . . . . . . A . 20 A N9   . . . . . . . . . rr_2l5z 1 
       .  6 .  4860 . 1 1 20 A O2'  O -29.525  13.255 39.897 . . . 1.0 . . . . . . . . . . . . A . 20 A O2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4861 . 1 1 20 A O3'  O -30.271  15.361 38.630 . . . 1.0 . . . . . . . . . . . . A . 20 A O3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4862 . 1 1 20 A O4'  O -31.479  12.247 37.490 . . . 1.0 . . . . . . . . . . . . A . 20 A O4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4863 . 1 1 20 A O5'  O -31.673  14.425 35.370 . . . 1.0 . . . . . . . . . . . . A . 20 A O5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4864 . 1 1 20 A OP1  O -33.057  15.605 33.646 . . . 1.0 . . . . . . . . . . . . A . 20 A OP1  . . . . . . . . . rr_2l5z 1 
       .  6 .  4865 . 1 1 20 A OP2  O -31.345  13.824 32.960 . . . 1.0 . . . . . . . . . . . . A . 20 A OP2  . . . . . . . . . rr_2l5z 1 
       .  6 .  4866 . 1 1 20 A P    P -32.357  14.328 33.916 . . . 1.0 . . . . . . . . . . . . A . 20 A P    . . . . . . . . . rr_2l5z 1 
       .  6 .  4867 . 1 1 21 C C1'  C -24.574  13.325 38.199 . . . 1.0 . . . . . . . . . . . . A . 21 C C1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4868 . 1 1 21 C C2   C -23.479  11.351 37.233 . . . 1.0 . . . . . . . . . . . . A . 21 C C2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4869 . 1 1 21 C C2'  C -23.525  14.398 37.871 . . . 1.0 . . . . . . . . . . . . A . 21 C C2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4870 . 1 1 21 C C3'  C -24.355  15.653 37.609 . . . 1.0 . . . . . . . . . . . . A . 21 C C3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4871 . 1 1 21 C C4   C -24.356  10.270 35.343 . . . 1.0 . . . . . . . . . . . . A . 21 C C4   . . . . . . . . . rr_2l5z 1 
       .  6 .  4872 . 1 1 21 C C4'  C -25.641  15.380 38.373 . . . 1.0 . . . . . . . . . . . . A . 21 C C4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4873 . 1 1 21 C C5   C -25.456  11.183 35.292 . . . 1.0 . . . . . . . . . . . . A . 21 C C5   . . . . . . . . . rr_2l5z 1 
       .  6 .  4874 . 1 1 21 C C5'  C -26.821  16.188 37.830 . . . 1.0 . . . . . . . . . . . . A . 21 C C5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4875 . 1 1 21 C C6   C -25.513  12.149 36.230 . . . 1.0 . . . . . . . . . . . . A . 21 C C6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4876 . 1 1 21 C H1'  H -24.366  12.909 39.186 . . . 1.0 . . . . . . . . . . . . A . 21 C H1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4877 . 1 1 21 C H2'  H -22.973  14.116 36.969 . . . 1.0 . . . . . . . . . . . . A . 21 C H2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4878 . 1 1 21 C H3'  H -24.535  15.812 36.541 . . . 1.0 . . . . . . . . . . . . A . 21 C H3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4879 . 1 1 21 C H4'  H -25.495  15.608 39.428 . . . 1.0 . . . . . . . . . . . . A . 21 C H4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4880 . 1 1 21 C H41  H -23.477   8.660 34.463 . . . 1.0 . . . . . . . . . . . . A . 21 C H41  . . . . . . . . . rr_2l5z 1 
       .  6 .  4881 . 1 1 21 C H42  H -24.950   9.220 33.705 . . . 1.0 . . . . . . . . . . . . A . 21 C H42  . . . . . . . . . rr_2l5z 1 
       .  6 .  4882 . 1 1 21 C H5   H -26.214  11.102 34.528 . . . 1.0 . . . . . . . . . . . . A . 21 C H5   . . . . . . . . . rr_2l5z 1 
       .  6 .  4883 . 1 1 21 C H5'  H -26.500  17.213 37.642 . . . 1.0 . . . . . . . . . . . . A . 21 C H5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4884 . 1 1 21 C H5'' H -27.158  15.742 36.894 . . . 1.0 . . . . . . . . . . . . A . 21 C H5'' . . . . . . . . . rr_2l5z 1 
       .  6 .  4885 . 1 1 21 C H6   H -26.332  12.856 36.223 . . . 1.0 . . . . . . . . . . . . A . 21 C H6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4886 . 1 1 21 C HO2' H -22.267  13.734 39.200 . . . 1.0 . . . . . . . . . . . . A . 21 C HO2' . . . . . . . . . rr_2l5z 1 
       .  6 .  4887 . 1 1 21 C N1   N -24.546  12.244 37.188 . . . 1.0 . . . . . . . . . . . . A . 21 C N1   . . . . . . . . . rr_2l5z 1 
       .  6 .  4888 . 1 1 21 C N3   N -23.416  10.374 36.291 . . . 1.0 . . . . . . . . . . . . A . 21 C N3   . . . . . . . . . rr_2l5z 1 
       .  6 .  4889 . 1 1 21 C N4   N -24.253   9.305 34.429 . . . 1.0 . . . . . . . . . . . . A . 21 C N4   . . . . . . . . . rr_2l5z 1 
       .  6 .  4890 . 1 1 21 C O2   O -22.622  11.455 38.109 . . . 1.0 . . . . . . . . . . . . A . 21 C O2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4891 . 1 1 21 C O2'  O -22.626  14.594 38.969 . . . 1.0 . . . . . . . . . . . . A . 21 C O2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4892 . 1 1 21 C O3'  O -23.691  16.765 38.217 . . . 1.0 . . . . . . . . . . . . A . 21 C O3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4893 . 1 1 21 C O4'  O -25.850  13.981 38.225 . . . 1.0 . . . . . . . . . . . . A . 21 C O4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4894 . 1 1 21 C O5'  O -27.910  16.207 38.757 . . . 1.0 . . . . . . . . . . . . A . 21 C O5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4895 . 1 1 21 C OP1  O -29.826  17.771 39.153 . . . 1.0 . . . . . . . . . . . . A . 21 C OP1  . . . . . . . . . rr_2l5z 1 
       .  6 .  4896 . 1 1 21 C OP2  O -29.364  16.829 36.815 . . . 1.0 . . . . . . . . . . . . A . 21 C OP2  . . . . . . . . . rr_2l5z 1 
       .  6 .  4897 . 1 1 21 C P    P -29.381  16.658 38.284 . . . 1.0 . . . . . . . . . . . . A . 21 C P    . . . . . . . . . rr_2l5z 1 
       .  6 .  4898 . 1 1 22 G C1'  C -19.152  13.894 40.038 . . . 1.0 . . . . . . . . . . . . A . 22 G C1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4899 . 1 1 22 G C2   C -17.038  10.665 37.853 . . . 1.0 . . . . . . . . . . . . A . 22 G C2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4900 . 1 1 22 G C2'  C -17.926  14.796 40.108 . . . 1.0 . . . . . . . . . . . . A . 22 G C2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4901 . 1 1 22 G C3'  C -18.515  16.140 39.728 . . . 1.0 . . . . . . . . . . . . A . 22 G C3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4902 . 1 1 22 G C4   C -18.554  12.280 38.119 . . . 1.0 . . . . . . . . . . . . A . 22 G C4   . . . . . . . . . rr_2l5z 1 
       .  6 .  4903 . 1 1 22 G C4'  C -19.872  16.095 40.417 . . . 1.0 . . . . . . . . . . . . A . 22 G C4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4904 . 1 1 22 G C5   C -19.088  12.129 36.847 . . . 1.0 . . . . . . . . . . . . A . 22 G C5   . . . . . . . . . rr_2l5z 1 
       .  6 .  4905 . 1 1 22 G C5'  C -20.883  17.028 39.750 . . . 1.0 . . . . . . . . . . . . A . 22 G C5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4906 . 1 1 22 G C6   C -18.553  11.146 35.976 . . . 1.0 . . . . . . . . . . . . A . 22 G C6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4907 . 1 1 22 G C8   C -20.164  13.667 37.769 . . . 1.0 . . . . . . . . . . . . A . 22 G C8   . . . . . . . . . rr_2l5z 1 
       .  6 .  4908 . 1 1 22 G H1   H -17.046   9.737 35.976 . . . 1.0 . . . . . . . . . . . . A . 22 G H1   . . . . . . . . . rr_2l5z 1 
       .  6 .  4909 . 1 1 22 G H1'  H -19.075  13.105 40.784 . . . 1.0 . . . . . . . . . . . . A . 22 G H1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4910 . 1 1 22 G H2'  H -17.183  14.485 39.368 . . . 1.0 . . . . . . . . . . . . A . 22 G H2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4911 . 1 1 22 G H21  H -15.651   9.193 37.620 . . . 1.0 . . . . . . . . . . . . A . 22 G H21  . . . . . . . . . rr_2l5z 1 
       .  6 .  4912 . 1 1 22 G H22  H -15.641   9.996 39.174 . . . 1.0 . . . . . . . . . . . . A . 22 G H22  . . . . . . . . . rr_2l5z 1 
       .  6 .  4913 . 1 1 22 G H3'  H -18.600  16.252 38.646 . . . 1.0 . . . . . . . . . . . . A . 22 G H3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4914 . 1 1 22 G H4'  H -19.759  16.370 41.464 . . . 1.0 . . . . . . . . . . . . A . 22 G H4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4915 . 1 1 22 G H5'  H -21.801  17.035 40.336 . . . 1.0 . . . . . . . . . . . . A . 22 G H5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4916 . 1 1 22 G H5'' H -20.471  18.037 39.723 . . . 1.0 . . . . . . . . . . . . A . 22 G H5'' . . . . . . . . . rr_2l5z 1 
       .  6 .  4917 . 1 1 22 G H8   H -20.874  14.455 37.957 . . . 1.0 . . . . . . . . . . . . A . 22 G H8   . . . . . . . . . rr_2l5z 1 
       .  6 .  4918 . 1 1 22 G HO2' H -16.618  14.216 41.429 . . . 1.0 . . . . . . . . . . . . A . 22 G HO2' . . . . . . . . . rr_2l5z 1 
       .  6 .  4919 . 1 1 22 G N1   N -17.509  10.450 36.571 . . . 1.0 . . . . . . . . . . . . A . 22 G N1   . . . . . . . . . rr_2l5z 1 
       .  6 .  4920 . 1 1 22 G N2   N -16.028   9.889 38.247 . . . 1.0 . . . . . . . . . . . . A . 22 G N2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4921 . 1 1 22 G N3   N -17.538  11.587 38.683 . . . 1.0 . . . . . . . . . . . . A . 22 G N3   . . . . . . . . . rr_2l5z 1 
       .  6 .  4922 . 1 1 22 G N7   N -20.135  13.041 36.639 . . . 1.0 . . . . . . . . . . . . A . 22 G N7   . . . . . . . . . rr_2l5z 1 
       .  6 .  4923 . 1 1 22 G N9   N -19.275  13.291 38.699 . . . 1.0 . . . . . . . . . . . . A . 22 G N9   . . . . . . . . . rr_2l5z 1 
       .  6 .  4924 . 1 1 22 G O2'  O -17.363  14.820 41.426 . . . 1.0 . . . . . . . . . . . . A . 22 G O2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4925 . 1 1 22 G O3'  O -17.729  17.174 40.325 . . . 1.0 . . . . . . . . . . . . A . 22 G O3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4926 . 1 1 22 G O4'  O -20.287  14.726 40.336 . . . 1.0 . . . . . . . . . . . . A . 22 G O4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4927 . 1 1 22 G O5'  O -21.187  16.613 38.415 . . . 1.0 . . . . . . . . . . . . A . 22 G O5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4928 . 1 1 22 G O6   O -18.908  10.863 34.833 . . . 1.0 . . . . . . . . . . . . A . 22 G O6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4929 . 1 1 22 G OP1  O -22.277  18.805 37.880 . . . 1.0 . . . . . . . . . . . . A . 22 G OP1  . . . . . . . . . rr_2l5z 1 
       .  6 .  4930 . 1 1 22 G OP2  O -22.257  16.900 36.168 . . . 1.0 . . . . . . . . . . . . A . 22 G OP2  . . . . . . . . . rr_2l5z 1 
       .  6 .  4931 . 1 1 22 G P    P -22.339  17.359 37.572 . . . 1.0 . . . . . . . . . . . . A . 22 G P    . . . . . . . . . rr_2l5z 1 
       .  6 .  4932 . 1 1 23 G C1'  C -14.585  13.857 37.000 . . . 1.0 . . . . . . . . . . . . A . 23 G C1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4933 . 1 1 23 G C2   C -15.668  11.791 33.238 . . . 1.0 . . . . . . . . . . . . A . 23 G C2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4934 . 1 1 23 G C2'  C -13.445  14.672 36.386 . . . 1.0 . . . . . . . . . . . . A . 23 G C2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4935 . 1 1 23 G C3'  C -13.552  15.990 37.130 . . . 1.0 . . . . . . . . . . . . A . 23 G C3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4936 . 1 1 23 G C4   C -15.998  13.176 34.955 . . . 1.0 . . . . . . . . . . . . A . 23 G C4   . . . . . . . . . rr_2l5z 1 
       .  6 .  4937 . 1 1 23 G C4'  C -13.987  15.540 38.513 . . . 1.0 . . . . . . . . . . . . A . 23 G C4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4938 . 1 1 23 G C5   C -17.263  13.564 34.536 . . . 1.0 . . . . . . . . . . . . A . 23 G C5   . . . . . . . . . rr_2l5z 1 
       .  6 .  4939 . 1 1 23 G C5'  C -14.658  16.670 39.292 . . . 1.0 . . . . . . . . . . . . A . 23 G C5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4940 . 1 1 23 G C6   C -17.801  13.014 33.342 . . . 1.0 . . . . . . . . . . . . A . 23 G C6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4941 . 1 1 23 G C8   C -16.875  14.606 36.312 . . . 1.0 . . . . . . . . . . . . A . 23 G C8   . . . . . . . . . rr_2l5z 1 
       .  6 .  4942 . 1 1 23 G H1   H -17.242  11.677 31.866 . . . 1.0 . . . . . . . . . . . . A . 23 G H1   . . . . . . . . . rr_2l5z 1 
       .  6 .  4943 . 1 1 23 G H1'  H -14.260  12.827 37.150 . . . 1.0 . . . . . . . . . . . . A . 23 G H1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4944 . 1 1 23 G H2'  H -13.625  14.825 35.320 . . . 1.0 . . . . . . . . . . . . A . 23 G H2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4945 . 1 1 23 G H21  H -15.356  10.526 31.672 . . . 1.0 . . . . . . . . . . . . A . 23 G H21  . . . . . . . . . rr_2l5z 1 
       .  6 .  4946 . 1 1 23 G H22  H -14.044  10.632 32.826 . . . 1.0 . . . . . . . . . . . . A . 23 G H22  . . . . . . . . . rr_2l5z 1 
       .  6 .  4947 . 1 1 23 G H3'  H -14.279  16.661 36.667 . . . 1.0 . . . . . . . . . . . . A . 23 G H3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4948 . 1 1 23 G H4'  H -13.124  15.178 39.067 . . . 1.0 . . . . . . . . . . . . A . 23 G H4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4949 . 1 1 23 G H5'  H -14.908  16.312 40.291 . . . 1.0 . . . . . . . . . . . . A . 23 G H5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4950 . 1 1 23 G H5'' H -13.961  17.504 39.379 . . . 1.0 . . . . . . . . . . . . A . 23 G H5'' . . . . . . . . . rr_2l5z 1 
       .  6 .  4951 . 1 1 23 G H8   H -16.973  15.263 37.162 . . . 1.0 . . . . . . . . . . . . A . 23 G H8   . . . . . . . . . rr_2l5z 1 
       .  6 .  4952 . 1 1 23 G HO2' H -11.769  14.483 37.359 . . . 1.0 . . . . . . . . . . . . A . 23 G HO2' . . . . . . . . . rr_2l5z 1 
       .  6 .  4953 . 1 1 23 G N1   N -16.918  12.120 32.748 . . . 1.0 . . . . . . . . . . . . A . 23 G N1   . . . . . . . . . rr_2l5z 1 
       .  6 .  4954 . 1 1 23 G N2   N -14.966  10.912 32.520 . . . 1.0 . . . . . . . . . . . . A . 23 G N2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4955 . 1 1 23 G N3   N -15.154  12.303 34.361 . . . 1.0 . . . . . . . . . . . . A . 23 G N3   . . . . . . . . . rr_2l5z 1 
       .  6 .  4956 . 1 1 23 G N7   N -17.816  14.493 35.432 . . . 1.0 . . . . . . . . . . . . A . 23 G N7   . . . . . . . . . rr_2l5z 1 
       .  6 .  4957 . 1 1 23 G N9   N -15.768  13.869 36.116 . . . 1.0 . . . . . . . . . . . . A . 23 G N9   . . . . . . . . . rr_2l5z 1 
       .  6 .  4958 . 1 1 23 G O2'  O -12.175  14.047 36.607 . . . 1.0 . . . . . . . . . . . . A . 23 G O2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4959 . 1 1 23 G O3'  O -12.251  16.575 37.220 . . . 1.0 . . . . . . . . . . . . A . 23 G O3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4960 . 1 1 23 G O4'  O -14.883  14.453 38.276 . . . 1.0 . . . . . . . . . . . . A . 23 G O4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4961 . 1 1 23 G O5'  O -15.851  17.126 38.650 . . . 1.0 . . . . . . . . . . . . A . 23 G O5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4962 . 1 1 23 G O6   O -18.894  13.239 32.824 . . . 1.0 . . . . . . . . . . . . A . 23 G O6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4963 . 1 1 23 G OP1  O -16.025  19.010 40.292 . . . 1.0 . . . . . . . . . . . . A . 23 G OP1  . . . . . . . . . rr_2l5z 1 
       .  6 .  4964 . 1 1 23 G OP2  O -17.726  18.767 38.392 . . . 1.0 . . . . . . . . . . . . A . 23 G OP2  . . . . . . . . . rr_2l5z 1 
       .  6 .  4965 . 1 1 23 G P    P -16.839  18.151 39.404 . . . 1.0 . . . . . . . . . . . . A . 23 G P    . . . . . . . . . rr_2l5z 1 
       .  6 .  4966 . 1 1 24 C C1'  C -12.728  14.714 31.993 . . . 1.0 . . . . . . . . . . . . A . 24 C C1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4967 . 1 1 24 C C2   C -14.984  14.515 30.974 . . . 1.0 . . . . . . . . . . . . A . 24 C C2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4968 . 1 1 24 C C2'  C -11.935  15.618 31.041 . . . 1.0 . . . . . . . . . . . . A . 24 C C2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4969 . 1 1 24 C C3'  C -11.184  16.540 31.986 . . . 1.0 . . . . . . . . . . . . A . 24 C C3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4970 . 1 1 24 C C4   C -16.804  15.731 31.823 . . . 1.0 . . . . . . . . . . . . A . 24 C C4   . . . . . . . . . rr_2l5z 1 
       .  6 .  4971 . 1 1 24 C C4'  C -10.959  15.652 33.192 . . . 1.0 . . . . . . . . . . . . A . 24 C C4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4972 . 1 1 24 C C5   C -15.982  16.312 32.840 . . . 1.0 . . . . . . . . . . . . A . 24 C C5   . . . . . . . . . rr_2l5z 1 
       .  6 .  4973 . 1 1 24 C C5'  C -10.670  16.466 34.452 . . . 1.0 . . . . . . . . . . . . A . 24 C C5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4974 . 1 1 24 C C6   C -14.681  15.960 32.875 . . . 1.0 . . . . . . . . . . . . A . 24 C C6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4975 . 1 1 24 C H1'  H -12.588  13.669 31.702 . . . 1.0 . . . . . . . . . . . . A . 24 C H1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4976 . 1 1 24 C H2'  H -12.622  16.199 30.424 . . . 1.0 . . . . . . . . . . . . A . 24 C H2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4977 . 1 1 24 C H3'  H -11.764  17.430 32.234 . . . 1.0 . . . . . . . . . . . . A . 24 C H3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4978 . 1 1 24 C H4'  H -10.134  14.969 32.998 . . . 1.0 . . . . . . . . . . . . A . 24 C H4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4979 . 1 1 24 C H41  H -18.678  15.649 31.034 . . . 1.0 . . . . . . . . . . . . A . 24 C H41  . . . . . . . . . rr_2l5z 1 
       .  6 .  4980 . 1 1 24 C H42  H -18.488  16.710 32.412 . . . 1.0 . . . . . . . . . . . . A . 24 C H42  . . . . . . . . . rr_2l5z 1 
       .  6 .  4981 . 1 1 24 C H5   H -16.392  17.008 33.555 . . . 1.0 . . . . . . . . . . . . A . 24 C H5   . . . . . . . . . rr_2l5z 1 
       .  6 .  4982 . 1 1 24 C H5'  H -10.417  15.784 35.264 . . . 1.0 . . . . . . . . . . . . A . 24 C H5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4983 . 1 1 24 C H5'' H  -9.823  17.123 34.262 . . . 1.0 . . . . . . . . . . . . A . 24 C H5'' . . . . . . . . . rr_2l5z 1 
       .  6 .  4984 . 1 1 24 C H6   H -14.029  16.395 33.620 . . . 1.0 . . . . . . . . . . . . A . 24 C H6   . . . . . . . . . rr_2l5z 1 
       .  6 .  4985 . 1 1 24 C HO2' H -11.538  14.133 29.846 . . . 1.0 . . . . . . . . . . . . A . 24 C HO2' . . . . . . . . . rr_2l5z 1 
       .  6 .  4986 . 1 1 24 C N1   N -14.173  15.076 31.965 . . . 1.0 . . . . . . . . . . . . A . 24 C N1   . . . . . . . . . rr_2l5z 1 
       .  6 .  4987 . 1 1 24 C N3   N -16.296  14.868 30.935 . . . 1.0 . . . . . . . . . . . . A . 24 C N3   . . . . . . . . . rr_2l5z 1 
       .  6 .  4988 . 1 1 24 C N4   N -18.094  16.057 31.751 . . . 1.0 . . . . . . . . . . . . A . 24 C N4   . . . . . . . . . rr_2l5z 1 
       .  6 .  4989 . 1 1 24 C O2   O -14.507  13.726 30.161 . . . 1.0 . . . . . . . . . . . . A . 24 C O2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4990 . 1 1 24 C O2'  O -11.036  14.857 30.225 . . . 1.0 . . . . . . . . . . . . A . 24 C O2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4991 . 1 1 24 C O3'  O  -9.919  16.861 31.399 . . . 1.0 . . . . . . . . . . . . A . 24 C O3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4992 . 1 1 24 C O4'  O -12.168  14.908 33.307 . . . 1.0 . . . . . . . . . . . . A . 24 C O4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4993 . 1 1 24 C O5'  O -11.794  17.257 34.843 . . . 1.0 . . . . . . . . . . . . A . 24 C O5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4994 . 1 1 24 C OP1  O -10.526  18.324 36.723 . . . 1.0 . . . . . . . . . . . . A . 24 C OP1  . . . . . . . . . rr_2l5z 1 
       .  6 .  4995 . 1 1 24 C OP2  O -13.019  18.808 36.383 . . . 1.0 . . . . . . . . . . . . A . 24 C OP2  . . . . . . . . . rr_2l5z 1 
       .  6 .  4996 . 1 1 24 C P    P -11.878  17.867 36.332 . . . 1.0 . . . . . . . . . . . . A . 24 C P    . . . . . . . . . rr_2l5z 1 
       .  6 .  4997 . 1 1 25 U C1'  C -12.235  15.594 26.372 . . . 1.0 . . . . . . . . . . . . A . 25 U C1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  4998 . 1 1 25 U C2   C -14.726  15.722 26.518 . . . 1.0 . . . . . . . . . . . . A . 25 U C2   . . . . . . . . . rr_2l5z 1 
       .  6 .  4999 . 1 1 25 U C2'  C -11.718  16.562 25.304 . . . 1.0 . . . . . . . . . . . . A . 25 U C2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  5000 . 1 1 25 U C3'  C -10.661  17.347 26.056 . . . 1.0 . . . . . . . . . . . . A . 25 U C3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  5001 . 1 1 25 U C4   C -15.820  17.214 28.152 . . . 1.0 . . . . . . . . . . . . A . 25 U C4   . . . . . . . . . rr_2l5z 1 
       .  6 .  5002 . 1 1 25 U C4'  C -10.071  16.284 26.959 . . . 1.0 . . . . . . . . . . . . A . 25 U C4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  5003 . 1 1 25 U C5   C -14.495  17.579 28.597 . . . 1.0 . . . . . . . . . . . . A . 25 U C5   . . . . . . . . . rr_2l5z 1 
       .  6 .  5004 . 1 1 25 U C5'  C  -9.362  16.893 28.168 . . . 1.0 . . . . . . . . . . . . A . 25 U C5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  5005 . 1 1 25 U C6   C -13.392  17.036 28.028 . . . 1.0 . . . . . . . . . . . . A . 25 U C6   . . . . . . . . . rr_2l5z 1 
       .  6 .  5006 . 1 1 25 U H1'  H -12.409  14.620 25.902 . . . 1.0 . . . . . . . . . . . . A . 25 U H1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  5007 . 1 1 25 U H2'  H -12.521  17.222 24.979 . . . 1.0 . . . . . . . . . . . . A . 25 U H2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  5008 . 1 1 25 U H3   H -16.764  16.023 26.743 . . . 1.0 . . . . . . . . . . . . A . 25 U H3   . . . . . . . . . rr_2l5z 1 
       .  6 .  5009 . 1 1 25 U H3'  H -11.089  18.179 26.617 . . . 1.0 . . . . . . . . . . . . A . 25 U H3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  5010 . 1 1 25 U H4'  H  -9.368  15.683 26.390 . . . 1.0 . . . . . . . . . . . . A . 25 U H4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  5011 . 1 1 25 U H5   H -14.378  18.333 29.363 . . . 1.0 . . . . . . . . . . . . A . 25 U H5   . . . . . . . . . rr_2l5z 1 
       .  6 .  5012 . 1 1 25 U H5'  H  -8.888  16.095 28.740 . . . 1.0 . . . . . . . . . . . . A . 25 U H5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  5013 . 1 1 25 U H5'' H  -8.593  17.582 27.818 . . . 1.0 . . . . . . . . . . . . A . 25 U H5'' . . . . . . . . . rr_2l5z 1 
       .  6 .  5014 . 1 1 25 U H6   H -12.418  17.336 28.383 . . . 1.0 . . . . . . . . . . . . A . 25 U H6   . . . . . . . . . rr_2l5z 1 
       .  6 .  5015 . 1 1 25 U HO2' H -10.202  15.983 24.228 . . . 1.0 . . . . . . . . . . . . A . 25 U HO2' . . . . . . . . . rr_2l5z 1 
       .  6 .  5016 . 1 1 25 U N1   N -13.482  16.127 27.007 . . . 1.0 . . . . . . . . . . . . A . 25 U N1   . . . . . . . . . rr_2l5z 1 
       .  6 .  5017 . 1 1 25 U N3   N -15.834  16.292 27.120 . . . 1.0 . . . . . . . . . . . . A . 25 U N3   . . . . . . . . . rr_2l5z 1 
       .  6 .  5018 . 1 1 25 U O2   O -14.834  14.907 25.605 . . . 1.0 . . . . . . . . . . . . A . 25 U O2   . . . . . . . . . rr_2l5z 1 
       .  6 .  5019 . 1 1 25 U O2'  O -11.153  15.858 24.191 . . . 1.0 . . . . . . . . . . . . A . 25 U O2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  5020 . 1 1 25 U O3'  O  -9.658  17.770 25.129 . . . 1.0 . . . . . . . . . . . . A . 25 U O3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  5021 . 1 1 25 U O4   O -16.871  17.651 28.616 . . . 1.0 . . . . . . . . . . . . A . 25 U O4   . . . . . . . . . rr_2l5z 1 
       .  6 .  5022 . 1 1 25 U O4'  O -11.179  15.469 27.347 . . . 1.0 . . . . . . . . . . . . A . 25 U O4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  5023 . 1 1 25 U O5'  O -10.267  17.600 29.019 . . . 1.0 . . . . . . . . . . . . A . 25 U O5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  5024 . 1 1 25 U OP1  O  -8.336  18.490 30.344 . . . 1.0 . . . . . . . . . . . . A . 25 U OP1  . . . . . . . . . rr_2l5z 1 
       .  6 .  5025 . 1 1 25 U OP2  O -10.739  19.177 30.908 . . . 1.0 . . . . . . . . . . . . A . 25 U OP2  . . . . . . . . . rr_2l5z 1 
       .  6 .  5026 . 1 1 25 U P    P  -9.773  18.153 30.449 . . . 1.0 . . . . . . . . . . . . A . 25 U P    . . . . . . . . . rr_2l5z 1 
       .  6 .  5027 . 1 1 26 C C1'  C -14.663  19.437 22.957 . . . 1.0 . . . . . . . . . . . . A . 26 C C1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  5028 . 1 1 26 C C2   C -16.516  20.334 24.289 . . . 1.0 . . . . . . . . . . . . A . 26 C C2   . . . . . . . . . rr_2l5z 1 
       .  6 .  5029 . 1 1 26 C C2'  C -14.342  20.665 22.096 . . . 1.0 . . . . . . . . . . . . A . 26 C C2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  5030 . 1 1 26 C C3'  C -12.816  20.684 22.056 . . . 1.0 . . . . . . . . . . . . A . 26 C C3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  5031 . 1 1 26 C C4   C -16.328  20.595 26.616 . . . 1.0 . . . . . . . . . . . . A . 26 C C4   . . . . . . . . . rr_2l5z 1 
       .  6 .  5032 . 1 1 26 C C4'  C -12.483  19.208 22.196 . . . 1.0 . . . . . . . . . . . . A . 26 C C4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  5033 . 1 1 26 C C5   C -14.991  20.086 26.595 . . . 1.0 . . . . . . . . . . . . A . 26 C C5   . . . . . . . . . rr_2l5z 1 
       .  6 .  5034 . 1 1 26 C C5'  C -11.052  18.988 22.685 . . . 1.0 . . . . . . . . . . . . A . 26 C C5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  5035 . 1 1 26 C C6   C -14.478  19.722 25.404 . . . 1.0 . . . . . . . . . . . . A . 26 C C6   . . . . . . . . . rr_2l5z 1 
       .  6 .  5036 . 1 1 26 C H1'  H -15.385  18.809 22.434 . . . 1.0 . . . . . . . . . . . . A . 26 C H1'  . . . . . . . . . rr_2l5z 1 
       .  6 .  5037 . 1 1 26 C H2'  H -14.719  21.570 22.583 . . . 1.0 . . . . . . . . . . . . A . 26 C H2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  5038 . 1 1 26 C H3'  H -12.420  21.248 22.909 . . . 1.0 . . . . . . . . . . . . A . 26 C H3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  5039 . 1 1 26 C H4'  H -12.621  18.711 21.239 . . . 1.0 . . . . . . . . . . . . A . 26 C H4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  5040 . 1 1 26 C H41  H -17.818  21.323 27.794 . . . 1.0 . . . . . . . . . . . . A . 26 C H41  . . . . . . . . . rr_2l5z 1 
       .  6 .  5041 . 1 1 26 C H42  H -16.346  20.885 28.631 . . . 1.0 . . . . . . . . . . . . A . 26 C H42  . . . . . . . . . rr_2l5z 1 
       .  6 .  5042 . 1 1 26 C H5   H -14.413  19.997 27.503 . . . 1.0 . . . . . . . . . . . . A . 26 C H5   . . . . . . . . . rr_2l5z 1 
       .  6 .  5043 . 1 1 26 C H5'  H -10.881  17.919 22.814 . . . 1.0 . . . . . . . . . . . . A . 26 C H5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  5044 . 1 1 26 C H5'' H -10.358  19.372 21.937 . . . 1.0 . . . . . . . . . . . . A . 26 C H5'' . . . . . . . . . rr_2l5z 1 
       .  6 .  5045 . 1 1 26 C H6   H -13.470  19.334 25.350 . . . 1.0 . . . . . . . . . . . . A . 26 C H6   . . . . . . . . . rr_2l5z 1 
       .  6 .  5046 . 1 1 26 C HO2' H -14.176  20.277 20.195 . . . 1.0 . . . . . . . . . . . . A . 26 C HO2' . . . . . . . . . rr_2l5z 1 
       .  6 .  5047 . 1 1 26 C HO3' H -12.641  22.121 20.754 . . . 1.0 . . . . . . . . . . . . A . 26 C HO3' . . . . . . . . . rr_2l5z 1 
       .  6 .  5048 . 1 1 26 C N1   N -15.218  19.838 24.265 . . . 1.0 . . . . . . . . . . . . A . 26 C N1   . . . . . . . . . rr_2l5z 1 
       .  6 .  5049 . 1 1 26 C N3   N -17.042  20.704 25.488 . . . 1.0 . . . . . . . . . . . . A . 26 C N3   . . . . . . . . . rr_2l5z 1 
       .  6 .  5050 . 1 1 26 C N4   N -16.875  20.965 27.775 . . . 1.0 . . . . . . . . . . . . A . 26 C N4   . . . . . . . . . rr_2l5z 1 
       .  6 .  5051 . 1 1 26 C O2   O -17.161  20.429 23.247 . . . 1.0 . . . . . . . . . . . . A . 26 C O2   . . . . . . . . . rr_2l5z 1 
       .  6 .  5052 . 1 1 26 C O2'  O -14.892  20.533 20.780 . . . 1.0 . . . . . . . . . . . . A . 26 C O2'  . . . . . . . . . rr_2l5z 1 
       .  6 .  5053 . 1 1 26 C O3'  O -12.329  21.216 20.818 . . . 1.0 . . . . . . . . . . . . A . 26 C O3'  . . . . . . . . . rr_2l5z 1 
       .  6 .  5054 . 1 1 26 C O4'  O -13.438  18.709 23.121 . . . 1.0 . . . . . . . . . . . . A . 26 C O4'  . . . . . . . . . rr_2l5z 1 
       .  6 .  5055 . 1 1 26 C O5'  O -10.811  19.651 23.928 . . . 1.0 . . . . . . . . . . . . A . 26 C O5'  . . . . . . . . . rr_2l5z 1 
       .  6 .  5056 . 1 1 26 C OP1  O  -8.313  19.474 23.877 . . . 1.0 . . . . . . . . . . . . A . 26 C OP1  . . . . . . . . . rr_2l5z 1 
       .  6 .  5057 . 1 1 26 C OP2  O  -9.540  20.103 26.038 . . . 1.0 . . . . . . . . . . . . A . 26 C OP2  . . . . . . . . . rr_2l5z 1 
       .  6 .  5058 . 1 1 26 C P    P  -9.481  19.332 24.776 . . . 1.0 . . . . . . . . . . . . A . 26 C P    . . . . . . . . . rr_2l5z 1 
       .  7 .  5059 . 1 1  1 G C1'  C -24.604  19.404 22.754 . . . 1.0 . . . . . . . . . . . . A .  1 G C1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5060 . 1 1  1 G C2   C -20.388  20.760 22.832 . . . 1.0 . . . . . . . . . . . . A .  1 G C2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5061 . 1 1  1 G C2'  C -24.601  17.935 22.335 . . . 1.0 . . . . . . . . . . . . A .  1 G C2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5062 . 1 1  1 G C3'  C -25.750  17.361 23.144 . . . 1.0 . . . . . . . . . . . . A .  1 G C3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5063 . 1 1  1 G C4   C -22.312  20.073 23.727 . . . 1.0 . . . . . . . . . . . . A .  1 G C4   . . . . . . . . . rr_2l5z 1 
       .  7 .  5064 . 1 1  1 G C4'  C -26.737  18.522 23.189 . . . 1.0 . . . . . . . . . . . . A .  1 G C4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5065 . 1 1  1 G C5   C -21.844  20.128 25.033 . . . 1.0 . . . . . . . . . . . . A .  1 G C5   . . . . . . . . . rr_2l5z 1 
       .  7 .  5066 . 1 1  1 G C5'  C -27.653  18.448 24.413 . . . 1.0 . . . . . . . . . . . . A .  1 G C5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5067 . 1 1  1 G C6   C -20.507  20.541 25.280 . . . 1.0 . . . . . . . . . . . . A .  1 G C6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5068 . 1 1  1 G C8   C -23.834  19.479 25.136 . . . 1.0 . . . . . . . . . . . . A .  1 G C8   . . . . . . . . . rr_2l5z 1 
       .  7 .  5069 . 1 1  1 G H1   H -18.855  21.156 24.198 . . . 1.0 . . . . . . . . . . . . A .  1 G H1   . . . . . . . . . rr_2l5z 1 
       .  7 .  5070 . 1 1  1 G H1'  H -24.368  20.025 21.892 . . . 1.0 . . . . . . . . . . . . A .  1 G H1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5071 . 1 1  1 G H2'  H -23.661  17.463 22.630 . . . 1.0 . . . . . . . . . . . . A .  1 G H2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5072 . 1 1  1 G H21  H -18.637  21.385 22.005 . . . 1.0 . . . . . . . . . . . . A .  1 G H21  . . . . . . . . . rr_2l5z 1 
       .  7 .  5073 . 1 1  1 G H22  H -19.927  21.051 20.871 . . . 1.0 . . . . . . . . . . . . A .  1 G H22  . . . . . . . . . rr_2l5z 1 
       .  7 .  5074 . 1 1  1 G H3'  H -25.423  17.044 24.139 . . . 1.0 . . . . . . . . . . . . A .  1 G H3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5075 . 1 1  1 G H4'  H -27.342  18.519 22.285 . . . 1.0 . . . . . . . . . . . . A .  1 G H4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5076 . 1 1  1 G H5'  H -28.125  19.419 24.563 . . . 1.0 . . . . . . . . . . . . A .  1 G H5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5077 . 1 1  1 G H5'' H -28.425  17.700 24.235 . . . 1.0 . . . . . . . . . . . . A .  1 G H5'' . . . . . . . . . rr_2l5z 1 
       .  7 .  5078 . 1 1  1 G H8   H -24.790  19.142 25.509 . . . 1.0 . . . . . . . . . . . . A .  1 G H8   . . . . . . . . . rr_2l5z 1 
       .  7 .  5079 . 1 1  1 G HO2' H -25.747  17.540 20.811 . . . 1.0 . . . . . . . . . . . . A .  1 G HO2' . . . . . . . . . rr_2l5z 1 
       .  7 .  5080 . 1 1  1 G HO5' H -27.161  17.192 25.815 . . . 1.0 . . . . . . . . . . . . A .  1 G HO5' . . . . . . . . . rr_2l5z 1 
       .  7 .  5081 . 1 1  1 G N1   N -19.841  20.843 24.098 . . . 1.0 . . . . . . . . . . . . A .  1 G N1   . . . . . . . . . rr_2l5z 1 
       .  7 .  5082 . 1 1  1 G N2   N -19.586  21.092 21.820 . . . 1.0 . . . . . . . . . . . . A .  1 G N2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5083 . 1 1  1 G N3   N -21.646  20.372 22.590 . . . 1.0 . . . . . . . . . . . . A .  1 G N3   . . . . . . . . . rr_2l5z 1 
       .  7 .  5084 . 1 1  1 G N7   N -22.849  19.737 25.934 . . . 1.0 . . . . . . . . . . . . A .  1 G N7   . . . . . . . . . rr_2l5z 1 
       .  7 .  5085 . 1 1  1 G N9   N -23.612  19.647 23.820 . . . 1.0 . . . . . . . . . . . . A .  1 G N9   . . . . . . . . . rr_2l5z 1 
       .  7 .  5086 . 1 1  1 G O2'  O -24.828  17.791 20.928 . . . 1.0 . . . . . . . . . . . . A .  1 G O2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5087 . 1 1  1 G O3'  O -26.340  16.291 22.399 . . . 1.0 . . . . . . . . . . . . A .  1 G O3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5088 . 1 1  1 G O4'  O -25.934  19.705 23.211 . . . 1.0 . . . . . . . . . . . . A .  1 G O4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5089 . 1 1  1 G O5'  O -26.926  18.097 25.593 . . . 1.0 . . . . . . . . . . . . A .  1 G O5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5090 . 1 1  1 G O6   O -19.928  20.647 26.359 . . . 1.0 . . . . . . . . . . . . A .  1 G O6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5091 . 1 1  2 A C1'  C -20.874  14.153 21.774 . . . 1.0 . . . . . . . . . . . . A .  2 A C1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5092 . 1 1  2 A C2   C -17.388  15.483 24.151 . . . 1.0 . . . . . . . . . . . . A .  2 A C2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5093 . 1 1  2 A C2'  C -21.064  12.684 22.150 . . . 1.0 . . . . . . . . . . . . A .  2 A C2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5094 . 1 1  2 A C3'  C -22.572  12.528 22.113 . . . 1.0 . . . . . . . . . . . . A .  2 A C3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5095 . 1 1  2 A C4   C -19.530  15.329 23.632 . . . 1.0 . . . . . . . . . . . . A .  2 A C4   . . . . . . . . . rr_2l5z 1 
       .  7 .  5096 . 1 1  2 A C4'  C -22.976  13.467 20.983 . . . 1.0 . . . . . . . . . . . . A .  2 A C4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5097 . 1 1  2 A C5   C -19.922  16.115 24.691 . . . 1.0 . . . . . . . . . . . . A .  2 A C5   . . . . . . . . . rr_2l5z 1 
       .  7 .  5098 . 1 1  2 A C5'  C -24.420  13.949 21.129 . . . 1.0 . . . . . . . . . . . . A .  2 A C5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5099 . 1 1  2 A C6   C -18.905  16.599 25.519 . . . 1.0 . . . . . . . . . . . . A .  2 A C6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5100 . 1 1  2 A C8   C -21.670  15.570 23.680 . . . 1.0 . . . . . . . . . . . . A .  2 A C8   . . . . . . . . . rr_2l5z 1 
       .  7 .  5101 . 1 1  2 A H1'  H -20.002  14.251 21.127 . . . 1.0 . . . . . . . . . . . . A .  2 A H1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5102 . 1 1  2 A H2   H -16.342  15.235 23.971 . . . 1.0 . . . . . . . . . . . . A .  2 A H2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5103 . 1 1  2 A H2'  H -20.694  12.507 23.162 . . . 1.0 . . . . . . . . . . . . A .  2 A H2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5104 . 1 1  2 A H3'  H -23.030  12.798 23.068 . . . 1.0 . . . . . . . . . . . . A .  2 A H3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5105 . 1 1  2 A H4'  H -22.857  12.959 20.028 . . . 1.0 . . . . . . . . . . . . A .  2 A H4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5106 . 1 1  2 A H5'  H -24.592  14.777 20.438 . . . 1.0 . . . . . . . . . . . . A .  2 A H5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5107 . 1 1  2 A H5'' H -25.095  13.132 20.876 . . . 1.0 . . . . . . . . . . . . A .  2 A H5'' . . . . . . . . . rr_2l5z 1 
       .  7 .  5108 . 1 1  2 A H61  H -18.364  17.697 27.145 . . . 1.0 . . . . . . . . . . . . A .  2 A H61  . . . . . . . . . rr_2l5z 1 
       .  7 .  5109 . 1 1  2 A H62  H -20.081  17.634 26.818 . . . 1.0 . . . . . . . . . . . . A .  2 A H62  . . . . . . . . . rr_2l5z 1 
       .  7 .  5110 . 1 1  2 A H8   H -22.705  15.461 23.398 . . . 1.0 . . . . . . . . . . . . A .  2 A H8   . . . . . . . . . rr_2l5z 1 
       .  7 .  5111 . 1 1  2 A HO2' H -19.613  12.247 20.928 . . . 1.0 . . . . . . . . . . . . A .  2 A HO2' . . . . . . . . . rr_2l5z 1 
       .  7 .  5112 . 1 1  2 A N1   N -17.640  16.257 25.211 . . . 1.0 . . . . . . . . . . . . A .  2 A N1   . . . . . . . . . rr_2l5z 1 
       .  7 .  5113 . 1 1  2 A N3   N -18.273  14.971 23.300 . . . 1.0 . . . . . . . . . . . . A .  2 A N3   . . . . . . . . . rr_2l5z 1 
       .  7 .  5114 . 1 1  2 A N6   N -19.135  17.373 26.580 . . . 1.0 . . . . . . . . . . . . A .  2 A N6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5115 . 1 1  2 A N7   N -21.319  16.265 24.712 . . . 1.0 . . . . . . . . . . . . A .  2 A N7   . . . . . . . . . rr_2l5z 1 
       .  7 .  5116 . 1 1  2 A N9   N -20.683  14.981 22.979 . . . 1.0 . . . . . . . . . . . . A .  2 A N9   . . . . . . . . . rr_2l5z 1 
       .  7 .  5117 . 1 1  2 A O2'  O -20.423  11.815 21.209 . . . 1.0 . . . . . . . . . . . . A .  2 A O2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5118 . 1 1  2 A O3'  O -22.878  11.185 21.725 . . . 1.0 . . . . . . . . . . . . A .  2 A O3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5119 . 1 1  2 A O4'  O -22.053  14.556 21.052 . . . 1.0 . . . . . . . . . . . . A .  2 A O4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5120 . 1 1  2 A O5'  O -24.696  14.386 22.463 . . . 1.0 . . . . . . . . . . . . A .  2 A O5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5121 . 1 1  2 A OP1  O -27.137  13.932 22.127 . . . 1.0 . . . . . . . . . . . . A .  2 A OP1  . . . . . . . . . rr_2l5z 1 
       .  7 .  5122 . 1 1  2 A OP2  O -26.258  14.765 24.384 . . . 1.0 . . . . . . . . . . . . A .  2 A OP2  . . . . . . . . . rr_2l5z 1 
       .  7 .  5123 . 1 1  2 A P    P -26.197  14.769 22.906 . . . 1.0 . . . . . . . . . . . . A .  2 A P    . . . . . . . . . rr_2l5z 1 
       .  7 .  5124 . 1 1  3 G C1'  C -17.742  10.657 24.041 . . . 1.0 . . . . . . . . . . . . A .  3 G C1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5125 . 1 1  3 G C2   C -15.621  13.067 27.082 . . . 1.0 . . . . . . . . . . . . A .  3 G C2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5126 . 1 1  3 G C2'  C -17.536   9.199 24.459 . . . 1.0 . . . . . . . . . . . . A .  3 G C2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5127 . 1 1  3 G C3'  C -18.775   8.512 23.912 . . . 1.0 . . . . . . . . . . . . A .  3 G C3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5128 . 1 1  3 G C4   C -17.411  12.190 26.084 . . . 1.0 . . . . . . . . . . . . A .  3 G C4   . . . . . . . . . rr_2l5z 1 
       .  7 .  5129 . 1 1  3 G C4'  C -19.071   9.319 22.659 . . . 1.0 . . . . . . . . . . . . A .  3 G C4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5130 . 1 1  3 G C5   C -18.315  12.764 26.965 . . . 1.0 . . . . . . . . . . . . A .  3 G C5   . . . . . . . . . rr_2l5z 1 
       .  7 .  5131 . 1 1  3 G C5'  C -20.533   9.191 22.231 . . . 1.0 . . . . . . . . . . . . A .  3 G C5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5132 . 1 1  3 G C6   C -17.836  13.579 28.025 . . . 1.0 . . . . . . . . . . . . A .  3 G C6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5133 . 1 1  3 G C8   C -19.441  11.659 25.587 . . . 1.0 . . . . . . . . . . . . A .  3 G C8   . . . . . . . . . rr_2l5z 1 
       .  7 .  5134 . 1 1  3 G H1   H -16.024  14.262 28.752 . . . 1.0 . . . . . . . . . . . . A .  3 G H1   . . . . . . . . . rr_2l5z 1 
       .  7 .  5135 . 1 1  3 G H1'  H -16.807  11.055 23.645 . . . 1.0 . . . . . . . . . . . . A .  3 G H1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5136 . 1 1  3 G H2'  H -17.516   9.122 25.548 . . . 1.0 . . . . . . . . . . . . A .  3 G H2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5137 . 1 1  3 G H21  H -13.977  13.857 27.987 . . . 1.0 . . . . . . . . . . . . A .  3 G H21  . . . . . . . . . rr_2l5z 1 
       .  7 .  5138 . 1 1  3 G H22  H -13.656  12.852 26.591 . . . 1.0 . . . . . . . . . . . . A .  3 G H22  . . . . . . . . . rr_2l5z 1 
       .  7 .  5139 . 1 1  3 G H3'  H -19.600   8.535 24.626 . . . 1.0 . . . . . . . . . . . . A .  3 G H3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5140 . 1 1  3 G H4'  H -18.423   8.986 21.849 . . . 1.0 . . . . . . . . . . . . A .  3 G H4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5141 . 1 1  3 G H5'  H -20.670   9.704 21.278 . . . 1.0 . . . . . . . . . . . . A .  3 G H5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5142 . 1 1  3 G H5'' H -20.775   8.136 22.106 . . . 1.0 . . . . . . . . . . . . A .  3 G H5'' . . . . . . . . . rr_2l5z 1 
       .  7 .  5143 . 1 1  3 G H8   H -20.266  11.199 25.064 . . . 1.0 . . . . . . . . . . . . A .  3 G H8   . . . . . . . . . rr_2l5z 1 
       .  7 .  5144 . 1 1  3 G HO2' H -15.953   9.337 23.335 . . . 1.0 . . . . . . . . . . . . A .  3 G HO2' . . . . . . . . . rr_2l5z 1 
       .  7 .  5145 . 1 1  3 G N1   N -16.449  13.678 28.004 . . . 1.0 . . . . . . . . . . . . A .  3 G N1   . . . . . . . . . rr_2l5z 1 
       .  7 .  5146 . 1 1  3 G N2   N -14.313  13.275 27.232 . . . 1.0 . . . . . . . . . . . . A .  3 G N2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5147 . 1 1  3 G N3   N -16.064  12.299 26.082 . . . 1.0 . . . . . . . . . . . . A .  3 G N3   . . . . . . . . . rr_2l5z 1 
       .  7 .  5148 . 1 1  3 G N7   N -19.631  12.406 26.625 . . . 1.0 . . . . . . . . . . . . A .  3 G N7   . . . . . . . . . rr_2l5z 1 
       .  7 .  5149 . 1 1  3 G N9   N -18.168  11.475 25.193 . . . 1.0 . . . . . . . . . . . . A .  3 G N9   . . . . . . . . . rr_2l5z 1 
       .  7 .  5150 . 1 1  3 G O2'  O -16.341   8.655 23.888 . . . 1.0 . . . . . . . . . . . . A .  3 G O2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5151 . 1 1  3 G O3'  O -18.424   7.179 23.527 . . . 1.0 . . . . . . . . . . . . A .  3 G O3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5152 . 1 1  3 G O4'  O -18.738  10.662 23.003 . . . 1.0 . . . . . . . . . . . . A .  3 G O4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5153 . 1 1  3 G O5'  O -21.419   9.762 23.197 . . . 1.0 . . . . . . . . . . . . A .  3 G O5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5154 . 1 1  3 G O6   O -18.483  14.163 28.891 . . . 1.0 . . . . . . . . . . . . A .  3 G O6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5155 . 1 1  3 G OP1  O -23.495   8.800 22.176 . . . 1.0 . . . . . . . . . . . . A .  3 G OP1  . . . . . . . . . rr_2l5z 1 
       .  7 .  5156 . 1 1  3 G OP2  O -23.643  10.564 24.029 . . . 1.0 . . . . . . . . . . . . A .  3 G OP2  . . . . . . . . . rr_2l5z 1 
       .  7 .  5157 . 1 1  3 G P    P -22.967  10.018 22.831 . . . 1.0 . . . . . . . . . . . . A .  3 G P    . . . . . . . . . rr_2l5z 1 
       .  7 .  5158 . 1 1  4 C C1'  C -15.810   8.243 28.355 . . . 1.0 . . . . . . . . . . . . A .  4 C C1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5159 . 1 1  4 C C2   C -16.583  10.094 29.840 . . . 1.0 . . . . . . . . . . . . A .  4 C C2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5160 . 1 1  4 C C2'  C -15.774   6.952 29.188 . . . 1.0 . . . . . . . . . . . . A .  4 C C2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5161 . 1 1  4 C C3'  C -16.156   5.861 28.186 . . . 1.0 . . . . . . . . . . . . A .  4 C C3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5162 . 1 1  4 C C4   C -18.805  10.852 29.760 . . . 1.0 . . . . . . . . . . . . A .  4 C C4   . . . . . . . . . rr_2l5z 1 
       .  7 .  5163 . 1 1  4 C C4'  C -15.756   6.471 26.854 . . . 1.0 . . . . . . . . . . . . A .  4 C C4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5164 . 1 1  4 C C5   C -19.127   9.898 28.743 . . . 1.0 . . . . . . . . . . . . A .  4 C C5   . . . . . . . . . rr_2l5z 1 
       .  7 .  5165 . 1 1  4 C C5'  C -16.514   5.845 25.684 . . . 1.0 . . . . . . . . . . . . A .  4 C C5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5166 . 1 1  4 C C6   C -18.147   9.075 28.318 . . . 1.0 . . . . . . . . . . . . A .  4 C C6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5167 . 1 1  4 C H1'  H -14.833   8.735 28.407 . . . 1.0 . . . . . . . . . . . . A .  4 C H1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5168 . 1 1  4 C H2'  H -16.519   7.007 29.986 . . . 1.0 . . . . . . . . . . . . A .  4 C H2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5169 . 1 1  4 C H3'  H -17.221   5.621 28.228 . . . 1.0 . . . . . . . . . . . . A .  4 C H3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5170 . 1 1  4 C H4'  H -14.684   6.351 26.703 . . . 1.0 . . . . . . . . . . . . A .  4 C H4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5171 . 1 1  4 C H41  H -19.525  12.357 30.926 . . . 1.0 . . . . . . . . . . . . A .  4 C H41  . . . . . . . . . rr_2l5z 1 
       .  7 .  5172 . 1 1  4 C H42  H -20.682  11.634 29.832 . . . 1.0 . . . . . . . . . . . . A .  4 C H42  . . . . . . . . . rr_2l5z 1 
       .  7 .  5173 . 1 1  4 C H5   H -20.123   9.840 28.331 . . . 1.0 . . . . . . . . . . . . A .  4 C H5   . . . . . . . . . rr_2l5z 1 
       .  7 .  5174 . 1 1  4 C H5'  H -16.118   6.245 24.749 . . . 1.0 . . . . . . . . . . . . A .  4 C H5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5175 . 1 1  4 C H5'' H -16.363   4.765 25.699 . . . 1.0 . . . . . . . . . . . . A .  4 C H5'' . . . . . . . . . rr_2l5z 1 
       .  7 .  5176 . 1 1  4 C H6   H -18.371   8.314 27.581 . . . 1.0 . . . . . . . . . . . . A .  4 C H6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5177 . 1 1  4 C HO2' H -13.836   7.137 29.141 . . . 1.0 . . . . . . . . . . . . A .  4 C HO2' . . . . . . . . . rr_2l5z 1 
       .  7 .  5178 . 1 1  4 C N1   N -16.887   9.159 28.843 . . . 1.0 . . . . . . . . . . . . A .  4 C N1   . . . . . . . . . rr_2l5z 1 
       .  7 .  5179 . 1 1  4 C N3   N -17.570  10.924 30.272 . . . 1.0 . . . . . . . . . . . . A .  4 C N3   . . . . . . . . . rr_2l5z 1 
       .  7 .  5180 . 1 1  4 C N4   N -19.747  11.681 30.208 . . . 1.0 . . . . . . . . . . . . A .  4 C N4   . . . . . . . . . rr_2l5z 1 
       .  7 .  5181 . 1 1  4 C O2   O -15.447  10.149 30.310 . . . 1.0 . . . . . . . . . . . . A .  4 C O2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5182 . 1 1  4 C O2'  O -14.469   6.722 29.731 . . . 1.0 . . . . . . . . . . . . A .  4 C O2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5183 . 1 1  4 C O3'  O -15.331   4.716 28.425 . . . 1.0 . . . . . . . . . . . . A .  4 C O3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5184 . 1 1  4 C O4'  O -16.054   7.851 26.994 . . . 1.0 . . . . . . . . . . . . A .  4 C O4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5185 . 1 1  4 C O5'  O -17.915   6.120 25.750 . . . 1.0 . . . . . . . . . . . . A .  4 C O5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5186 . 1 1  4 C OP1  O -18.431   4.685 23.763 . . . 1.0 . . . . . . . . . . . . A .  4 C OP1  . . . . . . . . . rr_2l5z 1 
       .  7 .  5187 . 1 1  4 C OP2  O -20.257   6.109 24.859 . . . 1.0 . . . . . . . . . . . . A .  4 C OP2  . . . . . . . . . rr_2l5z 1 
       .  7 .  5188 . 1 1  4 C P    P -18.846   5.928 24.450 . . . 1.0 . . . . . . . . . . . . A .  4 C P    . . . . . . . . . rr_2l5z 1 
       .  7 .  5189 . 1 1  5 U C1'  C -15.298   7.059 33.444 . . . 1.0 . . . . . . . . . . . . A .  5 U C1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5190 . 1 1  5 U C2   C -17.357   8.300 34.076 . . . 1.0 . . . . . . . . . . . . A .  5 U C2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5191 . 1 1  5 U C2'  C -15.006   6.076 34.585 . . . 1.0 . . . . . . . . . . . . A .  5 U C2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5192 . 1 1  5 U C3'  C -14.649   4.786 33.856 . . . 1.0 . . . . . . . . . . . . A .  5 U C3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5193 . 1 1  5 U C4   C -19.543   7.721 33.092 . . . 1.0 . . . . . . . . . . . . A .  5 U C4   . . . . . . . . . rr_2l5z 1 
       .  7 .  5194 . 1 1  5 U C4'  C -14.054   5.286 32.546 . . . 1.0 . . . . . . . . . . . . A .  5 U C4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5195 . 1 1  5 U C5   C -18.853   6.699 32.340 . . . 1.0 . . . . . . . . . . . . A .  5 U C5   . . . . . . . . . rr_2l5z 1 
       .  7 .  5196 . 1 1  5 U C5'  C -14.186   4.258 31.417 . . . 1.0 . . . . . . . . . . . . A .  5 U C5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5197 . 1 1  5 U C6   C -17.515   6.520 32.468 . . . 1.0 . . . . . . . . . . . . A .  5 U C6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5198 . 1 1  5 U H1'  H -14.772   8.000 33.632 . . . 1.0 . . . . . . . . . . . . A .  5 U H1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5199 . 1 1  5 U H2'  H -15.906   5.928 35.190 . . . 1.0 . . . . . . . . . . . . A .  5 U H2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5200 . 1 1  5 U H3   H -19.178   9.193 34.508 . . . 1.0 . . . . . . . . . . . . A .  5 U H3   . . . . . . . . . rr_2l5z 1 
       .  7 .  5201 . 1 1  5 U H3'  H -15.524   4.149 33.704 . . . 1.0 . . . . . . . . . . . . A .  5 U H3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5202 . 1 1  5 U H4'  H -13.004   5.532 32.693 . . . 1.0 . . . . . . . . . . . . A .  5 U H4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5203 . 1 1  5 U H5   H -19.415   6.049 31.685 . . . 1.0 . . . . . . . . . . . . A .  5 U H5   . . . . . . . . . rr_2l5z 1 
       .  7 .  5204 . 1 1  5 U H5'  H -13.487   4.514 30.622 . . . 1.0 . . . . . . . . . . . . A .  5 U H5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5205 . 1 1  5 U H5'' H -13.940   3.267 31.800 . . . 1.0 . . . . . . . . . . . . A .  5 U H5'' . . . . . . . . . rr_2l5z 1 
       .  7 .  5206 . 1 1  5 U H6   H -17.029   5.743 31.897 . . . 1.0 . . . . . . . . . . . . A .  5 U H6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5207 . 1 1  5 U HO2' H -13.408   7.152 34.871 . . . 1.0 . . . . . . . . . . . . A .  5 U HO2' . . . . . . . . . rr_2l5z 1 
       .  7 .  5208 . 1 1  5 U N1   N -16.767   7.294 33.313 . . . 1.0 . . . . . . . . . . . . A .  5 U N1   . . . . . . . . . rr_2l5z 1 
       .  7 .  5209 . 1 1  5 U N3   N -18.722   8.460 33.925 . . . 1.0 . . . . . . . . . . . . A .  5 U N3   . . . . . . . . . rr_2l5z 1 
       .  7 .  5210 . 1 1  5 U O2   O -16.702   9.004 34.839 . . . 1.0 . . . . . . . . . . . . A .  5 U O2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5211 . 1 1  5 U O2'  O -13.918   6.531 35.398 . . . 1.0 . . . . . . . . . . . . A .  5 U O2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5212 . 1 1  5 U O3'  O -13.618   4.122 34.593 . . . 1.0 . . . . . . . . . . . . A .  5 U O3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5213 . 1 1  5 U O4   O -20.748   7.958 33.029 . . . 1.0 . . . . . . . . . . . . A .  5 U O4   . . . . . . . . . rr_2l5z 1 
       .  7 .  5214 . 1 1  5 U O4'  O -14.774   6.475 32.239 . . . 1.0 . . . . . . . . . . . . A .  5 U O4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5215 . 1 1  5 U O5'  O -15.512   4.238 30.883 . . . 1.0 . . . . . . . . . . . . A .  5 U O5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5216 . 1 1  5 U OP1  O -14.901   2.405 29.290 . . . 1.0 . . . . . . . . . . . . A .  5 U OP1  . . . . . . . . . rr_2l5z 1 
       .  7 .  5217 . 1 1  5 U OP2  O -17.266   3.392 29.308 . . . 1.0 . . . . . . . . . . . . A .  5 U OP2  . . . . . . . . . rr_2l5z 1 
       .  7 .  5218 . 1 1  5 U P    P -15.803   3.567 29.449 . . . 1.0 . . . . . . . . . . . . A .  5 U P    . . . . . . . . . rr_2l5z 1 
       .  7 .  5219 . 1 1  6 G C1'  C -18.302   5.370 37.915 . . . 1.0 . . . . . . . . . . . . A .  6 G C1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5220 . 1 1  6 G C2   C -20.683   9.070 37.433 . . . 1.0 . . . . . . . . . . . . A .  6 G C2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5221 . 1 1  6 G C2'  C -18.844   4.305 38.876 . . . 1.0 . . . . . . . . . . . . A .  6 G C2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5222 . 1 1  6 G C3'  C -17.858   3.136 38.735 . . . 1.0 . . . . . . . . . . . . A .  6 G C3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5223 . 1 1  6 G C4   C -20.032   7.000 36.919 . . . 1.0 . . . . . . . . . . . . A .  6 G C4   . . . . . . . . . rr_2l5z 1 
       .  7 .  5224 . 1 1  6 G C4'  C -16.647   3.773 38.058 . . . 1.0 . . . . . . . . . . . . A .  6 G C4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5225 . 1 1  6 G C5   C -20.913   6.876 35.853 . . . 1.0 . . . . . . . . . . . . A .  6 G C5   . . . . . . . . . rr_2l5z 1 
       .  7 .  5226 . 1 1  6 G C5'  C -15.825   2.757 37.259 . . . 1.0 . . . . . . . . . . . . A .  6 G C5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5227 . 1 1  6 G C6   C -21.776   7.956 35.531 . . . 1.0 . . . . . . . . . . . . A .  6 G C6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5228 . 1 1  6 G C8   C -19.852   5.074 35.965 . . . 1.0 . . . . . . . . . . . . A .  6 G C8   . . . . . . . . . rr_2l5z 1 
       .  7 .  5229 . 1 1  6 G H1   H -22.183   9.865 36.213 . . . 1.0 . . . . . . . . . . . . A .  6 G H1   . . . . . . . . . rr_2l5z 1 
       .  7 .  5230 . 1 1  6 G H1'  H -17.952   6.226 38.490 . . . 1.0 . . . . . . . . . . . . A .  6 G H1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5231 . 1 1  6 G H2'  H -19.847   4.000 38.559 . . . 1.0 . . . . . . . . . . . . A .  6 G H2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5232 . 1 1  6 G H21  H -21.270  10.958 37.912 . . . 1.0 . . . . . . . . . . . . A .  6 G H21  . . . . . . . . . rr_2l5z 1 
       .  7 .  5233 . 1 1  6 G H22  H -20.014  10.283 38.924 . . . 1.0 . . . . . . . . . . . . A .  6 G H22  . . . . . . . . . rr_2l5z 1 
       .  7 .  5234 . 1 1  6 G H3'  H -18.278   2.309 38.151 . . . 1.0 . . . . . . . . . . . . A .  6 G H3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5235 . 1 1  6 G H4'  H -16.014   4.240 38.810 . . . 1.0 . . . . . . . . . . . . A .  6 G H4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5236 . 1 1  6 G H5'  H -15.574   1.916 37.905 . . . 1.0 . . . . . . . . . . . . A .  6 G H5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5237 . 1 1  6 G H5'' H -16.418   2.396 36.420 . . . 1.0 . . . . . . . . . . . . A .  6 G H5'' . . . . . . . . . rr_2l5z 1 
       .  7 .  5238 . 1 1  6 G H8   H -19.498   4.074 35.768 . . . 1.0 . . . . . . . . . . . . A .  6 G H8   . . . . . . . . . rr_2l5z 1 
       .  7 .  5239 . 1 1  6 G HO2' H -19.769   5.089 40.400 . . . 1.0 . . . . . . . . . . . . A .  6 G HO2' . . . . . . . . . rr_2l5z 1 
       .  7 .  5240 . 1 1  6 G N1   N -21.587   9.032 36.390 . . . 1.0 . . . . . . . . . . . . A .  6 G N1   . . . . . . . . . rr_2l5z 1 
       .  7 .  5241 . 1 1  6 G N2   N -20.653  10.195 38.147 . . . 1.0 . . . . . . . . . . . . A .  6 G N2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5242 . 1 1  6 G N3   N -19.866   8.058 37.743 . . . 1.0 . . . . . . . . . . . . A .  6 G N3   . . . . . . . . . rr_2l5z 1 
       .  7 .  5243 . 1 1  6 G N7   N -20.779   5.616 35.246 . . . 1.0 . . . . . . . . . . . . A .  6 G N7   . . . . . . . . . rr_2l5z 1 
       .  7 .  5244 . 1 1  6 G N9   N -19.350   5.811 36.973 . . . 1.0 . . . . . . . . . . . . A .  6 G N9   . . . . . . . . . rr_2l5z 1 
       .  7 .  5245 . 1 1  6 G O2'  O -18.873   4.794 40.221 . . . 1.0 . . . . . . . . . . . . A .  6 G O2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5246 . 1 1  6 G O3'  O -17.467   2.723 40.047 . . . 1.0 . . . . . . . . . . . . A .  6 G O3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5247 . 1 1  6 G O4'  O -17.197   4.780 37.225 . . . 1.0 . . . . . . . . . . . . A .  6 G O4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5248 . 1 1  6 G O5'  O -14.617   3.337 36.759 . . . 1.0 . . . . . . . . . . . . A .  6 G O5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5249 . 1 1  6 G O6   O -22.612   8.024 34.632 . . . 1.0 . . . . . . . . . . . . A .  6 G O6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5250 . 1 1  6 G OP1  O -12.649   2.139 35.778 . . . 1.0 . . . . . . . . . . . . A .  6 G OP1  . . . . . . . . . rr_2l5z 1 
       .  7 .  5251 . 1 1  6 G OP2  O -14.954   2.006 34.665 . . . 1.0 . . . . . . . . . . . . A .  6 G OP2  . . . . . . . . . rr_2l5z 1 
       .  7 .  5252 . 1 1  6 G P    P -13.936   2.775 35.414 . . . 1.0 . . . . . . . . . . . . A .  6 G P    . . . . . . . . . rr_2l5z 1 
       .  7 .  5253 . 1 1  7 C C1'  C -18.729   3.927 44.783 . . . 1.0 . . . . . . . . . . . . A .  7 C C1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5254 . 1 1  7 C C2   C -21.076   4.647 44.804 . . . 1.0 . . . . . . . . . . . . A .  7 C C2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5255 . 1 1  7 C C2'  C -18.838   2.632 45.590 . . . 1.0 . . . . . . . . . . . . A .  7 C C2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5256 . 1 1  7 C C3'  C -18.080   1.635 44.731 . . . 1.0 . . . . . . . . . . . . A .  7 C C3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5257 . 1 1  7 C C4   C -22.353   4.698 42.833 . . . 1.0 . . . . . . . . . . . . A .  7 C C4   . . . . . . . . . rr_2l5z 1 
       .  7 .  5258 . 1 1  7 C C4'  C -17.004   2.500 44.093 . . . 1.0 . . . . . . . . . . . . A .  7 C C4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5259 . 1 1  7 C C5   C -21.239   4.235 42.064 . . . 1.0 . . . . . . . . . . . . A .  7 C C5   . . . . . . . . . rr_2l5z 1 
       .  7 .  5260 . 1 1  7 C C5'  C -16.480   1.891 42.790 . . . 1.0 . . . . . . . . . . . . A .  7 C C5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5261 . 1 1  7 C C6   C -20.084   3.998 42.714 . . . 1.0 . . . . . . . . . . . . A .  7 C C6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5262 . 1 1  7 C H1'  H -18.509   4.756 45.457 . . . 1.0 . . . . . . . . . . . . A .  7 C H1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5263 . 1 1  7 C H2'  H -19.885   2.331 45.676 . . . 1.0 . . . . . . . . . . . . A .  7 C H2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5264 . 1 1  7 C H3'  H -18.729   1.164 43.990 . . . 1.0 . . . . . . . . . . . . A .  7 C H3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5265 . 1 1  7 C H4'  H -16.181   2.634 44.793 . . . 1.0 . . . . . . . . . . . . A .  7 C H4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5266 . 1 1  7 C H41  H -24.306   5.269 42.770 . . . 1.0 . . . . . . . . . . . . A .  7 C H41  . . . . . . . . . rr_2l5z 1 
       .  7 .  5267 . 1 1  7 C H42  H -23.609   4.799 41.235 . . . 1.0 . . . . . . . . . . . . A .  7 C H42  . . . . . . . . . rr_2l5z 1 
       .  7 .  5268 . 1 1  7 C H5   H -21.323   4.080 40.998 . . . 1.0 . . . . . . . . . . . . A .  7 C H5   . . . . . . . . . rr_2l5z 1 
       .  7 .  5269 . 1 1  7 C H5'  H -16.062   2.684 42.169 . . . 1.0 . . . . . . . . . . . . A .  7 C H5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5270 . 1 1  7 C H5'' H -15.696   1.170 43.023 . . . 1.0 . . . . . . . . . . . . A .  7 C H5'' . . . . . . . . . rr_2l5z 1 
       .  7 .  5271 . 1 1  7 C H6   H -19.225   3.644 42.165 . . . 1.0 . . . . . . . . . . . . A .  7 C H6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5272 . 1 1  7 C HO2' H -18.812   2.324 47.512 . . . 1.0 . . . . . . . . . . . . A .  7 C HO2' . . . . . . . . . rr_2l5z 1 
       .  7 .  5273 . 1 1  7 C N1   N -19.992   4.197 44.062 . . . 1.0 . . . . . . . . . . . . A .  7 C N1   . . . . . . . . . rr_2l5z 1 
       .  7 .  5274 . 1 1  7 C N3   N -22.247   4.888 44.155 . . . 1.0 . . . . . . . . . . . . A .  7 C N3   . . . . . . . . . rr_2l5z 1 
       .  7 .  5275 . 1 1  7 C N4   N -23.517   4.941 42.230 . . . 1.0 . . . . . . . . . . . . A .  7 C N4   . . . . . . . . . rr_2l5z 1 
       .  7 .  5276 . 1 1  7 C O2   O -20.965   4.818 46.017 . . . 1.0 . . . . . . . . . . . . A .  7 C O2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5277 . 1 1  7 C O2'  O -18.240   2.770 46.884 . . . 1.0 . . . . . . . . . . . . A .  7 C O2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5278 . 1 1  7 C O3'  O -17.454   0.680 45.590 . . . 1.0 . . . . . . . . . . . . A .  7 C O3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5279 . 1 1  7 C O4'  O -17.634   3.760 43.864 . . . 1.0 . . . . . . . . . . . . A .  7 C O4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5280 . 1 1  7 C O5'  O -17.520   1.229 42.065 . . . 1.0 . . . . . . . . . . . . A .  7 C O5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5281 . 1 1  7 C OP1  O -16.196   0.564 40.045 . . . 1.0 . . . . . . . . . . . . A .  7 C OP1  . . . . . . . . . rr_2l5z 1 
       .  7 .  5282 . 1 1  7 C OP2  O -18.758   0.578 39.986 . . . 1.0 . . . . . . . . . . . . A .  7 C OP2  . . . . . . . . . rr_2l5z 1 
       .  7 .  5283 . 1 1  7 C P    P -17.485   1.166 40.458 . . . 1.0 . . . . . . . . . . . . A .  7 C P    . . . . . . . . . rr_2l5z 1 
       .  7 .  5284 . 1 1  8 A C1'  C -22.962   0.372 43.986 . . . 1.0 . . . . . . . . . . . . A .  8 A C1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5285 . 1 1  8 A C2   C -25.925   3.603 43.396 . . . 1.0 . . . . . . . . . . . . A .  8 A C2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5286 . 1 1  8 A C2'  C -21.699   0.739 43.227 . . . 1.0 . . . . . . . . . . . . A .  8 A C2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5287 . 1 1  8 A C3'  C -21.044  -0.618 43.020 . . . 1.0 . . . . . . . . . . . . A .  8 A C3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5288 . 1 1  8 A C4   C -24.387   2.459 44.494 . . . 1.0 . . . . . . . . . . . . A .  8 A C4   . . . . . . . . . rr_2l5z 1 
       .  7 .  5289 . 1 1  8 A C4'  C -21.494  -1.441 44.248 . . . 1.0 . . . . . . . . . . . . A .  8 A C4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5290 . 1 1  8 A C5   C -24.451   3.282 45.596 . . . 1.0 . . . . . . . . . . . . A .  8 A C5   . . . . . . . . . rr_2l5z 1 
       .  7 .  5291 . 1 1  8 A C5'  C -20.381  -1.623 45.292 . . . 1.0 . . . . . . . . . . . . A .  8 A C5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5292 . 1 1  8 A C6   C -25.357   4.346 45.527 . . . 1.0 . . . . . . . . . . . . A .  8 A C6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5293 . 1 1  8 A C8   C -23.018   1.820 46.030 . . . 1.0 . . . . . . . . . . . . A .  8 A C8   . . . . . . . . . rr_2l5z 1 
       .  7 .  5294 . 1 1  8 A H1'  H -23.737   0.071 43.280 . . . 1.0 . . . . . . . . . . . . A .  8 A H1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5295 . 1 1  8 A H2   H -26.544   3.766 42.513 . . . 1.0 . . . . . . . . . . . . A .  8 A H2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5296 . 1 1  8 A H2'  H -21.063   1.375 43.846 . . . 1.0 . . . . . . . . . . . . A .  8 A H2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5297 . 1 1  8 A H3'  H -19.957  -0.531 42.923 . . . 1.0 . . . . . . . . . . . . A .  8 A H3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5298 . 1 1  8 A H4'  H -21.830  -2.421 43.914 . . . 1.0 . . . . . . . . . . . . A .  8 A H4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5299 . 1 1  8 A H5'  H -20.814  -2.032 46.205 . . . 1.0 . . . . . . . . . . . . A .  8 A H5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5300 . 1 1  8 A H5'' H -19.643  -2.324 44.904 . . . 1.0 . . . . . . . . . . . . A .  8 A H5'' . . . . . . . . . rr_2l5z 1 
       .  7 .  5301 . 1 1  8 A H61  H -26.196   5.974 46.415 . . . 1.0 . . . . . . . . . . . . A .  8 A H61  . . . . . . . . . rr_2l5z 1 
       .  7 .  5302 . 1 1  8 A H62  H -24.990   5.136 47.367 . . . 1.0 . . . . . . . . . . . . A .  8 A H62  . . . . . . . . . rr_2l5z 1 
       .  7 .  5303 . 1 1  8 A H8   H -22.263   1.234 46.532 . . . 1.0 . . . . . . . . . . . . A .  8 A H8   . . . . . . . . . rr_2l5z 1 
       .  7 .  5304 . 1 1  8 A HO2' H -21.202   1.811 41.681 . . . 1.0 . . . . . . . . . . . . A .  8 A HO2' . . . . . . . . . rr_2l5z 1 
       .  7 .  5305 . 1 1  8 A N1   N -26.081   4.471 44.399 . . . 1.0 . . . . . . . . . . . . A .  8 A N1   . . . . . . . . . rr_2l5z 1 
       .  7 .  5306 . 1 1  8 A N3   N -25.098   2.562 43.355 . . . 1.0 . . . . . . . . . . . . A .  8 A N3   . . . . . . . . . rr_2l5z 1 
       .  7 .  5307 . 1 1  8 A N6   N -25.528   5.223 46.516 . . . 1.0 . . . . . . . . . . . . A .  8 A N6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5308 . 1 1  8 A N7   N -23.554   2.855 46.590 . . . 1.0 . . . . . . . . . . . . A .  8 A N7   . . . . . . . . . rr_2l5z 1 
       .  7 .  5309 . 1 1  8 A N9   N -23.446   1.509 44.793 . . . 1.0 . . . . . . . . . . . . A .  8 A N9   . . . . . . . . . rr_2l5z 1 
       .  7 .  5310 . 1 1  8 A O2'  O -22.002   1.373 41.979 . . . 1.0 . . . . . . . . . . . . A .  8 A O2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5311 . 1 1  8 A O3'  O -21.630  -1.212 41.858 . . . 1.0 . . . . . . . . . . . . A .  8 A O3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5312 . 1 1  8 A O4'  O -22.610  -0.740 44.815 . . . 1.0 . . . . . . . . . . . . A .  8 A O4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5313 . 1 1  8 A O5'  O -19.731  -0.386 45.596 . . . 1.0 . . . . . . . . . . . . A .  8 A O5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5314 . 1 1  8 A OP1  O -18.609   0.197 47.759 . . . 1.0 . . . . . . . . . . . . A .  8 A OP1  . . . . . . . . . rr_2l5z 1 
       .  7 .  5315 . 1 1  8 A OP2  O -17.721  -1.708 46.294 . . . 1.0 . . . . . . . . . . . . A .  8 A OP2  . . . . . . . . . rr_2l5z 1 
       .  7 .  5316 . 1 1  8 A P    P -18.346  -0.373 46.419 . . . 1.0 . . . . . . . . . . . . A .  8 A P    . . . . . . . . . rr_2l5z 1 
       .  7 .  5317 . 1 1  9 G C1'  C -23.687   1.982 39.826 . . . 1.0 . . . . . . . . . . . . A .  9 G C1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5318 . 1 1  9 G C2   C -24.990   6.198 39.658 . . . 1.0 . . . . . . . . . . . . A .  9 G C2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5319 . 1 1  9 G C2'  C -24.941   1.101 39.814 . . . 1.0 . . . . . . . . . . . . A .  9 G C2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5320 . 1 1  9 G C3'  C -24.431  -0.224 39.268 . . . 1.0 . . . . . . . . . . . . A .  9 G C3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5321 . 1 1  9 G C4   C -24.191   4.295 38.819 . . . 1.0 . . . . . . . . . . . . A .  9 G C4   . . . . . . . . . rr_2l5z 1 
       .  7 .  5322 . 1 1  9 G C4'  C -22.982  -0.239 39.728 . . . 1.0 . . . . . . . . . . . . A .  9 G C4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5323 . 1 1  9 G C5   C -24.077   4.787 37.528 . . . 1.0 . . . . . . . . . . . . A .  9 G C5   . . . . . . . . . rr_2l5z 1 
       .  7 .  5324 . 1 1  9 G C5'  C -22.114  -1.151 38.863 . . . 1.0 . . . . . . . . . . . . A .  9 G C5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5325 . 1 1  9 G C6   C -24.458   6.128 37.256 . . . 1.0 . . . . . . . . . . . . A .  9 G C6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5326 . 1 1  9 G C8   C -23.416   2.800 37.473 . . . 1.0 . . . . . . . . . . . . A .  9 G C8   . . . . . . . . . rr_2l5z 1 
       .  7 .  5327 . 1 1  9 G H1   H -25.219   7.758 38.282 . . . 1.0 . . . . . . . . . . . . A .  9 G H1   . . . . . . . . . rr_2l5z 1 
       .  7 .  5328 . 1 1  9 G H1'  H -23.609   2.482 40.791 . . . 1.0 . . . . . . . . . . . . A .  9 G H1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5329 . 1 1  9 G H2'  H -25.685   1.524 39.135 . . . 1.0 . . . . . . . . . . . . A .  9 G H2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5330 . 1 1  9 G H21  H -25.710   7.931 40.444 . . . 1.0 . . . . . . . . . . . . A .  9 G H21  . . . . . . . . . rr_2l5z 1 
       .  7 .  5331 . 1 1  9 G H22  H -25.513   6.614 41.580 . . . 1.0 . . . . . . . . . . . . A .  9 G H22  . . . . . . . . . rr_2l5z 1 
       .  7 .  5332 . 1 1  9 G H3'  H -24.524  -0.281 38.181 . . . 1.0 . . . . . . . . . . . . A .  9 G H3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5333 . 1 1  9 G H4'  H -22.931  -0.565 40.766 . . . 1.0 . . . . . . . . . . . . A .  9 G H4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5334 . 1 1  9 G H5'  H -22.633  -2.098 38.713 . . . 1.0 . . . . . . . . . . . . A .  9 G H5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5335 . 1 1  9 G H5'' H -21.954  -0.677 37.895 . . . 1.0 . . . . . . . . . . . . A .  9 G H5'' . . . . . . . . . rr_2l5z 1 
       .  7 .  5336 . 1 1  9 G H8   H -23.033   1.851 37.131 . . . 1.0 . . . . . . . . . . . . A .  9 G H8   . . . . . . . . . rr_2l5z 1 
       .  7 .  5337 . 1 1  9 G HO2' H -25.030   1.573 41.701 . . . 1.0 . . . . . . . . . . . . A .  9 G HO2' . . . . . . . . . rr_2l5z 1 
       .  7 .  5338 . 1 1  9 G N1   N -24.912   6.771 38.403 . . . 1.0 . . . . . . . . . . . . A .  9 G N1   . . . . . . . . . rr_2l5z 1 
       .  7 .  5339 . 1 1  9 G N2   N -25.441   6.978 40.640 . . . 1.0 . . . . . . . . . . . . A .  9 G N2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5340 . 1 1  9 G N3   N -24.634   4.938 39.921 . . . 1.0 . . . . . . . . . . . . A .  9 G N3   . . . . . . . . . rr_2l5z 1 
       .  7 .  5341 . 1 1  9 G N7   N -23.570   3.799 36.666 . . . 1.0 . . . . . . . . . . . . A .  9 G N7   . . . . . . . . . rr_2l5z 1 
       .  7 .  5342 . 1 1  9 G N9   N -23.756   2.999 38.759 . . . 1.0 . . . . . . . . . . . . A .  9 G N9   . . . . . . . . . rr_2l5z 1 
       .  7 .  5343 . 1 1  9 G O2'  O -25.484   0.949 41.130 . . . 1.0 . . . . . . . . . . . . A .  9 G O2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5344 . 1 1  9 G O3'  O -25.131  -1.283 39.930 . . . 1.0 . . . . . . . . . . . . A .  9 G O3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5345 . 1 1  9 G O4'  O -22.556   1.118 39.645 . . . 1.0 . . . . . . . . . . . . A .  9 G O4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5346 . 1 1  9 G O5'  O -20.846  -1.404 39.475 . . . 1.0 . . . . . . . . . . . . A .  9 G O5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5347 . 1 1  9 G O6   O -24.426   6.728 36.184 . . . 1.0 . . . . . . . . . . . . A .  9 G O6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5348 . 1 1  9 G OP1  O -21.455  -3.461 40.769 . . . 1.0 . . . . . . . . . . . . A .  9 G OP1  . . . . . . . . . rr_2l5z 1 
       .  7 .  5349 . 1 1  9 G OP2  O -19.350  -2.121 41.353 . . . 1.0 . . . . . . . . . . . . A .  9 G OP2  . . . . . . . . . rr_2l5z 1 
       .  7 .  5350 . 1 1  9 G P    P -20.758  -2.161 40.894 . . . 1.0 . . . . . . . . . . . . A .  9 G P    . . . . . . . . . rr_2l5z 1 
       .  7 .  5351 . 1 1 10 C C1'  C -28.967   2.315 40.487 . . . 1.0 . . . . . . . . . . . . A . 10 C C1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5352 . 1 1 10 C C2   C -29.854   3.340 38.434 . . . 1.0 . . . . . . . . . . . . A . 10 C C2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5353 . 1 1 10 C C2'  C -30.243   1.751 41.108 . . . 1.0 . . . . . . . . . . . . A . 10 C C2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5354 . 1 1 10 C C3'  C -29.883   0.291 41.318 . . . 1.0 . . . . . . . . . . . . A . 10 C C3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5355 . 1 1 10 C C4   C -29.313   2.489 36.314 . . . 1.0 . . . . . . . . . . . . A . 10 C C4   . . . . . . . . . rr_2l5z 1 
       .  7 .  5356 . 1 1 10 C C4'  C -28.401   0.364 41.667 . . . 1.0 . . . . . . . . . . . . A . 10 C C4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5357 . 1 1 10 C C5   C -28.510   1.459 36.898 . . . 1.0 . . . . . . . . . . . . A . 10 C C5   . . . . . . . . . rr_2l5z 1 
       .  7 .  5358 . 1 1 10 C C5'  C -27.665  -0.936 41.329 . . . 1.0 . . . . . . . . . . . . A . 10 C C5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5359 . 1 1 10 C C6   C -28.417   1.423 38.242 . . . 1.0 . . . . . . . . . . . . A . 10 C C6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5360 . 1 1 10 C H1'  H -28.792   3.325 40.861 . . . 1.0 . . . . . . . . . . . . A . 10 C H1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5361 . 1 1 10 C H2'  H -31.074   1.834 40.402 . . . 1.0 . . . . . . . . . . . . A . 10 C H2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5362 . 1 1 10 C H3'  H -30.075  -0.306 40.423 . . . 1.0 . . . . . . . . . . . . A . 10 C H3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5363 . 1 1 10 C H4'  H -28.287   0.579 42.728 . . . 1.0 . . . . . . . . . . . . A . 10 C H4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5364 . 1 1 10 C H41  H -29.992   3.293 34.572 . . . 1.0 . . . . . . . . . . . . A . 10 C H41  . . . . . . . . . rr_2l5z 1 
       .  7 .  5365 . 1 1 10 C H42  H -28.944   1.902 34.400 . . . 1.0 . . . . . . . . . . . . A . 10 C H42  . . . . . . . . . rr_2l5z 1 
       .  7 .  5366 . 1 1 10 C H5   H -27.994   0.736 36.283 . . . 1.0 . . . . . . . . . . . . A . 10 C H5   . . . . . . . . . rr_2l5z 1 
       .  7 .  5367 . 1 1 10 C H5'  H -26.639  -0.866 41.690 . . . 1.0 . . . . . . . . . . . . A . 10 C H5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5368 . 1 1 10 C H5'' H -28.163  -1.766 41.829 . . . 1.0 . . . . . . . . . . . . A . 10 C H5'' . . . . . . . . . rr_2l5z 1 
       .  7 .  5369 . 1 1 10 C H6   H -27.825   0.652 38.717 . . . 1.0 . . . . . . . . . . . . A . 10 C H6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5370 . 1 1 10 C HO2' H -30.718   1.709 42.996 . . . 1.0 . . . . . . . . . . . . A . 10 C HO2' . . . . . . . . . rr_2l5z 1 
       .  7 .  5371 . 1 1 10 C N1   N -29.072   2.343 39.009 . . . 1.0 . . . . . . . . . . . . A . 10 C N1   . . . . . . . . . rr_2l5z 1 
       .  7 .  5372 . 1 1 10 C N3   N -29.952   3.382 37.078 . . . 1.0 . . . . . . . . . . . . A . 10 C N3   . . . . . . . . . rr_2l5z 1 
       .  7 .  5373 . 1 1 10 C N4   N -29.426   2.568 34.988 . . . 1.0 . . . . . . . . . . . . A . 10 C N4   . . . . . . . . . rr_2l5z 1 
       .  7 .  5374 . 1 1 10 C O2   O -30.437   4.156 39.146 . . . 1.0 . . . . . . . . . . . . A . 10 C O2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5375 . 1 1 10 C O2'  O -30.555   2.397 42.348 . . . 1.0 . . . . . . . . . . . . A . 10 C O2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5376 . 1 1 10 C O3'  O -30.599  -0.193 42.458 . . . 1.0 . . . . . . . . . . . . A . 10 C O3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5377 . 1 1 10 C O4'  O -27.888   1.462 40.909 . . . 1.0 . . . . . . . . . . . . A . 10 C O4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5378 . 1 1 10 C O5'  O -27.648  -1.182 39.920 . . . 1.0 . . . . . . . . . . . . A . 10 C O5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5379 . 1 1 10 C OP1  O -26.474  -3.383 39.679 . . . 1.0 . . . . . . . . . . . . A . 10 C OP1  . . . . . . . . . rr_2l5z 1 
       .  7 .  5380 . 1 1 10 C OP2  O -26.398  -1.644 37.798 . . . 1.0 . . . . . . . . . . . . A . 10 C OP2  . . . . . . . . . rr_2l5z 1 
       .  7 .  5381 . 1 1 10 C P    P -26.416  -1.970 39.242 . . . 1.0 . . . . . . . . . . . . A . 10 C P    . . . . . . . . . rr_2l5z 1 
       .  7 .  5382 . 1 1 11 A C1'  C -35.467   2.466 40.246 . . . 1.0 . . . . . . . . . . . . A . 11 A C1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5383 . 1 1 11 A C2   C -35.454   4.135 36.142 . . . 1.0 . . . . . . . . . . . . A . 11 A C2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5384 . 1 1 11 A C2'  C -36.519   1.381 40.467 . . . 1.0 . . . . . . . . . . . . A . 11 A C2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5385 . 1 1 11 A C3'  C -35.814   0.430 41.415 . . . 1.0 . . . . . . . . . . . . A . 11 A C3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5386 . 1 1 11 A C4   C -34.792   2.804 37.780 . . . 1.0 . . . . . . . . . . . . A . 11 A C4   . . . . . . . . . rr_2l5z 1 
       .  7 .  5387 . 1 1 11 A C4'  C -34.972   1.374 42.268 . . . 1.0 . . . . . . . . . . . . A . 11 A C4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5388 . 1 1 11 A C5   C -33.850   2.180 36.994 . . . 1.0 . . . . . . . . . . . . A . 11 A C5   . . . . . . . . . rr_2l5z 1 
       .  7 .  5389 . 1 1 11 A C5'  C -33.735   0.680 42.846 . . . 1.0 . . . . . . . . . . . . A . 11 A C5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5390 . 1 1 11 A C6   C -33.751   2.619 35.670 . . . 1.0 . . . . . . . . . . . . A . 11 A C6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5391 . 1 1 11 A C8   C -33.727   1.291 38.883 . . . 1.0 . . . . . . . . . . . . A . 11 A C8   . . . . . . . . . rr_2l5z 1 
       .  7 .  5392 . 1 1 11 A H1'  H -35.958   3.435 40.172 . . . 1.0 . . . . . . . . . . . . A . 11 A H1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5393 . 1 1 11 A H2   H -36.080   4.942 35.764 . . . 1.0 . . . . . . . . . . . . A . 11 A H2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5394 . 1 1 11 A H2'  H -36.738   0.876 39.523 . . . 1.0 . . . . . . . . . . . . A . 11 A H2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5395 . 1 1 11 A H3'  H -35.209  -0.303 40.877 . . . 1.0 . . . . . . . . . . . . A . 11 A H3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5396 . 1 1 11 A H4'  H -35.580   1.765 43.083 . . . 1.0 . . . . . . . . . . . . A . 11 A H4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5397 . 1 1 11 A H5'  H -33.066   1.434 43.259 . . . 1.0 . . . . . . . . . . . . A . 11 A H5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5398 . 1 1 11 A H5'' H -34.048   0.006 43.644 . . . 1.0 . . . . . . . . . . . . A . 11 A H5'' . . . . . . . . . rr_2l5z 1 
       .  7 .  5399 . 1 1 11 A H61  H -32.850   2.459 33.853 . . . 1.0 . . . . . . . . . . . . A . 11 A H61  . . . . . . . . . rr_2l5z 1 
       .  7 .  5400 . 1 1 11 A H62  H -32.257   1.368 35.084 . . . 1.0 . . . . . . . . . . . . A . 11 A H62  . . . . . . . . . rr_2l5z 1 
       .  7 .  5401 . 1 1 11 A H8   H -33.417   0.675 39.714 . . . 1.0 . . . . . . . . . . . . A . 11 A H8   . . . . . . . . . rr_2l5z 1 
       .  7 .  5402 . 1 1 11 A HO2' H -37.453   2.392 41.844 . . . 1.0 . . . . . . . . . . . . A . 11 A HO2' . . . . . . . . . rr_2l5z 1 
       .  7 .  5403 . 1 1 11 A N1   N -34.579   3.607 35.279 . . . 1.0 . . . . . . . . . . . . A . 11 A N1   . . . . . . . . . rr_2l5z 1 
       .  7 .  5404 . 1 1 11 A N3   N -35.632   3.793 37.417 . . . 1.0 . . . . . . . . . . . . A . 11 A N3   . . . . . . . . . rr_2l5z 1 
       .  7 .  5405 . 1 1 11 A N6   N -32.883   2.108 34.798 . . . 1.0 . . . . . . . . . . . . A . 11 A N6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5406 . 1 1 11 A N7   N -33.162   1.196 37.724 . . . 1.0 . . . . . . . . . . . . A . 11 A N7   . . . . . . . . . rr_2l5z 1 
       .  7 .  5407 . 1 1 11 A N9   N -34.700   2.210 39.013 . . . 1.0 . . . . . . . . . . . . A . 11 A N9   . . . . . . . . . rr_2l5z 1 
       .  7 .  5408 . 1 1 11 A O2'  O -37.712   1.917 41.051 . . . 1.0 . . . . . . . . . . . . A . 11 A O2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5409 . 1 1 11 A O3'  O -36.795  -0.188 42.254 . . . 1.0 . . . . . . . . . . . . A . 11 A O3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5410 . 1 1 11 A O4'  O -34.607   2.452 41.400 . . . 1.0 . . . . . . . . . . . . A . 11 A O4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5411 . 1 1 11 A O5'  O -33.036  -0.070 41.849 . . . 1.0 . . . . . . . . . . . . A . 11 A O5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5412 . 1 1 11 A OP1  O -32.254  -1.694 43.591 . . . 1.0 . . . . . . . . . . . . A . 11 A OP1  . . . . . . . . . rr_2l5z 1 
       .  7 .  5413 . 1 1 11 A OP2  O -31.655  -2.030 41.123 . . . 1.0 . . . . . . . . . . . . A . 11 A OP2  . . . . . . . . . rr_2l5z 1 
       .  7 .  5414 . 1 1 11 A P    P -31.897  -1.128 42.271 . . . 1.0 . . . . . . . . . . . . A . 11 A P    . . . . . . . . . rr_2l5z 1 
       .  7 .  5415 . 1 1 12 C C1'  C -39.300   0.092 37.256 . . . 1.0 . . . . . . . . . . . . A . 12 C C1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5416 . 1 1 12 C C2   C -38.005   0.086 35.144 . . . 1.0 . . . . . . . . . . . . A . 12 C C2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5417 . 1 1 12 C C2'  C -40.348  -1.015 37.065 . . . 1.0 . . . . . . . . . . . . A . 12 C C2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5418 . 1 1 12 C C3'  C -40.477  -1.634 38.454 . . . 1.0 . . . . . . . . . . . . A . 12 C C3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5419 . 1 1 12 C C4   C -35.809  -0.745 35.073 . . . 1.0 . . . . . . . . . . . . A . 12 C C4   . . . . . . . . . rr_2l5z 1 
       .  7 .  5420 . 1 1 12 C C4'  C -40.052  -0.502 39.376 . . . 1.0 . . . . . . . . . . . . A . 12 C C4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5421 . 1 1 12 C C5   C -35.853  -1.064 36.466 . . . 1.0 . . . . . . . . . . . . A . 12 C C5   . . . . . . . . . rr_2l5z 1 
       .  7 .  5422 . 1 1 12 C C5'  C -39.539  -1.008 40.727 . . . 1.0 . . . . . . . . . . . . A . 12 C C5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5423 . 1 1 12 C C6   C -36.987  -0.788 37.140 . . . 1.0 . . . . . . . . . . . . A . 12 C C6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5424 . 1 1 12 C H1'  H -39.714   1.047 36.919 . . . 1.0 . . . . . . . . . . . . A . 12 C H1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5425 . 1 1 12 C H2'  H -39.976  -1.759 36.353 . . . 1.0 . . . . . . . . . . . . A . 12 C H2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5426 . 1 1 12 C H3'  H -39.847  -2.520 38.570 . . . 1.0 . . . . . . . . . . . . A . 12 C H3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5427 . 1 1 12 C H4'  H -40.890   0.174 39.532 . . . 1.0 . . . . . . . . . . . . A . 12 C H4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5428 . 1 1 12 C H41  H -34.667  -0.775 33.389 . . . 1.0 . . . . . . . . . . . . A . 12 C H41  . . . . . . . . . rr_2l5z 1 
       .  7 .  5429 . 1 1 12 C H42  H -33.902  -1.411 34.828 . . . 1.0 . . . . . . . . . . . . A . 12 C H42  . . . . . . . . . rr_2l5z 1 
       .  7 .  5430 . 1 1 12 C H5   H -35.004  -1.510 36.963 . . . 1.0 . . . . . . . . . . . . A . 12 C H5   . . . . . . . . . rr_2l5z 1 
       .  7 .  5431 . 1 1 12 C H5'  H -39.566  -0.188 41.445 . . . 1.0 . . . . . . . . . . . . A . 12 C H5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5432 . 1 1 12 C H5'' H -40.184  -1.812 41.084 . . . 1.0 . . . . . . . . . . . . A . 12 C H5'' . . . . . . . . . rr_2l5z 1 
       .  7 .  5433 . 1 1 12 C H6   H -37.058  -1.031 38.192 . . . 1.0 . . . . . . . . . . . . A . 12 C H6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5434 . 1 1 12 C HO2' H -41.399   0.259 36.034 . . . 1.0 . . . . . . . . . . . . A . 12 C HO2' . . . . . . . . . rr_2l5z 1 
       .  7 .  5435 . 1 1 12 C N1   N -38.054  -0.219 36.504 . . . 1.0 . . . . . . . . . . . . A . 12 C N1   . . . . . . . . . rr_2l5z 1 
       .  7 .  5436 . 1 1 12 C N3   N -36.862  -0.191 34.459 . . . 1.0 . . . . . . . . . . . . A . 12 C N3   . . . . . . . . . rr_2l5z 1 
       .  7 .  5437 . 1 1 12 C N4   N -34.703  -0.996 34.373 . . . 1.0 . . . . . . . . . . . . A . 12 C N4   . . . . . . . . . rr_2l5z 1 
       .  7 .  5438 . 1 1 12 C O2   O -38.977   0.599 34.592 . . . 1.0 . . . . . . . . . . . . A . 12 C O2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5439 . 1 1 12 C O2'  O -41.598  -0.474 36.620 . . . 1.0 . . . . . . . . . . . . A . 12 C O2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5440 . 1 1 12 C O3'  O -41.857  -1.917 38.698 . . . 1.0 . . . . . . . . . . . . A . 12 C O3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5441 . 1 1 12 C O4'  O -39.033   0.180 38.662 . . . 1.0 . . . . . . . . . . . . A . 12 C O4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5442 . 1 1 12 C O5'  O -38.198  -1.492 40.629 . . . 1.0 . . . . . . . . . . . . A . 12 C O5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5443 . 1 1 12 C OP1  O -38.190  -2.108 43.057 . . . 1.0 . . . . . . . . . . . . A . 12 C OP1  . . . . . . . . . rr_2l5z 1 
       .  7 .  5444 . 1 1 12 C OP2  O -36.123  -2.510 41.596 . . . 1.0 . . . . . . . . . . . . A . 12 C OP2  . . . . . . . . . rr_2l5z 1 
       .  7 .  5445 . 1 1 12 C P    P -37.301  -1.686 41.951 . . . 1.0 . . . . . . . . . . . . A . 12 C P    . . . . . . . . . rr_2l5z 1 
       .  7 .  5446 . 1 1 13 G C1'  C -39.759  -3.461 33.348 . . . 1.0 . . . . . . . . . . . . A . 13 G C1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5447 . 1 1 13 G C2   C -36.292  -3.003 30.634 . . . 1.0 . . . . . . . . . . . . A . 13 G C2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5448 . 1 1 13 G C2'  C -40.177  -4.844 32.836 . . . 1.0 . . . . . . . . . . . . A . 13 G C2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5449 . 1 1 13 G C3'  C -40.845  -5.478 34.047 . . . 1.0 . . . . . . . . . . . . A . 13 G C3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5450 . 1 1 13 G C4   C -37.300  -3.253 32.607 . . . 1.0 . . . . . . . . . . . . A . 13 G C4   . . . . . . . . . rr_2l5z 1 
       .  7 .  5451 . 1 1 13 G C4'  C -41.403  -4.277 34.795 . . . 1.0 . . . . . . . . . . . . A . 13 G C4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5452 . 1 1 13 G C5   C -36.114  -3.272 33.329 . . . 1.0 . . . . . . . . . . . . A . 13 G C5   . . . . . . . . . rr_2l5z 1 
       .  7 .  5453 . 1 1 13 G C5'  C -41.600  -4.566 36.284 . . . 1.0 . . . . . . . . . . . . A . 13 G C5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5454 . 1 1 13 G C6   C -34.876  -3.144 32.643 . . . 1.0 . . . . . . . . . . . . A . 13 G C6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5455 . 1 1 13 G C8   C -37.665  -3.487 34.721 . . . 1.0 . . . . . . . . . . . . A . 13 G C8   . . . . . . . . . rr_2l5z 1 
       .  7 .  5456 . 1 1 13 G H1   H -34.202  -2.913 30.700 . . . 1.0 . . . . . . . . . . . . A . 13 G H1   . . . . . . . . . rr_2l5z 1 
       .  7 .  5457 . 1 1 13 G H1'  H -40.064  -2.703 32.628 . . . 1.0 . . . . . . . . . . . . A . 13 G H1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5458 . 1 1 13 G H2'  H -39.292  -5.419 32.552 . . . 1.0 . . . . . . . . . . . . A . 13 G H2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5459 . 1 1 13 G H21  H -35.382  -2.775 28.827 . . . 1.0 . . . . . . . . . . . . A . 13 G H21  . . . . . . . . . rr_2l5z 1 
       .  7 .  5460 . 1 1 13 G H22  H -37.129  -2.852 28.784 . . . 1.0 . . . . . . . . . . . . A . 13 G H22  . . . . . . . . . rr_2l5z 1 
       .  7 .  5461 . 1 1 13 G H3'  H -40.135  -6.052 34.649 . . . 1.0 . . . . . . . . . . . . A . 13 G H3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5462 . 1 1 13 G H4'  H -42.353  -3.981 34.353 . . . 1.0 . . . . . . . . . . . . A . 13 G H4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5463 . 1 1 13 G H5'  H -42.070  -5.543 36.400 . . . 1.0 . . . . . . . . . . . . A . 13 G H5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5464 . 1 1 13 G H5'' H -40.628  -4.578 36.777 . . . 1.0 . . . . . . . . . . . . A . 13 G H5'' . . . . . . . . . rr_2l5z 1 
       .  7 .  5465 . 1 1 13 G H8   H -38.210  -3.606 35.644 . . . 1.0 . . . . . . . . . . . . A . 13 G H8   . . . . . . . . . rr_2l5z 1 
       .  7 .  5466 . 1 1 13 G HO2' H -41.793  -4.143 32.005 . . . 1.0 . . . . . . . . . . . . A . 13 G HO2' . . . . . . . . . rr_2l5z 1 
       .  7 .  5467 . 1 1 13 G N1   N -35.066  -3.012 31.272 . . . 1.0 . . . . . . . . . . . . A . 13 G N1   . . . . . . . . . rr_2l5z 1 
       .  7 .  5468 . 1 1 13 G N2   N -36.265  -2.866 29.308 . . . 1.0 . . . . . . . . . . . . A . 13 G N2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5469 . 1 1 13 G N3   N -37.460  -3.123 31.271 . . . 1.0 . . . . . . . . . . . . A . 13 G N3   . . . . . . . . . rr_2l5z 1 
       .  7 .  5470 . 1 1 13 G N7   N -36.374  -3.425 34.700 . . . 1.0 . . . . . . . . . . . . A . 13 G N7   . . . . . . . . . rr_2l5z 1 
       .  7 .  5471 . 1 1 13 G N9   N -38.297  -3.395 33.537 . . . 1.0 . . . . . . . . . . . . A . 13 G N9   . . . . . . . . . rr_2l5z 1 
       .  7 .  5472 . 1 1 13 G O2'  O -41.088  -4.737 31.736 . . . 1.0 . . . . . . . . . . . . A . 13 G O2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5473 . 1 1 13 G O3'  O -41.940  -6.278 33.591 . . . 1.0 . . . . . . . . . . . . A . 13 G O3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5474 . 1 1 13 G O4'  O -40.449  -3.239 34.589 . . . 1.0 . . . . . . . . . . . . A . 13 G O4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5475 . 1 1 13 G O5'  O -42.426  -3.578 36.904 . . . 1.0 . . . . . . . . . . . . A . 13 G O5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5476 . 1 1 13 G O6   O -33.741  -3.140 33.113 . . . 1.0 . . . . . . . . . . . . A . 13 G O6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5477 . 1 1 13 G OP1  O -43.839  -3.425 38.966 . . . 1.0 . . . . . . . . . . . . A . 13 G OP1  . . . . . . . . . rr_2l5z 1 
       .  7 .  5478 . 1 1 13 G OP2  O -41.456  -4.360 39.077 . . . 1.0 . . . . . . . . . . . . A . 13 G OP2  . . . . . . . . . rr_2l5z 1 
       .  7 .  5479 . 1 1 13 G P    P -42.433  -3.407 38.504 . . . 1.0 . . . . . . . . . . . . A . 13 G P    . . . . . . . . . rr_2l5z 1 
       .  7 .  5480 . 1 1 14 A C1'  C -42.056  -9.077 28.449 . . . 1.0 . . . . . . . . . . . . A . 14 A C1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5481 . 1 1 14 A C2   C -43.899  -6.223 25.616 . . . 1.0 . . . . . . . . . . . . A . 14 A C2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5482 . 1 1 14 A C2'  C -40.678  -8.501 28.132 . . . 1.0 . . . . . . . . . . . . A . 14 A C2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5483 . 1 1 14 A C3'  C -40.047  -8.386 29.506 . . . 1.0 . . . . . . . . . . . . A . 14 A C3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5484 . 1 1 14 A C4   C -43.562  -7.174 27.581 . . . 1.0 . . . . . . . . . . . . A . 14 A C4   . . . . . . . . . rr_2l5z 1 
       .  7 .  5485 . 1 1 14 A C4'  C -40.630  -9.588 30.246 . . . 1.0 . . . . . . . . . . . . A . 14 A C4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5486 . 1 1 14 A C5   C -44.475  -6.362 28.216 . . . 1.0 . . . . . . . . . . . . A . 14 A C5   . . . . . . . . . rr_2l5z 1 
       .  7 .  5487 . 1 1 14 A C5'  C -40.697  -9.359 31.758 . . . 1.0 . . . . . . . . . . . . A . 14 A C5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5488 . 1 1 14 A C6   C -45.127  -5.414 27.420 . . . 1.0 . . . . . . . . . . . . A . 14 A C6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5489 . 1 1 14 A C8   C -43.702  -7.642 29.680 . . . 1.0 . . . . . . . . . . . . A . 14 A C8   . . . . . . . . . rr_2l5z 1 
       .  7 .  5490 . 1 1 14 A H1'  H -42.347  -9.773 27.661 . . . 1.0 . . . . . . . . . . . . A . 14 A H1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5491 . 1 1 14 A H2   H -43.686  -6.133 24.550 . . . 1.0 . . . . . . . . . . . . A . 14 A H2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5492 . 1 1 14 A H2'  H -40.780  -7.511 27.681 . . . 1.0 . . . . . . . . . . . . A . 14 A H2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5493 . 1 1 14 A H3'  H -40.292  -7.435 29.984 . . . 1.0 . . . . . . . . . . . . A . 14 A H3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5494 . 1 1 14 A H4'  H -40.022 -10.468 30.042 . . . 1.0 . . . . . . . . . . . . A . 14 A H4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5495 . 1 1 14 A H5'  H -41.087 -10.257 32.237 . . . 1.0 . . . . . . . . . . . . A . 14 A H5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5496 . 1 1 14 A H5'' H -39.692  -9.164 32.133 . . . 1.0 . . . . . . . . . . . . A . 14 A H5'' . . . . . . . . . rr_2l5z 1 
       .  7 .  5497 . 1 1 14 A H61  H -46.475  -3.896 27.276 . . . 1.0 . . . . . . . . . . . . A . 14 A H61  . . . . . . . . . rr_2l5z 1 
       .  7 .  5498 . 1 1 14 A H62  H -46.280  -4.580 28.875 . . . 1.0 . . . . . . . . . . . . A . 14 A H62  . . . . . . . . . rr_2l5z 1 
       .  7 .  5499 . 1 1 14 A H8   H -43.509  -8.134 30.622 . . . 1.0 . . . . . . . . . . . . A . 14 A H8   . . . . . . . . . rr_2l5z 1 
       .  7 .  5500 . 1 1 14 A HO2' H -39.883 -10.230 27.718 . . . 1.0 . . . . . . . . . . . . A . 14 A HO2' . . . . . . . . . rr_2l5z 1 
       .  7 .  5501 . 1 1 14 A N1   N -44.806  -5.378 26.113 . . . 1.0 . . . . . . . . . . . . A . 14 A N1   . . . . . . . . . rr_2l5z 1 
       .  7 .  5502 . 1 1 14 A N3   N -43.223  -7.158 26.277 . . . 1.0 . . . . . . . . . . . . A . 14 A N3   . . . . . . . . . rr_2l5z 1 
       .  7 .  5503 . 1 1 14 A N6   N -46.034  -4.562 27.895 . . . 1.0 . . . . . . . . . . . . A . 14 A N6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5504 . 1 1 14 A N7   N -44.557  -6.677 29.583 . . . 1.0 . . . . . . . . . . . . A . 14 A N7   . . . . . . . . . rr_2l5z 1 
       .  7 .  5505 . 1 1 14 A N9   N -43.065  -8.005 28.550 . . . 1.0 . . . . . . . . . . . . A . 14 A N9   . . . . . . . . . rr_2l5z 1 
       .  7 .  5506 . 1 1 14 A O2'  O -39.928  -9.376 27.281 . . . 1.0 . . . . . . . . . . . . A . 14 A O2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5507 . 1 1 14 A O3'  O -38.635  -8.578 29.372 . . . 1.0 . . . . . . . . . . . . A . 14 A O3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5508 . 1 1 14 A O4'  O -41.935  -9.787 29.693 . . . 1.0 . . . . . . . . . . . . A . 14 A O4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5509 . 1 1 14 A O5'  O -41.540  -8.251 32.085 . . . 1.0 . . . . . . . . . . . . A . 14 A O5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5510 . 1 1 14 A OP1  O -43.185  -8.419 33.968 . . . 1.0 . . . . . . . . . . . . A . 14 A OP1  . . . . . . . . . rr_2l5z 1 
       .  7 .  5511 . 1 1 14 A OP2  O -40.670  -8.266 34.434 . . . 1.0 . . . . . . . . . . . . A . 14 A OP2  . . . . . . . . . rr_2l5z 1 
       .  7 .  5512 . 1 1 14 A P    P -41.848  -7.886 33.623 . . . 1.0 . . . . . . . . . . . . A . 14 A P    . . . . . . . . . rr_2l5z 1 
       .  7 .  5513 . 1 1 15 A C1'  C -40.675  -5.056 26.032 . . . 1.0 . . . . . . . . . . . . A . 15 A C1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5514 . 1 1 15 A C2   C -43.375  -1.559 26.280 . . . 1.0 . . . . . . . . . . . . A . 15 A C2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5515 . 1 1 15 A C2'  C -39.599  -4.189 25.367 . . . 1.0 . . . . . . . . . . . . A . 15 A C2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5516 . 1 1 15 A C3'  C -38.292  -4.852 25.790 . . . 1.0 . . . . . . . . . . . . A . 15 A C3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5517 . 1 1 15 A C4   C -42.177  -3.237 27.074 . . . 1.0 . . . . . . . . . . . . A . 15 A C4   . . . . . . . . . rr_2l5z 1 
       .  7 .  5518 . 1 1 15 A C4'  C -38.699  -6.302 26.021 . . . 1.0 . . . . . . . . . . . . A . 15 A C4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5519 . 1 1 15 A C5   C -42.534  -2.977 28.378 . . . 1.0 . . . . . . . . . . . . A . 15 A C5   . . . . . . . . . rr_2l5z 1 
       .  7 .  5520 . 1 1 15 A C5'  C -37.764  -7.015 27.001 . . . 1.0 . . . . . . . . . . . . A . 15 A C5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5521 . 1 1 15 A C6   C -43.396  -1.894 28.583 . . . 1.0 . . . . . . . . . . . . A . 15 A C6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5522 . 1 1 15 A C8   C -41.255  -4.632 28.434 . . . 1.0 . . . . . . . . . . . . A . 15 A C8   . . . . . . . . . rr_2l5z 1 
       .  7 .  5523 . 1 1 15 A H1'  H -41.418  -5.338 25.286 . . . 1.0 . . . . . . . . . . . . A . 15 A H1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5524 . 1 1 15 A H2   H -43.720  -0.942 25.452 . . . 1.0 . . . . . . . . . . . . A . 15 A H2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5525 . 1 1 15 A H2'  H -39.649  -3.169 25.761 . . . 1.0 . . . . . . . . . . . . A . 15 A H2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5526 . 1 1 15 A H3'  H -37.869  -4.387 26.685 . . . 1.0 . . . . . . . . . . . . A . 15 A H3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5527 . 1 1 15 A H4'  H -38.705  -6.834 25.071 . . . 1.0 . . . . . . . . . . . . A . 15 A H4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5528 . 1 1 15 A H5'  H -38.041  -8.068 27.054 . . . 1.0 . . . . . . . . . . . . A . 15 A H5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5529 . 1 1 15 A H5'' H -36.740  -6.934 26.636 . . . 1.0 . . . . . . . . . . . . A . 15 A H5'' . . . . . . . . . rr_2l5z 1 
       .  7 .  5530 . 1 1 15 A H61  H -44.451  -0.736 29.882 . . . 1.0 . . . . . . . . . . . . A . 15 A H61  . . . . . . . . . rr_2l5z 1 
       .  7 .  5531 . 1 1 15 A H62  H -43.534  -2.037 30.609 . . . 1.0 . . . . . . . . . . . . A . 15 A H62  . . . . . . . . . rr_2l5z 1 
       .  7 .  5532 . 1 1 15 A H8   H -40.634  -5.443 28.785 . . . 1.0 . . . . . . . . . . . . A . 15 A H8   . . . . . . . . . rr_2l5z 1 
       .  7 .  5533 . 1 1 15 A HO2' H -39.769  -3.271 23.660 . . . 1.0 . . . . . . . . . . . . A . 15 A HO2' . . . . . . . . . rr_2l5z 1 
       .  7 .  5534 . 1 1 15 A N1   N -43.796  -1.207 27.498 . . . 1.0 . . . . . . . . . . . . A . 15 A N1   . . . . . . . . . rr_2l5z 1 
       .  7 .  5535 . 1 1 15 A N3   N -42.562  -2.566 25.971 . . . 1.0 . . . . . . . . . . . . A . 15 A N3   . . . . . . . . . rr_2l5z 1 
       .  7 .  5536 . 1 1 15 A N6   N -43.829  -1.526 29.789 . . . 1.0 . . . . . . . . . . . . A . 15 A N6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5537 . 1 1 15 A N7   N -41.928  -3.893 29.254 . . . 1.0 . . . . . . . . . . . . A . 15 A N7   . . . . . . . . . rr_2l5z 1 
       .  7 .  5538 . 1 1 15 A N9   N -41.342  -4.324 27.126 . . . 1.0 . . . . . . . . . . . . A . 15 A N9   . . . . . . . . . rr_2l5z 1 
       .  7 .  5539 . 1 1 15 A O2'  O -39.742  -4.187 23.943 . . . 1.0 . . . . . . . . . . . . A . 15 A O2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5540 . 1 1 15 A O3'  O -37.389  -4.810 24.681 . . . 1.0 . . . . . . . . . . . . A . 15 A O3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5541 . 1 1 15 A O4'  O -40.029  -6.238 26.526 . . . 1.0 . . . . . . . . . . . . A . 15 A O4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5542 . 1 1 15 A O5'  O -37.841  -6.444 28.310 . . . 1.0 . . . . . . . . . . . . A . 15 A O5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5543 . 1 1 15 A OP1  O -36.236  -7.889 29.579 . . . 1.0 . . . . . . . . . . . . A . 15 A OP1  . . . . . . . . . rr_2l5z 1 
       .  7 .  5544 . 1 1 15 A OP2  O -38.082  -6.596 30.799 . . . 1.0 . . . . . . . . . . . . A . 15 A OP2  . . . . . . . . . rr_2l5z 1 
       .  7 .  5545 . 1 1 15 A P    P -37.617  -7.357 29.617 . . . 1.0 . . . . . . . . . . . . A . 15 A P    . . . . . . . . . rr_2l5z 1 
       .  7 .  5546 . 1 1 16 A C1'  C -40.062  -0.568 25.171 . . . 1.0 . . . . . . . . . . . . A . 16 A C1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5547 . 1 1 16 A C2   C -41.337   0.307 29.314 . . . 1.0 . . . . . . . . . . . . A . 16 A C2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5548 . 1 1 16 A C2'  C -39.574   0.683 24.450 . . . 1.0 . . . . . . . . . . . . A . 16 A C2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5549 . 1 1 16 A C3'  C -38.426   0.155 23.609 . . . 1.0 . . . . . . . . . . . . A . 16 A C3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5550 . 1 1 16 A C4   C -39.951  -0.382 27.739 . . . 1.0 . . . . . . . . . . . . A . 16 A C4   . . . . . . . . . rr_2l5z 1 
       .  7 .  5551 . 1 1 16 A C4'  C -38.873  -1.269 23.266 . . . 1.0 . . . . . . . . . . . . A . 16 A C4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5552 . 1 1 16 A C5   C -38.964  -0.708 28.642 . . . 1.0 . . . . . . . . . . . . A . 16 A C5   . . . . . . . . . rr_2l5z 1 
       .  7 .  5553 . 1 1 16 A C5'  C -37.689  -2.225 23.090 . . . 1.0 . . . . . . . . . . . . A . 16 A C5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5554 . 1 1 16 A C6   C -39.255  -0.481 29.991 . . . 1.0 . . . . . . . . . . . . A . 16 A C6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5555 . 1 1 16 A C8   C -38.209  -1.169 26.746 . . . 1.0 . . . . . . . . . . . . A . 16 A C8   . . . . . . . . . rr_2l5z 1 
       .  7 .  5556 . 1 1 16 A H1'  H -41.144  -0.523 25.282 . . . 1.0 . . . . . . . . . . . . A . 16 A H1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5557 . 1 1 16 A H2   H -42.297   0.720 29.626 . . . 1.0 . . . . . . . . . . . . A . 16 A H2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5558 . 1 1 16 A H2'  H -39.205   1.414 25.174 . . . 1.0 . . . . . . . . . . . . A . 16 A H2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5559 . 1 1 16 A H3'  H -37.480   0.187 24.158 . . . 1.0 . . . . . . . . . . . . A . 16 A H3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5560 . 1 1 16 A H4'  H -39.458  -1.249 22.347 . . . 1.0 . . . . . . . . . . . . A . 16 A H4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5561 . 1 1 16 A H5'  H -38.063  -3.204 22.788 . . . 1.0 . . . . . . . . . . . . A . 16 A H5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5562 . 1 1 16 A H5'' H -37.032  -1.839 22.312 . . . 1.0 . . . . . . . . . . . . A . 16 A H5'' . . . . . . . . . rr_2l5z 1 
       .  7 .  5563 . 1 1 16 A H61  H -38.661  -0.569 31.937 . . . 1.0 . . . . . . . . . . . . A . 16 A H61  . . . . . . . . . rr_2l5z 1 
       .  7 .  5564 . 1 1 16 A H62  H -37.494  -1.145 30.767 . . . 1.0 . . . . . . . . . . . . A . 16 A H62  . . . . . . . . . rr_2l5z 1 
       .  7 .  5565 . 1 1 16 A H8   H -37.563  -1.496 25.945 . . . 1.0 . . . . . . . . . . . . A . 16 A H8   . . . . . . . . . rr_2l5z 1 
       .  7 .  5566 . 1 1 16 A HO2' H -41.371   1.386 24.192 . . . 1.0 . . . . . . . . . . . . A . 16 A HO2' . . . . . . . . . rr_2l5z 1 
       .  7 .  5567 . 1 1 16 A N1   N -40.464   0.033 30.286 . . . 1.0 . . . . . . . . . . . . A . 16 A N1   . . . . . . . . . rr_2l5z 1 
       .  7 .  5568 . 1 1 16 A N3   N -41.167   0.131 28.007 . . . 1.0 . . . . . . . . . . . . A . 16 A N3   . . . . . . . . . rr_2l5z 1 
       .  7 .  5569 . 1 1 16 A N6   N -38.401  -0.753 30.978 . . . 1.0 . . . . . . . . . . . . A . 16 A N6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5570 . 1 1 16 A N7   N -37.834  -1.219 27.983 . . . 1.0 . . . . . . . . . . . . A . 16 A N7   . . . . . . . . . rr_2l5z 1 
       .  7 .  5571 . 1 1 16 A N9   N -39.442  -0.690 26.504 . . . 1.0 . . . . . . . . . . . . A . 16 A N9   . . . . . . . . . rr_2l5z 1 
       .  7 .  5572 . 1 1 16 A O2'  O -40.604   1.251 23.632 . . . 1.0 . . . . . . . . . . . . A . 16 A O2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5573 . 1 1 16 A O3'  O -38.374   0.913 22.395 . . . 1.0 . . . . . . . . . . . . A . 16 A O3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5574 . 1 1 16 A O4'  O -39.716  -1.689 24.342 . . . 1.0 . . . . . . . . . . . . A . 16 A O4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5575 . 1 1 16 A O5'  O -36.944  -2.364 24.304 . . . 1.0 . . . . . . . . . . . . A . 16 A O5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5576 . 1 1 16 A OP1  O -35.303  -4.079 23.504 . . . 1.0 . . . . . . . . . . . . A . 16 A OP1  . . . . . . . . . rr_2l5z 1 
       .  7 .  5577 . 1 1 16 A OP2  O -35.619  -3.635 26.008 . . . 1.0 . . . . . . . . . . . . A . 16 A OP2  . . . . . . . . . rr_2l5z 1 
       .  7 .  5578 . 1 1 16 A P    P -36.184  -3.743 24.644 . . . 1.0 . . . . . . . . . . . . A . 16 A P    . . . . . . . . . rr_2l5z 1 
       .  7 .  5579 . 1 1 17 G C1'  C -37.588   2.910 27.027 . . . 1.0 . . . . . . . . . . . . A . 17 G C1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5580 . 1 1 17 G C2   C -38.082   1.971 31.323 . . . 1.0 . . . . . . . . . . . . A . 17 G C2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5581 . 1 1 17 G C2'  C -37.291   4.401 26.892 . . . 1.0 . . . . . . . . . . . . A . 17 G C2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5582 . 1 1 17 G C3'  C -36.268   4.412 25.773 . . . 1.0 . . . . . . . . . . . . A . 17 G C3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5583 . 1 1 17 G C4   C -36.990   2.050 29.380 . . . 1.0 . . . . . . . . . . . . A . 17 G C4   . . . . . . . . . rr_2l5z 1 
       .  7 .  5584 . 1 1 17 G C4'  C -36.788   3.313 24.860 . . . 1.0 . . . . . . . . . . . . A . 17 G C4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5585 . 1 1 17 G C5   C -35.839   1.460 29.883 . . . 1.0 . . . . . . . . . . . . A . 17 G C5   . . . . . . . . . rr_2l5z 1 
       .  7 .  5586 . 1 1 17 G C5'  C -35.679   2.729 23.985 . . . 1.0 . . . . . . . . . . . . A . 17 G C5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5587 . 1 1 17 G C6   C -35.790   1.079 31.251 . . . 1.0 . . . . . . . . . . . . A . 17 G C6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5588 . 1 1 17 G C8   C -35.476   1.850 27.857 . . . 1.0 . . . . . . . . . . . . A . 17 G C8   . . . . . . . . . rr_2l5z 1 
       .  7 .  5589 . 1 1 17 G H1   H -37.018   1.127 32.912 . . . 1.0 . . . . . . . . . . . . A . 17 G H1   . . . . . . . . . rr_2l5z 1 
       .  7 .  5590 . 1 1 17 G H1'  H -38.635   2.767 27.297 . . . 1.0 . . . . . . . . . . . . A . 17 G H1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5591 . 1 1 17 G H2'  H -36.846   4.782 27.815 . . . 1.0 . . . . . . . . . . . . A . 17 G H2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5592 . 1 1 17 G H21  H -39.090   1.901 33.090 . . . 1.0 . . . . . . . . . . . . A . 17 G H21  . . . . . . . . . rr_2l5z 1 
       .  7 .  5593 . 1 1 17 G H22  H -39.969   2.602 31.751 . . . 1.0 . . . . . . . . . . . . A . 17 G H22  . . . . . . . . . rr_2l5z 1 
       .  7 .  5594 . 1 1 17 G H3'  H -35.261   4.208 26.143 . . . 1.0 . . . . . . . . . . . . A . 17 G H3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5595 . 1 1 17 G H4'  H -37.579   3.714 24.231 . . . 1.0 . . . . . . . . . . . . A . 17 G H4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5596 . 1 1 17 G H5'  H -35.366   3.479 23.257 . . . 1.0 . . . . . . . . . . . . A . 17 G H5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5597 . 1 1 17 G H5'' H -34.828   2.468 24.614 . . . 1.0 . . . . . . . . . . . . A . 17 G H5'' . . . . . . . . . rr_2l5z 1 
       .  7 .  5598 . 1 1 17 G H8   H -35.000   1.917 26.890 . . . 1.0 . . . . . . . . . . . . A . 17 G H8   . . . . . . . . . rr_2l5z 1 
       .  7 .  5599 . 1 1 17 G HO2' H -38.727   5.646 27.315 . . . 1.0 . . . . . . . . . . . . A . 17 G HO2' . . . . . . . . . rr_2l5z 1 
       .  7 .  5600 . 1 1 17 G N1   N -36.978   1.379 31.905 . . . 1.0 . . . . . . . . . . . . A . 17 G N1   . . . . . . . . . rr_2l5z 1 
       .  7 .  5601 . 1 1 17 G N2   N -39.132   2.174 32.119 . . . 1.0 . . . . . . . . . . . . A . 17 G N2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5602 . 1 1 17 G N3   N -38.138   2.332 30.036 . . . 1.0 . . . . . . . . . . . . A . 17 G N3   . . . . . . . . . rr_2l5z 1 
       .  7 .  5603 . 1 1 17 G N7   N -34.866   1.339 28.876 . . . 1.0 . . . . . . . . . . . . A . 17 G N7   . . . . . . . . . rr_2l5z 1 
       .  7 .  5604 . 1 1 17 G N9   N -36.730   2.296 28.058 . . . 1.0 . . . . . . . . . . . . A . 17 G N9   . . . . . . . . . rr_2l5z 1 
       .  7 .  5605 . 1 1 17 G O2'  O -38.464   5.143 26.541 . . . 1.0 . . . . . . . . . . . . A . 17 G O2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5606 . 1 1 17 G O3'  O -36.353   5.661 25.079 . . . 1.0 . . . . . . . . . . . . A . 17 G O3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5607 . 1 1 17 G O4'  O -37.341   2.327 25.736 . . . 1.0 . . . . . . . . . . . . A . 17 G O4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5608 . 1 1 17 G O5'  O -36.118   1.560 23.289 . . . 1.0 . . . . . . . . . . . . A . 17 G O5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5609 . 1 1 17 G O6   O -34.864   0.548 31.863 . . . 1.0 . . . . . . . . . . . . A . 17 G O6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5610 . 1 1 17 G OP1  O -37.363   3.120 21.774 . . . 1.0 . . . . . . . . . . . . A . 17 G OP1  . . . . . . . . . rr_2l5z 1 
       .  7 .  5611 . 1 1 17 G OP2  O -36.381   0.929 20.879 . . . 1.0 . . . . . . . . . . . . A . 17 G OP2  . . . . . . . . . rr_2l5z 1 
       .  7 .  5612 . 1 1 17 G P    P -37.030   1.691 21.968 . . . 1.0 . . . . . . . . . . . . A . 17 G P    . . . . . . . . . rr_2l5z 1 
       .  7 .  5613 . 1 1 18 U C1'  C -36.576   7.154 30.424 . . . 1.0 . . . . . . . . . . . . A . 18 U C1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5614 . 1 1 18 U C2   C -35.784   5.605 32.190 . . . 1.0 . . . . . . . . . . . . A . 18 U C2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5615 . 1 1 18 U C2'  C -35.827   8.471 30.678 . . . 1.0 . . . . . . . . . . . . A . 18 U C2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5616 . 1 1 18 U C3'  C -35.540   8.995 29.273 . . . 1.0 . . . . . . . . . . . . A . 18 U C3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5617 . 1 1 18 U C4   C -34.187   3.795 31.670 . . . 1.0 . . . . . . . . . . . . A . 18 U C4   . . . . . . . . . rr_2l5z 1 
       .  7 .  5618 . 1 1 18 U C4'  C -36.666   8.390 28.459 . . . 1.0 . . . . . . . . . . . . A . 18 U C4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5619 . 1 1 18 U C5   C -34.215   4.264 30.303 . . . 1.0 . . . . . . . . . . . . A . 18 U C5   . . . . . . . . . rr_2l5z 1 
       .  7 .  5620 . 1 1 18 U C5'  C -36.325   8.317 26.973 . . . 1.0 . . . . . . . . . . . . A . 18 U C5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5621 . 1 1 18 U C6   C -34.979   5.323 29.942 . . . 1.0 . . . . . . . . . . . . A . 18 U C6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5622 . 1 1 18 U H1'  H -37.527   7.169 30.961 . . . 1.0 . . . . . . . . . . . . A . 18 U H1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5623 . 1 1 18 U H2'  H -34.888   8.269 31.201 . . . 1.0 . . . . . . . . . . . . A . 18 U H2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5624 . 1 1 18 U H3   H -35.007   4.223 33.527 . . . 1.0 . . . . . . . . . . . . A . 18 U H3   . . . . . . . . . rr_2l5z 1 
       .  7 .  5625 . 1 1 18 U H3'  H -34.555   8.684 28.915 . . . 1.0 . . . . . . . . . . . . A . 18 U H3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5626 . 1 1 18 U H4'  H -37.574   8.973 28.597 . . . 1.0 . . . . . . . . . . . . A . 18 U H4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5627 . 1 1 18 U H5   H -33.617   3.762 29.556 . . . 1.0 . . . . . . . . . . . . A . 18 U H5   . . . . . . . . . rr_2l5z 1 
       .  7 .  5628 . 1 1 18 U H5'  H -37.234   8.112 26.408 . . . 1.0 . . . . . . . . . . . . A . 18 U H5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5629 . 1 1 18 U H5'' H -35.915   9.275 26.654 . . . 1.0 . . . . . . . . . . . . A . 18 U H5'' . . . . . . . . . rr_2l5z 1 
       .  7 .  5630 . 1 1 18 U H6   H -34.967   5.656 28.916 . . . 1.0 . . . . . . . . . . . . A . 18 U H6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5631 . 1 1 18 U HO2' H -37.471   8.960 31.597 . . . 1.0 . . . . . . . . . . . . A . 18 U HO2' . . . . . . . . . rr_2l5z 1 
       .  7 .  5632 . 1 1 18 U N1   N -35.754   5.989 30.852 . . . 1.0 . . . . . . . . . . . . A . 18 U N1   . . . . . . . . . rr_2l5z 1 
       .  7 .  5633 . 1 1 18 U N3   N -34.993   4.520 32.531 . . . 1.0 . . . . . . . . . . . . A . 18 U N3   . . . . . . . . . rr_2l5z 1 
       .  7 .  5634 . 1 1 18 U O2   O -36.472   6.191 33.022 . . . 1.0 . . . . . . . . . . . . A . 18 U O2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5635 . 1 1 18 U O2'  O -36.633   9.392 31.421 . . . 1.0 . . . . . . . . . . . . A . 18 U O2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5636 . 1 1 18 U O3'  O -35.692  10.417 29.277 . . . 1.0 . . . . . . . . . . . . A . 18 U O3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5637 . 1 1 18 U O4   O -33.527   2.845 32.081 . . . 1.0 . . . . . . . . . . . . A . 18 U O4   . . . . . . . . . rr_2l5z 1 
       .  7 .  5638 . 1 1 18 U O4'  O -36.849   7.097 29.015 . . . 1.0 . . . . . . . . . . . . A . 18 U O4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5639 . 1 1 18 U O5'  O -35.368   7.290 26.705 . . . 1.0 . . . . . . . . . . . . A . 18 U O5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5640 . 1 1 18 U OP1  O -35.445   7.849 24.265 . . . 1.0 . . . . . . . . . . . . A . 18 U OP1  . . . . . . . . . rr_2l5z 1 
       .  7 .  5641 . 1 1 18 U OP2  O -33.874   6.024 25.145 . . . 1.0 . . . . . . . . . . . . A . 18 U OP2  . . . . . . . . . rr_2l5z 1 
       .  7 .  5642 . 1 1 18 U P    P -35.168   6.741 25.207 . . . 1.0 . . . . . . . . . . . . A . 18 U P    . . . . . . . . . rr_2l5z 1 
       .  7 .  5643 . 1 1 19 G C1'  C -34.245   9.750 34.639 . . . 1.0 . . . . . . . . . . . . A . 19 G C1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5644 . 1 1 19 G C2   C -32.096   6.642 36.941 . . . 1.0 . . . . . . . . . . . . A . 19 G C2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5645 . 1 1 19 G C2'  C -33.593  11.070 35.068 . . . 1.0 . . . . . . . . . . . . A . 19 G C2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5646 . 1 1 19 G C3'  C -33.867  11.992 33.889 . . . 1.0 . . . . . . . . . . . . A . 19 G C3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5647 . 1 1 19 G C4   C -32.616   7.813 35.115 . . . 1.0 . . . . . . . . . . . . A . 19 G C4   . . . . . . . . . rr_2l5z 1 
       .  7 .  5648 . 1 1 19 G C4'  C -35.173  11.447 33.336 . . . 1.0 . . . . . . . . . . . . A . 19 G C4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5649 . 1 1 19 G C5   C -31.738   7.120 34.293 . . . 1.0 . . . . . . . . . . . . A . 19 G C5   . . . . . . . . . rr_2l5z 1 
       .  7 .  5650 . 1 1 19 G C5'  C -35.378  11.832 31.872 . . . 1.0 . . . . . . . . . . . . A . 19 G C5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5651 . 1 1 19 G C6   C -30.949   6.073 34.839 . . . 1.0 . . . . . . . . . . . . A . 19 G C6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5652 . 1 1 19 G C8   C -32.682   8.551 33.090 . . . 1.0 . . . . . . . . . . . . A . 19 G C8   . . . . . . . . . rr_2l5z 1 
       .  7 .  5653 . 1 1 19 G H1   H -30.656   5.152 36.668 . . . 1.0 . . . . . . . . . . . . A . 19 G H1   . . . . . . . . . rr_2l5z 1 
       .  7 .  5654 . 1 1 19 G H1'  H -34.867   9.374 35.451 . . . 1.0 . . . . . . . . . . . . A . 19 G H1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5655 . 1 1 19 G H2'  H -32.515  10.931 35.191 . . . 1.0 . . . . . . . . . . . . A . 19 G H2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5656 . 1 1 19 G H21  H -31.630   5.580 38.614 . . . 1.0 . . . . . . . . . . . . A . 19 G H21  . . . . . . . . . rr_2l5z 1 
       .  7 .  5657 . 1 1 19 G H22  H -32.834   6.829 38.829 . . . 1.0 . . . . . . . . . . . . A . 19 G H22  . . . . . . . . . rr_2l5z 1 
       .  7 .  5658 . 1 1 19 G H3'  H -33.060  11.962 33.153 . . . 1.0 . . . . . . . . . . . . A . 19 G H3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5659 . 1 1 19 G H4'  H -36.005  11.820 33.932 . . . 1.0 . . . . . . . . . . . . A . 19 G H4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5660 . 1 1 19 G H5'  H -36.275  11.338 31.498 . . . 1.0 . . . . . . . . . . . . A . 19 G H5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5661 . 1 1 19 G H5'' H -35.513  12.912 31.805 . . . 1.0 . . . . . . . . . . . . A . 19 G H5'' . . . . . . . . . rr_2l5z 1 
       .  7 .  5662 . 1 1 19 G H8   H -32.978   9.152 32.243 . . . 1.0 . . . . . . . . . . . . A . 19 G H8   . . . . . . . . . rr_2l5z 1 
       .  7 .  5663 . 1 1 19 G HO2' H -34.498  10.820 36.773 . . . 1.0 . . . . . . . . . . . . A . 19 G HO2' . . . . . . . . . rr_2l5z 1 
       .  7 .  5664 . 1 1 19 G N1   N -31.199   5.902 36.196 . . . 1.0 . . . . . . . . . . . . A . 19 G N1   . . . . . . . . . rr_2l5z 1 
       .  7 .  5665 . 1 1 19 G N2   N -32.195   6.325 38.232 . . . 1.0 . . . . . . . . . . . . A . 19 G N2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5666 . 1 1 19 G N3   N -32.844   7.629 36.434 . . . 1.0 . . . . . . . . . . . . A . 19 G N3   . . . . . . . . . rr_2l5z 1 
       .  7 .  5667 . 1 1 19 G N7   N -31.796   7.616 32.979 . . . 1.0 . . . . . . . . . . . . A . 19 G N7   . . . . . . . . . rr_2l5z 1 
       .  7 .  5668 . 1 1 19 G N9   N -33.220   8.741 34.308 . . . 1.0 . . . . . . . . . . . . A . 19 G N9   . . . . . . . . . rr_2l5z 1 
       .  7 .  5669 . 1 1 19 G O2'  O -34.182  11.575 36.272 . . . 1.0 . . . . . . . . . . . . A . 19 G O2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5670 . 1 1 19 G O3'  O -34.099  13.312 34.386 . . . 1.0 . . . . . . . . . . . . A . 19 G O3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5671 . 1 1 19 G O4'  O -35.075  10.036 33.500 . . . 1.0 . . . . . . . . . . . . A . 19 G O4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5672 . 1 1 19 G O5'  O -34.264  11.449 31.064 . . . 1.0 . . . . . . . . . . . . A . 19 G O5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5673 . 1 1 19 G O6   O -30.129   5.356 34.268 . . . 1.0 . . . . . . . . . . . . A . 19 G O6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5674 . 1 1 19 G OP1  O -34.760  12.722 28.965 . . . 1.0 . . . . . . . . . . . . A . 19 G OP1  . . . . . . . . . rr_2l5z 1 
       .  7 .  5675 . 1 1 19 G OP2  O -33.225  10.671 28.922 . . . 1.0 . . . . . . . . . . . . A . 19 G OP2  . . . . . . . . . rr_2l5z 1 
       .  7 .  5676 . 1 1 19 G P    P -34.409  11.373 29.464 . . . 1.0 . . . . . . . . . . . . A . 19 G P    . . . . . . . . . rr_2l5z 1 
       .  7 .  5677 . 1 1 20 A C1'  C -30.811  11.520 38.322 . . . 1.0 . . . . . . . . . . . . A . 20 A C1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5678 . 1 1 20 A C2   C -27.791   8.319 38.697 . . . 1.0 . . . . . . . . . . . . A . 20 A C2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5679 . 1 1 20 A C2'  C -30.174  12.799 38.881 . . . 1.0 . . . . . . . . . . . . A . 20 A C2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5680 . 1 1 20 A C3'  C -31.019  13.914 38.270 . . . 1.0 . . . . . . . . . . . . A . 20 A C3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5681 . 1 1 20 A C4   C -28.987   9.838 37.634 . . . 1.0 . . . . . . . . . . . . A . 20 A C4   . . . . . . . . . rr_2l5z 1 
       .  7 .  5682 . 1 1 20 A C4'  C -32.358  13.234 38.026 . . . 1.0 . . . . . . . . . . . . A . 20 A C4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5683 . 1 1 20 A C5   C -28.399   9.563 36.420 . . . 1.0 . . . . . . . . . . . . A . 20 A C5   . . . . . . . . . rr_2l5z 1 
       .  7 .  5684 . 1 1 20 A C5'  C -33.166  13.935 36.934 . . . 1.0 . . . . . . . . . . . . A . 20 A C5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5685 . 1 1 20 A C6   C -27.423   8.561 36.413 . . . 1.0 . . . . . . . . . . . . A . 20 A C6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5686 . 1 1 20 A C8   C -29.789  11.090 36.075 . . . 1.0 . . . . . . . . . . . . A . 20 A C8   . . . . . . . . . rr_2l5z 1 
       .  7 .  5687 . 1 1 20 A H1'  H -31.052  10.848 39.145 . . . 1.0 . . . . . . . . . . . . A . 20 A H1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5688 . 1 1 20 A H2   H -27.518   7.788 39.608 . . . 1.0 . . . . . . . . . . . . A . 20 A H2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5689 . 1 1 20 A H2'  H -29.137  12.881 38.538 . . . 1.0 . . . . . . . . . . . . A . 20 A H2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5690 . 1 1 20 A H3'  H -30.575  14.305 37.350 . . . 1.0 . . . . . . . . . . . . A . 20 A H3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5691 . 1 1 20 A H4'  H -32.932  13.217 38.950 . . . 1.0 . . . . . . . . . . . . A . 20 A H4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5692 . 1 1 20 A H5'  H -33.929  13.250 36.563 . . . 1.0 . . . . . . . . . . . . A . 20 A H5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5693 . 1 1 20 A H5'' H -33.653  14.812 37.360 . . . 1.0 . . . . . . . . . . . . A . 20 A H5'' . . . . . . . . . rr_2l5z 1 
       .  7 .  5694 . 1 1 20 A H61  H -26.074   7.456 35.362 . . . 1.0 . . . . . . . . . . . . A . 20 A H61  . . . . . . . . . rr_2l5z 1 
       .  7 .  5695 . 1 1 20 A H62  H -26.973   8.632 34.430 . . . 1.0 . . . . . . . . . . . . A . 20 A H62  . . . . . . . . . rr_2l5z 1 
       .  7 .  5696 . 1 1 20 A H8   H -30.391  11.846 35.595 . . . 1.0 . . . . . . . . . . . . A . 20 A H8   . . . . . . . . . rr_2l5z 1 
       .  7 .  5697 . 1 1 20 A HO2' H -31.161  12.923 40.555 . . . 1.0 . . . . . . . . . . . . A . 20 A HO2' . . . . . . . . . rr_2l5z 1 
       .  7 .  5698 . 1 1 20 A N1   N -27.146   7.958 37.585 . . . 1.0 . . . . . . . . . . . . A . 20 A N1   . . . . . . . . . rr_2l5z 1 
       .  7 .  5699 . 1 1 20 A N3   N -28.729   9.252 38.817 . . . 1.0 . . . . . . . . . . . . A . 20 A N3   . . . . . . . . . rr_2l5z 1 
       .  7 .  5700 . 1 1 20 A N6   N -26.770   8.186 35.313 . . . 1.0 . . . . . . . . . . . . A . 20 A N6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5701 . 1 1 20 A N7   N -28.930  10.386 35.411 . . . 1.0 . . . . . . . . . . . . A . 20 A N7   . . . . . . . . . rr_2l5z 1 
       .  7 .  5702 . 1 1 20 A N9   N -29.893  10.837 37.392 . . . 1.0 . . . . . . . . . . . . A . 20 A N9   . . . . . . . . . rr_2l5z 1 
       .  7 .  5703 . 1 1 20 A O2'  O -30.237  12.827 40.312 . . . 1.0 . . . . . . . . . . . . A . 20 A O2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5704 . 1 1 20 A O3'  O -31.207  14.933 39.256 . . . 1.0 . . . . . . . . . . . . A . 20 A O3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5705 . 1 1 20 A O4'  O -32.024  11.902 37.657 . . . 1.0 . . . . . . . . . . . . A . 20 A O4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5706 . 1 1 20 A O5'  O -32.336  14.346 35.844 . . . 1.0 . . . . . . . . . . . . A . 20 A O5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5707 . 1 1 20 A OP1  O -33.550  15.745 34.158 . . . 1.0 . . . . . . . . . . . . A . 20 A OP1  . . . . . . . . . rr_2l5z 1 
       .  7 .  5708 . 1 1 20 A OP2  O -31.880  13.950 33.413 . . . 1.0 . . . . . . . . . . . . A . 20 A OP2  . . . . . . . . . rr_2l5z 1 
       .  7 .  5709 . 1 1 20 A P    P -32.928  14.416 34.350 . . . 1.0 . . . . . . . . . . . . A . 20 A P    . . . . . . . . . rr_2l5z 1 
       .  7 .  5710 . 1 1 21 C C1'  C -25.310  13.172 38.351 . . . 1.0 . . . . . . . . . . . . A . 21 C C1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5711 . 1 1 21 C C2   C -24.157  11.409 37.088 . . . 1.0 . . . . . . . . . . . . A . 21 C C2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5712 . 1 1 21 C C2'  C -24.393  14.367 38.049 . . . 1.0 . . . . . . . . . . . . A . 21 C C2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5713 . 1 1 21 C C3'  C -25.360  15.541 37.932 . . . 1.0 . . . . . . . . . . . . A . 21 C C3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5714 . 1 1 21 C C4   C -25.104  10.472 35.155 . . . 1.0 . . . . . . . . . . . . A . 21 C C4   . . . . . . . . . rr_2l5z 1 
       .  7 .  5715 . 1 1 21 C C4'  C -26.532  15.098 38.791 . . . 1.0 . . . . . . . . . . . . A . 21 C C4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5716 . 1 1 21 C C5   C -26.271  11.287 35.297 . . . 1.0 . . . . . . . . . . . . A . 21 C C5   . . . . . . . . . rr_2l5z 1 
       .  7 .  5717 . 1 1 21 C C5'  C -27.828  15.821 38.418 . . . 1.0 . . . . . . . . . . . . A . 21 C C5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5718 . 1 1 21 C C6   C -26.322  12.134 36.343 . . . 1.0 . . . . . . . . . . . . A . 21 C C6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5719 . 1 1 21 C H1'  H -24.974  12.679 39.266 . . . 1.0 . . . . . . . . . . . . A . 21 C H1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5720 . 1 1 21 C H2'  H -23.878  14.211 37.095 . . . 1.0 . . . . . . . . . . . . A . 21 C H2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5721 . 1 1 21 C H3'  H -25.657  15.727 36.897 . . . 1.0 . . . . . . . . . . . . A . 21 C H3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5722 . 1 1 21 C H4'  H -26.304  15.274 39.841 . . . 1.0 . . . . . . . . . . . . A . 21 C H4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5723 . 1 1 21 C H41  H -24.183   9.053 34.028 . . . 1.0 . . . . . . . . . . . . A . 21 C H41  . . . . . . . . . rr_2l5z 1 
       .  7 .  5724 . 1 1 21 C H42  H -25.754   9.566 33.455 . . . 1.0 . . . . . . . . . . . . A . 21 C H42  . . . . . . . . . rr_2l5z 1 
       .  7 .  5725 . 1 1 21 C H5   H -27.084  11.223 34.589 . . . 1.0 . . . . . . . . . . . . A . 21 C H5   . . . . . . . . . rr_2l5z 1 
       .  7 .  5726 . 1 1 21 C H5'  H -27.621  16.884 38.277 . . . 1.0 . . . . . . . . . . . . A . 21 C H5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5727 . 1 1 21 C H5'' H -28.213  15.406 37.487 . . . 1.0 . . . . . . . . . . . . A . 21 C H5'' . . . . . . . . . rr_2l5z 1 
       .  7 .  5728 . 1 1 21 C H6   H -27.189  12.763 36.481 . . . 1.0 . . . . . . . . . . . . A . 21 C H6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5729 . 1 1 21 C HO2' H -23.251  13.718 39.485 . . . 1.0 . . . . . . . . . . . . A . 21 C HO2' . . . . . . . . . rr_2l5z 1 
       .  7 .  5730 . 1 1 21 C N1   N -25.288  12.205 37.228 . . . 1.0 . . . . . . . . . . . . A . 21 C N1   . . . . . . . . . rr_2l5z 1 
       .  7 .  5731 . 1 1 21 C N3   N -24.099  10.550 36.035 . . . 1.0 . . . . . . . . . . . . A . 21 C N3   . . . . . . . . . rr_2l5z 1 
       .  7 .  5732 . 1 1 21 C N4   N -25.006   9.629 34.130 . . . 1.0 . . . . . . . . . . . . A . 21 C N4   . . . . . . . . . rr_2l5z 1 
       .  7 .  5733 . 1 1 21 C O2   O -23.240  11.489 37.903 . . . 1.0 . . . . . . . . . . . . A . 21 C O2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5734 . 1 1 21 C O2'  O -23.448  14.576 39.104 . . . 1.0 . . . . . . . . . . . . A . 21 C O2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5735 . 1 1 21 C O3'  O -24.753  16.685 38.535 . . . 1.0 . . . . . . . . . . . . A . 21 C O3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5736 . 1 1 21 C O4'  O -26.629  13.697 38.561 . . . 1.0 . . . . . . . . . . . . A . 21 C O4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5737 . 1 1 21 C O5'  O -28.817  15.674 39.440 . . . 1.0 . . . . . . . . . . . . A . 21 C O5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5738 . 1 1 21 C OP1  O -30.645  17.077 40.423 . . . 1.0 . . . . . . . . . . . . A . 21 C OP1  . . . . . . . . . rr_2l5z 1 
       .  7 .  5739 . 1 1 21 C OP2  O -30.381  16.859 37.883 . . . 1.0 . . . . . . . . . . . . A . 21 C OP2  . . . . . . . . . rr_2l5z 1 
       .  7 .  5740 . 1 1 21 C P    P -30.301  16.263 39.235 . . . 1.0 . . . . . . . . . . . . A . 21 C P    . . . . . . . . . rr_2l5z 1 
       .  7 .  5741 . 1 1 22 G C1'  C -19.891  14.345 39.919 . . . 1.0 . . . . . . . . . . . . A . 22 G C1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5742 . 1 1 22 G C2   C -17.628  11.193 37.790 . . . 1.0 . . . . . . . . . . . . A . 22 G C2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5743 . 1 1 22 G C2'  C -18.737  15.343 39.879 . . . 1.0 . . . . . . . . . . . . A . 22 G C2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5744 . 1 1 22 G C3'  C -19.458  16.621 39.505 . . . 1.0 . . . . . . . . . . . . A . 22 G C3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5745 . 1 1 22 G C4   C -19.255  12.696 38.047 . . . 1.0 . . . . . . . . . . . . A . 22 G C4   . . . . . . . . . rr_2l5z 1 
       .  7 .  5746 . 1 1 22 G C4'  C -20.742  16.495 40.305 . . . 1.0 . . . . . . . . . . . . A . 22 G C4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5747 . 1 1 22 G C5   C -19.815  12.457 36.800 . . . 1.0 . . . . . . . . . . . . A . 22 G C5   . . . . . . . . . rr_2l5z 1 
       .  7 .  5748 . 1 1 22 G C5'  C -21.857  17.367 39.731 . . . 1.0 . . . . . . . . . . . . A . 22 G C5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5749 . 1 1 22 G C6   C -19.231  11.484 35.946 . . . 1.0 . . . . . . . . . . . . A . 22 G C6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5750 . 1 1 22 G C8   C -20.975  13.946 37.704 . . . 1.0 . . . . . . . . . . . . A . 22 G C8   . . . . . . . . . rr_2l5z 1 
       .  7 .  5751 . 1 1 22 G H1   H -17.619  10.196 35.951 . . . 1.0 . . . . . . . . . . . . A . 22 G H1   . . . . . . . . . rr_2l5z 1 
       .  7 .  5752 . 1 1 22 G H1'  H -19.712  13.603 40.694 . . . 1.0 . . . . . . . . . . . . A . 22 G H1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5753 . 1 1 22 G H2'  H -18.026  15.066 39.097 . . . 1.0 . . . . . . . . . . . . A . 22 G H2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5754 . 1 1 22 G H21  H -16.138   9.823 37.563 . . . 1.0 . . . . . . . . . . . . A . 22 G H21  . . . . . . . . . rr_2l5z 1 
       .  7 .  5755 . 1 1 22 G H22  H -16.141  10.687 39.085 . . . 1.0 . . . . . . . . . . . . A . 22 G H22  . . . . . . . . . rr_2l5z 1 
       .  7 .  5756 . 1 1 22 G H3'  H -19.646  16.683 38.432 . . . 1.0 . . . . . . . . . . . . A . 22 G H3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5757 . 1 1 22 G H4'  H -20.557  16.774 41.341 . . . 1.0 . . . . . . . . . . . . A . 22 G H4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5758 . 1 1 22 G H5'  H -22.721  17.320 40.394 . . . 1.0 . . . . . . . . . . . . A . 22 G H5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5759 . 1 1 22 G H5'' H -21.508  18.397 39.674 . . . 1.0 . . . . . . . . . . . . A . 22 G H5'' . . . . . . . . . rr_2l5z 1 
       .  7 .  5760 . 1 1 22 G H8   H -21.725  14.699 37.884 . . . 1.0 . . . . . . . . . . . . A . 22 G H8   . . . . . . . . . rr_2l5z 1 
       .  7 .  5761 . 1 1 22 G HO2' H -18.676  15.062 41.804 . . . 1.0 . . . . . . . . . . . . A . 22 G HO2' . . . . . . . . . rr_2l5z 1 
       .  7 .  5762 . 1 1 22 G N1   N -18.119  10.894 36.533 . . . 1.0 . . . . . . . . . . . . A . 22 G N1   . . . . . . . . . rr_2l5z 1 
       .  7 .  5763 . 1 1 22 G N2   N -16.548  10.513 38.178 . . . 1.0 . . . . . . . . . . . . A . 22 G N2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5764 . 1 1 22 G N3   N -18.172  12.105 38.601 . . . 1.0 . . . . . . . . . . . . A . 22 G N3   . . . . . . . . . rr_2l5z 1 
       .  7 .  5765 . 1 1 22 G N7   N -20.935  13.280 36.597 . . . 1.0 . . . . . . . . . . . . A . 22 G N7   . . . . . . . . . rr_2l5z 1 
       .  7 .  5766 . 1 1 22 G N9   N -20.030  13.671 38.616 . . . 1.0 . . . . . . . . . . . . A . 22 G N9   . . . . . . . . . rr_2l5z 1 
       .  7 .  5767 . 1 1 22 G O2'  O -18.091  15.454 41.153 . . . 1.0 . . . . . . . . . . . . A . 22 G O2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5768 . 1 1 22 G O3'  O -18.707  17.736 39.994 . . . 1.0 . . . . . . . . . . . . A . 22 G O3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5769 . 1 1 22 G O4'  O -21.072  15.103 40.245 . . . 1.0 . . . . . . . . . . . . A . 22 G O4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5770 . 1 1 22 G O5'  O -22.251  16.935 38.426 . . . 1.0 . . . . . . . . . . . . A . 22 G O5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5771 . 1 1 22 G O6   O -19.592  11.136 34.823 . . . 1.0 . . . . . . . . . . . . A . 22 G O6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5772 . 1 1 22 G OP1  O -23.729  18.933 38.110 . . . 1.0 . . . . . . . . . . . . A . 22 G OP1  . . . . . . . . . rr_2l5z 1 
       .  7 .  5773 . 1 1 22 G OP2  O -23.623  17.088 36.336 . . . 1.0 . . . . . . . . . . . . A . 22 G OP2  . . . . . . . . . rr_2l5z 1 
       .  7 .  5774 . 1 1 22 G P    P -23.602  17.502 37.757 . . . 1.0 . . . . . . . . . . . . A . 22 G P    . . . . . . . . . rr_2l5z 1 
       .  7 .  5775 . 1 1 23 G C1'  C -15.133  14.550 37.132 . . . 1.0 . . . . . . . . . . . . A . 23 G C1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5776 . 1 1 23 G C2   C -15.520  12.070 33.490 . . . 1.0 . . . . . . . . . . . . A . 23 G C2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5777 . 1 1 23 G C2'  C -13.963  15.342 36.548 . . . 1.0 . . . . . . . . . . . . A . 23 G C2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5778 . 1 1 23 G C3'  C -14.230  16.740 37.074 . . . 1.0 . . . . . . . . . . . . A . 23 G C3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5779 . 1 1 23 G C4   C -16.202  13.552 35.011 . . . 1.0 . . . . . . . . . . . . A . 23 G C4   . . . . . . . . . rr_2l5z 1 
       .  7 .  5780 . 1 1 23 G C4'  C -14.794  16.449 38.450 . . . 1.0 . . . . . . . . . . . . A . 23 G C4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5781 . 1 1 23 G C5   C -17.434  13.762 34.409 . . . 1.0 . . . . . . . . . . . . A . 23 G C5   . . . . . . . . . rr_2l5z 1 
       .  7 .  5782 . 1 1 23 G C5'  C -15.584  17.636 38.999 . . . 1.0 . . . . . . . . . . . . A . 23 G C5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5783 . 1 1 23 G C6   C -17.759  13.057 33.219 . . . 1.0 . . . . . . . . . . . . A . 23 G C6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5784 . 1 1 23 G C8   C -17.380  14.988 36.107 . . . 1.0 . . . . . . . . . . . . A . 23 G C8   . . . . . . . . . rr_2l5z 1 
       .  7 .  5785 . 1 1 23 G H1   H -16.886  11.664 31.959 . . . 1.0 . . . . . . . . . . . . A . 23 G H1   . . . . . . . . . rr_2l5z 1 
       .  7 .  5786 . 1 1 23 G H1'  H -14.784  13.573 37.468 . . . 1.0 . . . . . . . . . . . . A . 23 G H1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5787 . 1 1 23 G H2'  H -14.012  15.332 35.458 . . . 1.0 . . . . . . . . . . . . A . 23 G H2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5788 . 1 1 23 G H21  H -14.886  10.719 32.104 . . . 1.0 . . . . . . . . . . . . A . 23 G H21  . . . . . . . . . rr_2l5z 1 
       .  7 .  5789 . 1 1 23 G H22  H -13.750  11.069 33.389 . . . 1.0 . . . . . . . . . . . . A . 23 G H22  . . . . . . . . . rr_2l5z 1 
       .  7 .  5790 . 1 1 23 G H3'  H -14.939  17.283 36.448 . . . 1.0 . . . . . . . . . . . . A . 23 G H3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5791 . 1 1 23 G H4'  H -13.983  16.202 39.133 . . . 1.0 . . . . . . . . . . . . A . 23 G H4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5792 . 1 1 23 G H5'  H -15.779  17.472 40.060 . . . 1.0 . . . . . . . . . . . . A . 23 G H5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5793 . 1 1 23 G H5'' H -14.987  18.541 38.884 . . . 1.0 . . . . . . . . . . . . A . 23 G H5'' . . . . . . . . . rr_2l5z 1 
       .  7 .  5794 . 1 1 23 G H8   H -17.648  15.704 36.869 . . . 1.0 . . . . . . . . . . . . A . 23 G H8   . . . . . . . . . rr_2l5z 1 
       .  7 .  5795 . 1 1 23 G HO2' H -12.745  13.880 36.962 . . . 1.0 . . . . . . . . . . . . A . 23 G HO2' . . . . . . . . . rr_2l5z 1 
       .  7 .  5796 . 1 1 23 G N1   N -16.722  12.217 32.825 . . . 1.0 . . . . . . . . . . . . A . 23 G N1   . . . . . . . . . rr_2l5z 1 
       .  7 .  5797 . 1 1 23 G N2   N -14.648  11.217 32.951 . . . 1.0 . . . . . . . . . . . . A . 23 G N2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5798 . 1 1 23 G N3   N -15.207  12.729 34.610 . . . 1.0 . . . . . . . . . . . . A . 23 G N3   . . . . . . . . . rr_2l5z 1 
       .  7 .  5799 . 1 1 23 G N7   N -18.186  14.700 35.137 . . . 1.0 . . . . . . . . . . . . A . 23 G N7   . . . . . . . . . rr_2l5z 1 
       .  7 .  5800 . 1 1 23 G N9   N -16.189  14.363 36.117 . . . 1.0 . . . . . . . . . . . . A . 23 G N9   . . . . . . . . . rr_2l5z 1 
       .  7 .  5801 . 1 1 23 G O2'  O -12.704  14.838 37.011 . . . 1.0 . . . . . . . . . . . . A . 23 G O2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5802 . 1 1 23 G O3'  O -12.984  17.428 37.213 . . . 1.0 . . . . . . . . . . . . A . 23 G O3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5803 . 1 1 23 G O4'  O -15.619  15.299 38.262 . . . 1.0 . . . . . . . . . . . . A . 23 G O4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5804 . 1 1 23 G O5'  O -16.828  17.811 38.319 . . . 1.0 . . . . . . . . . . . . A . 23 G O5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5805 . 1 1 23 G O6   O -18.792  13.113 32.555 . . . 1.0 . . . . . . . . . . . . A . 23 G O6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5806 . 1 1 23 G OP1  O -17.332  19.813 39.737 . . . 1.0 . . . . . . . . . . . . A . 23 G OP1  . . . . . . . . . rr_2l5z 1 
       .  7 .  5807 . 1 1 23 G OP2  O -18.948  19.077 37.891 . . . 1.0 . . . . . . . . . . . . A . 23 G OP2  . . . . . . . . . rr_2l5z 1 
       .  7 .  5808 . 1 1 23 G P    P -17.982  18.735 38.960 . . . 1.0 . . . . . . . . . . . . A . 23 G P    . . . . . . . . . rr_2l5z 1 
       .  7 .  5809 . 1 1 24 C C1'  C -12.312  15.287 31.999 . . . 1.0 . . . . . . . . . . . . A . 24 C C1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5810 . 1 1 24 C C2   C -14.402  14.646 30.818 . . . 1.0 . . . . . . . . . . . . A . 24 C C2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5811 . 1 1 24 C C2'  C -11.651  16.343 31.109 . . . 1.0 . . . . . . . . . . . . A . 24 C C2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5812 . 1 1 24 C C3'  C -11.230  17.412 32.104 . . . 1.0 . . . . . . . . . . . . A . 24 C C3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5813 . 1 1 24 C C4   C -16.487  15.448 31.540 . . . 1.0 . . . . . . . . . . . . A . 24 C C4   . . . . . . . . . rr_2l5z 1 
       .  7 .  5814 . 1 1 24 C C4'  C -10.919  16.596 33.344 . . . 1.0 . . . . . . . . . . . . A . 24 C C4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5815 . 1 1 24 C C5   C -15.874  16.174 32.610 . . . 1.0 . . . . . . . . . . . . A . 24 C C5   . . . . . . . . . rr_2l5z 1 
       .  7 .  5816 . 1 1 24 C C5'  C -10.974  17.443 34.614 . . . 1.0 . . . . . . . . . . . . A . 24 C C5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5817 . 1 1 24 C C6   C -14.534  16.099 32.732 . . . 1.0 . . . . . . . . . . . . A . 24 C C6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5818 . 1 1 24 C H1'  H -11.944  14.294 31.722 . . . 1.0 . . . . . . . . . . . . A . 24 C H1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5819 . 1 1 24 C H2'  H -12.384  16.751 30.414 . . . 1.0 . . . . . . . . . . . . A . 24 C H2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5820 . 1 1 24 C H3'  H -12.023  18.140 32.279 . . . 1.0 . . . . . . . . . . . . A . 24 C H3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5821 . 1 1 24 C H4'  H  -9.934  16.143 33.248 . . . 1.0 . . . . . . . . . . . . A . 24 C H4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5822 . 1 1 24 C H41  H -18.246  14.984 30.629 . . . 1.0 . . . . . . . . . . . . A . 24 C H41  . . . . . . . . . rr_2l5z 1 
       .  7 .  5823 . 1 1 24 C H42  H -18.375  16.042 32.017 . . . 1.0 . . . . . . . . . . . . A . 24 C H42  . . . . . . . . . rr_2l5z 1 
       .  7 .  5824 . 1 1 24 C H5   H -16.465  16.761 33.296 . . . 1.0 . . . . . . . . . . . . A . 24 C H5   . . . . . . . . . rr_2l5z 1 
       .  7 .  5825 . 1 1 24 C H5'  H -10.677  16.828 35.464 . . . 1.0 . . . . . . . . . . . . A . 24 C H5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5826 . 1 1 24 C H5'' H -10.274  18.274 34.516 . . . 1.0 . . . . . . . . . . . . A . 24 C H5'' . . . . . . . . . rr_2l5z 1 
       .  7 .  5827 . 1 1 24 C H6   H -14.037  16.653 33.517 . . . 1.0 . . . . . . . . . . . . A . 24 C H6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5828 . 1 1 24 C HO2' H  -9.872  15.551 31.066 . . . 1.0 . . . . . . . . . . . . A . 24 C HO2' . . . . . . . . . rr_2l5z 1 
       .  7 .  5829 . 1 1 24 C N1   N -13.794  15.351 31.861 . . . 1.0 . . . . . . . . . . . . A . 24 C N1   . . . . . . . . . rr_2l5z 1 
       .  7 .  5830 . 1 1 24 C N3   N -15.753  14.720 30.690 . . . 1.0 . . . . . . . . . . . . A . 24 C N3   . . . . . . . . . rr_2l5z 1 
       .  7 .  5831 . 1 1 24 C N4   N -17.809  15.495 31.383 . . . 1.0 . . . . . . . . . . . . A . 24 C N4   . . . . . . . . . rr_2l5z 1 
       .  7 .  5832 . 1 1 24 C O2   O -13.718  13.986 30.037 . . . 1.0 . . . . . . . . . . . . A . 24 C O2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5833 . 1 1 24 C O2'  O -10.523  15.806 30.409 . . . 1.0 . . . . . . . . . . . . A . 24 C O2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5834 . 1 1 24 C O3'  O -10.025  18.023 31.633 . . . 1.0 . . . . . . . . . . . . A . 24 C O3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5835 . 1 1 24 C O4'  O -11.907  15.570 33.352 . . . 1.0 . . . . . . . . . . . . A . 24 C O4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5836 . 1 1 24 C O5'  O -12.284  17.963 34.851 . . . 1.0 . . . . . . . . . . . . A . 24 C O5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5837 . 1 1 24 C OP1  O -11.410  19.325 36.764 . . . 1.0 . . . . . . . . . . . . A . 24 C OP1  . . . . . . . . . rr_2l5z 1 
       .  7 .  5838 . 1 1 24 C OP2  O -13.871  19.472 36.068 . . . 1.0 . . . . . . . . . . . . A . 24 C OP2  . . . . . . . . . rr_2l5z 1 
       .  7 .  5839 . 1 1 24 C P    P -12.637  18.676 36.253 . . . 1.0 . . . . . . . . . . . . A . 24 C P    . . . . . . . . . rr_2l5z 1 
       .  7 .  5840 . 1 1 25 U C1'  C -11.668  16.267 26.532 . . . 1.0 . . . . . . . . . . . . A . 25 U C1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5841 . 1 1 25 U C2   C -14.150  16.047 26.441 . . . 1.0 . . . . . . . . . . . . A . 25 U C2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5842 . 1 1 25 U C2'  C -11.210  17.244 25.446 . . . 1.0 . . . . . . . . . . . . A . 25 U C2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5843 . 1 1 25 U C3'  C -10.377  18.235 26.235 . . . 1.0 . . . . . . . . . . . . A . 25 U C3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5844 . 1 1 25 U C4   C -15.595  17.405 27.909 . . . 1.0 . . . . . . . . . . . . A . 25 U C4   . . . . . . . . . rr_2l5z 1 
       .  7 .  5845 . 1 1 25 U C4'  C  -9.707  17.335 27.255 . . . 1.0 . . . . . . . . . . . . A . 25 U C4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5846 . 1 1 25 U C5   C -14.384  17.969 28.460 . . . 1.0 . . . . . . . . . . . . A . 25 U C5   . . . . . . . . . rr_2l5z 1 
       .  7 .  5847 . 1 1 25 U C5'  C  -9.238  18.113 28.483 . . . 1.0 . . . . . . . . . . . . A . 25 U C5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5848 . 1 1 25 U C6   C -13.165  17.576 28.014 . . . 1.0 . . . . . . . . . . . . A . 25 U C6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5849 . 1 1 25 U H1'  H -11.655  15.251 26.123 . . . 1.0 . . . . . . . . . . . . A . 25 U H1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5850 . 1 1 25 U H2'  H -12.073  17.742 25.003 . . . 1.0 . . . . . . . . . . . . A . 25 U H2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5851 . 1 1 25 U H3   H -16.222  16.056 26.466 . . . 1.0 . . . . . . . . . . . . A . 25 U H3   . . . . . . . . . rr_2l5z 1 
       .  7 .  5852 . 1 1 25 U H3'  H -10.990  19.008 26.701 . . . 1.0 . . . . . . . . . . . . A . 25 U H3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5853 . 1 1 25 U H4'  H  -8.860  16.837 26.793 . . . 1.0 . . . . . . . . . . . . A . 25 U H4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5854 . 1 1 25 U H5   H -14.449  18.742 29.210 . . . 1.0 . . . . . . . . . . . . A . 25 U H5   . . . . . . . . . rr_2l5z 1 
       .  7 .  5855 . 1 1 25 U H5'  H  -8.676  17.443 29.134 . . . 1.0 . . . . . . . . . . . . A . 25 U H5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5856 . 1 1 25 U H5'' H  -8.585  18.925 28.160 . . . 1.0 . . . . . . . . . . . . A . 25 U H5'' . . . . . . . . . rr_2l5z 1 
       .  7 .  5857 . 1 1 25 U H6   H -12.281  18.021 28.444 . . . 1.0 . . . . . . . . . . . . A . 25 U H6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5858 . 1 1 25 U HO2' H -11.041  16.157 23.840 . . . 1.0 . . . . . . . . . . . . A . 25 U HO2' . . . . . . . . . rr_2l5z 1 
       .  7 .  5859 . 1 1 25 U N1   N -13.030  16.636 27.026 . . . 1.0 . . . . . . . . . . . . A . 25 U N1   . . . . . . . . . rr_2l5z 1 
       .  7 .  5860 . 1 1 25 U N3   N -15.380  16.466 26.915 . . . 1.0 . . . . . . . . . . . . A . 25 U N3   . . . . . . . . . rr_2l5z 1 
       .  7 .  5861 . 1 1 25 U O2   O -14.054  15.202 25.554 . . . 1.0 . . . . . . . . . . . . A . 25 U O2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5862 . 1 1 25 U O2'  O -10.428  16.583 24.444 . . . 1.0 . . . . . . . . . . . . A . 25 U O2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5863 . 1 1 25 U O3'  O  -9.371  18.778 25.374 . . . 1.0 . . . . . . . . . . . . A . 25 U O3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5864 . 1 1 25 U O4   O -16.737  17.700 28.255 . . . 1.0 . . . . . . . . . . . . A . 25 U O4   . . . . . . . . . rr_2l5z 1 
       .  7 .  5865 . 1 1 25 U O4'  O -10.696  16.360 27.592 . . . 1.0 . . . . . . . . . . . . A . 25 U O4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5866 . 1 1 25 U O5'  O -10.334  18.664 29.218 . . . 1.0 . . . . . . . . . . . . A . 25 U O5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5867 . 1 1 25 U OP1  O  -8.761  19.961 30.673 . . . 1.0 . . . . . . . . . . . . A . 25 U OP1  . . . . . . . . . rr_2l5z 1 
       .  7 .  5868 . 1 1 25 U OP2  O -11.293  20.099 31.034 . . . 1.0 . . . . . . . . . . . . A . 25 U OP2  . . . . . . . . . rr_2l5z 1 
       .  7 .  5869 . 1 1 25 U P    P -10.092  19.315 30.672 . . . 1.0 . . . . . . . . . . . . A . 25 U P    . . . . . . . . . rr_2l5z 1 
       .  7 .  5870 . 1 1 26 C C1'  C -14.350  19.540 22.654 . . . 1.0 . . . . . . . . . . . . A . 26 C C1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5871 . 1 1 26 C C2   C -16.404  20.213 23.813 . . . 1.0 . . . . . . . . . . . . A . 26 C C2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5872 . 1 1 26 C C2'  C -14.139  20.765 21.758 . . . 1.0 . . . . . . . . . . . . A . 26 C C2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5873 . 1 1 26 C C3'  C -12.640  21.027 21.863 . . . 1.0 . . . . . . . . . . . . A . 26 C C3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5874 . 1 1 26 C C4   C -16.427  20.598 26.130 . . . 1.0 . . . . . . . . . . . . A . 26 C C4   . . . . . . . . . rr_2l5z 1 
       .  7 .  5875 . 1 1 26 C C4'  C -12.096  19.627 22.093 . . . 1.0 . . . . . . . . . . . . A . 26 C C4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5876 . 1 1 26 C C5   C -15.033  20.289 26.226 . . . 1.0 . . . . . . . . . . . . A . 26 C C5   . . . . . . . . . rr_2l5z 1 
       .  7 .  5877 . 1 1 26 C C5'  C -10.708  19.649 22.732 . . . 1.0 . . . . . . . . . . . . A . 26 C C5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5878 . 1 1 26 C C6   C -14.387  19.953 25.092 . . . 1.0 . . . . . . . . . . . . A . 26 C C6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5879 . 1 1 26 C H1'  H -14.938  18.795 22.116 . . . 1.0 . . . . . . . . . . . . A . 26 C H1'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5880 . 1 1 26 C H2'  H -14.701  21.617 22.154 . . . 1.0 . . . . . . . . . . . . A . 26 C H2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5881 . 1 1 26 C H3'  H -12.427  21.668 22.727 . . . 1.0 . . . . . . . . . . . . A . 26 C H3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5882 . 1 1 26 C H4'  H -12.053  19.092 21.146 . . . 1.0 . . . . . . . . . . . . A . 26 C H4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5883 . 1 1 26 C H41  H -18.091  21.152 27.165 . . . 1.0 . . . . . . . . . . . . A . 26 C H41  . . . . . . . . . rr_2l5z 1 
       .  7 .  5884 . 1 1 26 C H42  H -16.636  20.969 28.120 . . . 1.0 . . . . . . . . . . . . A . 26 C H42  . . . . . . . . . rr_2l5z 1 
       .  7 .  5885 . 1 1 26 C H5   H -14.516  20.326 27.173 . . . 1.0 . . . . . . . . . . . . A . 26 C H5   . . . . . . . . . rr_2l5z 1 
       .  7 .  5886 . 1 1 26 C H5'  H -10.386  18.625 22.920 . . . 1.0 . . . . . . . . . . . . A . 26 C H5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5887 . 1 1 26 C H5'' H -10.007  20.121 22.042 . . . 1.0 . . . . . . . . . . . . A . 26 C H5'' . . . . . . . . . rr_2l5z 1 
       .  7 .  5888 . 1 1 26 C H6   H -13.332  19.716 25.126 . . . 1.0 . . . . . . . . . . . . A . 26 C H6   . . . . . . . . . rr_2l5z 1 
       .  7 .  5889 . 1 1 26 C HO2' H -14.133  19.647 20.163 . . . 1.0 . . . . . . . . . . . . A . 26 C HO2' . . . . . . . . . rr_2l5z 1 
       .  7 .  5890 . 1 1 26 C HO3' H -12.279  22.545 20.700 . . . 1.0 . . . . . . . . . . . . A . 26 C HO3' . . . . . . . . . rr_2l5z 1 
       .  7 .  5891 . 1 1 26 C N1   N -15.051  19.911 23.900 . . . 1.0 . . . . . . . . . . . . A . 26 C N1   . . . . . . . . . rr_2l5z 1 
       .  7 .  5892 . 1 1 26 C N3   N -17.064  20.553 24.953 . . . 1.0 . . . . . . . . . . . . A . 26 C N3   . . . . . . . . . rr_2l5z 1 
       .  7 .  5893 . 1 1 26 C N4   N -17.106  20.933 27.227 . . . 1.0 . . . . . . . . . . . . A . 26 C N4   . . . . . . . . . rr_2l5z 1 
       .  7 .  5894 . 1 1 26 C O2   O -16.979  20.169 22.726 . . . 1.0 . . . . . . . . . . . . A . 26 C O2   . . . . . . . . . rr_2l5z 1 
       .  7 .  5895 . 1 1 26 C O2'  O -14.524  20.490 20.406 . . . 1.0 . . . . . . . . . . . . A . 26 C O2'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5896 . 1 1 26 C O3'  O -12.122  21.600 20.657 . . . 1.0 . . . . . . . . . . . . A . 26 C O3'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5897 . 1 1 26 C O4'  O -13.052  18.999 22.938 . . . 1.0 . . . . . . . . . . . . A . 26 C O4'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5898 . 1 1 26 C O5'  O -10.706  20.374 23.964 . . . 1.0 . . . . . . . . . . . . A . 26 C O5'  . . . . . . . . . rr_2l5z 1 
       .  7 .  5899 . 1 1 26 C OP1  O  -8.219  20.619 24.126 . . . 1.0 . . . . . . . . . . . . A . 26 C OP1  . . . . . . . . . rr_2l5z 1 
       .  7 .  5900 . 1 1 26 C OP2  O  -9.721  21.137 26.136 . . . 1.0 . . . . . . . . . . . . A . 26 C OP2  . . . . . . . . . rr_2l5z 1 
       .  7 .  5901 . 1 1 26 C P    P  -9.423  20.326 24.935 . . . 1.0 . . . . . . . . . . . . A . 26 C P    . . . . . . . . . rr_2l5z 1 
       .  8 .  5902 . 1 1  1 G C1'  C -24.432  19.789 22.419 . . . 1.0 . . . . . . . . . . . . A .  1 G C1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  5903 . 1 1  1 G C2   C -20.174  20.978 22.639 . . . 1.0 . . . . . . . . . . . . A .  1 G C2   . . . . . . . . . rr_2l5z 1 
       .  8 .  5904 . 1 1  1 G C2'  C -24.521  18.310 22.043 . . . 1.0 . . . . . . . . . . . . A .  1 G C2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  5905 . 1 1  1 G C3'  C -25.767  17.854 22.781 . . . 1.0 . . . . . . . . . . . . A .  1 G C3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  5906 . 1 1  1 G C4   C -22.153  20.369 23.470 . . . 1.0 . . . . . . . . . . . . A .  1 G C4   . . . . . . . . . rr_2l5z 1 
       .  8 .  5907 . 1 1  1 G C4'  C -26.651  19.096 22.748 . . . 1.0 . . . . . . . . . . . . A .  1 G C4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  5908 . 1 1  1 G C5   C -21.728  20.405 24.790 . . . 1.0 . . . . . . . . . . . . A .  1 G C5   . . . . . . . . . rr_2l5z 1 
       .  8 .  5909 . 1 1  1 G C5'  C -27.646  19.122 23.910 . . . 1.0 . . . . . . . . . . . . A .  1 G C5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  5910 . 1 1  1 G C6   C -20.385  20.766 25.083 . . . 1.0 . . . . . . . . . . . . A .  1 G C6   . . . . . . . . . rr_2l5z 1 
       .  8 .  5911 . 1 1  1 G C8   C -23.743  19.835 24.825 . . . 1.0 . . . . . . . . . . . . A .  1 G C8   . . . . . . . . . rr_2l5z 1 
       .  8 .  5912 . 1 1  1 G H1   H -18.674  21.314 24.058 . . . 1.0 . . . . . . . . . . . . A .  1 G H1   . . . . . . . . . rr_2l5z 1 
       .  8 .  5913 . 1 1  1 G H1'  H -24.114  20.363 21.550 . . . 1.0 . . . . . . . . . . . . A .  1 G H1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  5914 . 1 1  1 G H2'  H -23.646  17.774 22.421 . . . 1.0 . . . . . . . . . . . . A .  1 G H2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  5915 . 1 1  1 G H21  H -18.374  21.534 21.871 . . . 1.0 . . . . . . . . . . . . A .  1 G H21  . . . . . . . . . rr_2l5z 1 
       .  8 .  5916 . 1 1  1 G H22  H -19.637  21.251 20.695 . . . 1.0 . . . . . . . . . . . . A .  1 G H22  . . . . . . . . . rr_2l5z 1 
       .  8 .  5917 . 1 1  1 G H3'  H -25.536  17.525 23.797 . . . 1.0 . . . . . . . . . . . . A .  1 G H3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  5918 . 1 1  1 G H4'  H -27.194  19.130 21.806 . . . 1.0 . . . . . . . . . . . . A .  1 G H4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  5919 . 1 1  1 G H5'  H -28.185  20.070 23.895 . . . 1.0 . . . . . . . . . . . . A .  1 G H5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  5920 . 1 1  1 G H5'' H -28.359  18.307 23.787 . . . 1.0 . . . . . . . . . . . . A .  1 G H5'' . . . . . . . . . rr_2l5z 1 
       .  8 .  5921 . 1 1  1 G H8   H -24.723  19.536 25.165 . . . 1.0 . . . . . . . . . . . . A .  1 G H8   . . . . . . . . . rr_2l5z 1 
       .  8 .  5922 . 1 1  1 G HO2' H -25.518  18.477 20.380 . . . 1.0 . . . . . . . . . . . . A .  1 G HO2' . . . . . . . . . rr_2l5z 1 
       .  8 .  5923 . 1 1  1 G HO5' H -27.440  18.284 25.652 . . . 1.0 . . . . . . . . . . . . A .  1 G HO5' . . . . . . . . . rr_2l5z 1 
       .  8 .  5924 . 1 1  1 G N1   N -19.668  21.041 23.923 . . . 1.0 . . . . . . . . . . . . A .  1 G N1   . . . . . . . . . rr_2l5z 1 
       .  8 .  5925 . 1 1  1 G N2   N -19.327  21.278 21.655 . . . 1.0 . . . . . . . . . . . . A .  1 G N2   . . . . . . . . . rr_2l5z 1 
       .  8 .  5926 . 1 1  1 G N3   N -21.437  20.640 22.355 . . . 1.0 . . . . . . . . . . . . A .  1 G N3   . . . . . . . . . rr_2l5z 1 
       .  8 .  5927 . 1 1  1 G N7   N -22.777  20.055 25.656 . . . 1.0 . . . . . . . . . . . . A .  1 G N7   . . . . . . . . . rr_2l5z 1 
       .  8 .  5928 . 1 1  1 G N9   N -23.470  19.993 23.518 . . . 1.0 . . . . . . . . . . . . A .  1 G N9   . . . . . . . . . rr_2l5z 1 
       .  8 .  5929 . 1 1  1 G O2'  O -24.656  18.135 20.629 . . . 1.0 . . . . . . . . . . . . A .  1 G O2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  5930 . 1 1  1 G O3'  O -26.398  16.828 22.010 . . . 1.0 . . . . . . . . . . . . A .  1 G O3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  5931 . 1 1  1 G O4'  O -25.752  20.205 22.808 . . . 1.0 . . . . . . . . . . . . A .  1 G O4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  5932 . 1 1  1 G O5'  O -26.987  18.979 25.171 . . . 1.0 . . . . . . . . . . . . A .  1 G O5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  5933 . 1 1  1 G O6   O -19.839  20.849 26.181 . . . 1.0 . . . . . . . . . . . . A .  1 G O6   . . . . . . . . . rr_2l5z 1 
       .  8 .  5934 . 1 1  2 A C1'  C -20.890  14.455 21.631 . . . 1.0 . . . . . . . . . . . . A .  2 A C1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  5935 . 1 1  2 A C2   C -17.463  15.494 24.232 . . . 1.0 . . . . . . . . . . . . A .  2 A C2   . . . . . . . . . rr_2l5z 1 
       .  8 .  5936 . 1 1  2 A C2'  C -21.225  12.989 21.903 . . . 1.0 . . . . . . . . . . . . A .  2 A C2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  5937 . 1 1  2 A C3'  C -22.735  12.967 21.763 . . . 1.0 . . . . . . . . . . . . A .  2 A C3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  5938 . 1 1  2 A C4   C -19.586  15.454 23.619 . . . 1.0 . . . . . . . . . . . . A .  2 A C4   . . . . . . . . . rr_2l5z 1 
       .  8 .  5939 . 1 1  2 A C4'  C -22.977  13.992 20.662 . . . 1.0 . . . . . . . . . . . . A .  2 A C4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  5940 . 1 1  2 A C5   C -19.997  16.174 24.717 . . . 1.0 . . . . . . . . . . . . A .  2 A C5   . . . . . . . . . rr_2l5z 1 
       .  8 .  5941 . 1 1  2 A C5'  C -24.387  14.583 20.732 . . . 1.0 . . . . . . . . . . . . A .  2 A C5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  5942 . 1 1  2 A C6   C -19.000  16.560 25.619 . . . 1.0 . . . . . . . . . . . . A .  2 A C6   . . . . . . . . . rr_2l5z 1 
       .  8 .  5943 . 1 1  2 A C8   C -21.718  15.769 23.597 . . . 1.0 . . . . . . . . . . . . A .  2 A C8   . . . . . . . . . rr_2l5z 1 
       .  8 .  5944 . 1 1  2 A H1'  H -19.969  14.515 21.052 . . . 1.0 . . . . . . . . . . . . A .  2 A H1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  5945 . 1 1  2 A H2   H -16.418  15.238 24.066 . . . 1.0 . . . . . . . . . . . . A .  2 A H2   . . . . . . . . . rr_2l5z 1 
       .  8 .  5946 . 1 1  2 A H2'  H -20.938  12.721 22.922 . . . 1.0 . . . . . . . . . . . . A .  2 A H2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  5947 . 1 1  2 A H3'  H -23.232  13.232 22.700 . . . 1.0 . . . . . . . . . . . . A .  2 A H3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  5948 . 1 1  2 A H4'  H -22.828  13.522 19.690 . . . 1.0 . . . . . . . . . . . . A .  2 A H4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  5949 . 1 1  2 A H5'  H -24.431  15.472 20.103 . . . 1.0 . . . . . . . . . . . . A .  2 A H5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  5950 . 1 1  2 A H5'' H -25.099  13.847 20.358 . . . 1.0 . . . . . . . . . . . . A .  2 A H5'' . . . . . . . . . rr_2l5z 1 
       .  8 .  5951 . 1 1  2 A H61  H -18.493  17.513 27.345 . . . 1.0 . . . . . . . . . . . . A .  2 A H61  . . . . . . . . . rr_2l5z 1 
       .  8 .  5952 . 1 1  2 A H62  H -20.195  17.536 26.946 . . . 1.0 . . . . . . . . . . . . A .  2 A H62  . . . . . . . . . rr_2l5z 1 
       .  8 .  5953 . 1 1  2 A H8   H -22.743  15.726 23.262 . . . 1.0 . . . . . . . . . . . . A .  2 A H8   . . . . . . . . . rr_2l5z 1 
       .  8 .  5954 . 1 1  2 A HO2' H -20.417  12.644 20.165 . . . 1.0 . . . . . . . . . . . . A .  2 A HO2' . . . . . . . . . rr_2l5z 1 
       .  8 .  5955 . 1 1  2 A N1   N -17.735  16.196 25.336 . . . 1.0 . . . . . . . . . . . . A .  2 A N1   . . . . . . . . . rr_2l5z 1 
       .  8 .  5956 . 1 1  2 A N3   N -18.330  15.077 23.312 . . . 1.0 . . . . . . . . . . . . A .  2 A N3   . . . . . . . . . rr_2l5z 1 
       .  8 .  5957 . 1 1  2 A N6   N -19.249  17.260 26.726 . . . 1.0 . . . . . . . . . . . . A .  2 A N6   . . . . . . . . . rr_2l5z 1 
       .  8 .  5958 . 1 1  2 A N7   N -21.388  16.373 24.692 . . . 1.0 . . . . . . . . . . . . A .  2 A N7   . . . . . . . . . rr_2l5z 1 
       .  8 .  5959 . 1 1  2 A N9   N -20.723  15.197 22.896 . . . 1.0 . . . . . . . . . . . . A .  2 A N9   . . . . . . . . . rr_2l5z 1 
       .  8 .  5960 . 1 1  2 A O2'  O -20.598  12.123 20.951 . . . 1.0 . . . . . . . . . . . . A .  2 A O2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  5961 . 1 1  2 A O3'  O -23.130  11.679 21.285 . . . 1.0 . . . . . . . . . . . . A .  2 A O3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  5962 . 1 1  2 A O4'  O -21.977  14.994 20.857 . . . 1.0 . . . . . . . . . . . . A .  2 A O4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  5963 . 1 1  2 A O5'  O -24.742  14.938 22.070 . . . 1.0 . . . . . . . . . . . . A .  2 A O5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  5964 . 1 1  2 A OP1  O -27.154  14.480 21.572 . . . 1.0 . . . . . . . . . . . . A .  2 A OP1  . . . . . . . . . rr_2l5z 1 
       .  8 .  5965 . 1 1  2 A OP2  O -26.415  15.204 23.916 . . . 1.0 . . . . . . . . . . . . A .  2 A OP2  . . . . . . . . . rr_2l5z 1 
       .  8 .  5966 . 1 1  2 A P    P -26.269  15.284 22.445 . . . 1.0 . . . . . . . . . . . . A .  2 A P    . . . . . . . . . rr_2l5z 1 
       .  8 .  5967 . 1 1  3 G C1'  C -18.545  11.004 24.504 . . . 1.0 . . . . . . . . . . . . A .  3 G C1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  5968 . 1 1  3 G C2   C -16.138  13.220 27.473 . . . 1.0 . . . . . . . . . . . . A .  3 G C2   . . . . . . . . . rr_2l5z 1 
       .  8 .  5969 . 1 1  3 G C2'  C -18.624   9.597 25.114 . . . 1.0 . . . . . . . . . . . . A .  3 G C2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  5970 . 1 1  3 G C3'  C -19.718   8.904 24.297 . . . 1.0 . . . . . . . . . . . . A .  3 G C3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  5971 . 1 1  3 G C4   C -18.012  12.658 26.402 . . . 1.0 . . . . . . . . . . . . A .  3 G C4   . . . . . . . . . rr_2l5z 1 
       .  8 .  5972 . 1 1  3 G C4'  C -19.740   9.710 23.006 . . . 1.0 . . . . . . . . . . . . A .  3 G C4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  5973 . 1 1  3 G C5   C -18.817  13.514 27.140 . . . 1.0 . . . . . . . . . . . . A .  3 G C5   . . . . . . . . . rr_2l5z 1 
       .  8 .  5974 . 1 1  3 G C5'  C -21.079   9.590 22.277 . . . 1.0 . . . . . . . . . . . . A .  3 G C5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  5975 . 1 1  3 G C6   C -18.233  14.316 28.159 . . . 1.0 . . . . . . . . . . . . A .  3 G C6   . . . . . . . . . rr_2l5z 1 
       .  8 .  5976 . 1 1  3 G C8   C -20.070  12.540 25.772 . . . 1.0 . . . . . . . . . . . . A .  3 G C8   . . . . . . . . . rr_2l5z 1 
       .  8 .  5977 . 1 1  3 G H1   H -16.366  14.649 28.985 . . . 1.0 . . . . . . . . . . . . A .  3 G H1   . . . . . . . . . rr_2l5z 1 
       .  8 .  5978 . 1 1  3 G H1'  H -17.539  11.171 24.117 . . . 1.0 . . . . . . . . . . . . A .  3 G H1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  5979 . 1 1  3 G H2'  H -18.924   9.665 26.164 . . . 1.0 . . . . . . . . . . . . A .  3 G H2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  5980 . 1 1  3 G H21  H -14.420  13.721 28.441 . . . 1.0 . . . . . . . . . . . . A .  3 G H21  . . . . . . . . . rr_2l5z 1 
       .  8 .  5981 . 1 1  3 G H22  H -14.248  12.526 27.176 . . . 1.0 . . . . . . . . . . . . A .  3 G H22  . . . . . . . . . rr_2l5z 1 
       .  8 .  5982 . 1 1  3 G H3'  H -20.684   8.915 24.809 . . . 1.0 . . . . . . . . . . . . A .  3 G H3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  5983 . 1 1  3 G H4'  H -18.938   9.374 22.352 . . . 1.0 . . . . . . . . . . . . A .  3 G H4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  5984 . 1 1  3 G H5'  H -21.008  10.101 21.316 . . . 1.0 . . . . . . . . . . . . A .  3 G H5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  5985 . 1 1  3 G H5'' H -21.296   8.536 22.104 . . . 1.0 . . . . . . . . . . . . A .  3 G H5'' . . . . . . . . . rr_2l5z 1 
       .  8 .  5986 . 1 1  3 G H8   H -20.941  12.222 25.218 . . . 1.0 . . . . . . . . . . . . A .  3 G H8   . . . . . . . . . rr_2l5z 1 
       .  8 .  5987 . 1 1  3 G HO2' H -16.824   9.185 25.729 . . . 1.0 . . . . . . . . . . . . A .  3 G HO2' . . . . . . . . . rr_2l5z 1 
       .  8 .  5988 . 1 1  3 G N1   N -16.864  14.098 28.256 . . . 1.0 . . . . . . . . . . . . A .  3 G N1   . . . . . . . . . rr_2l5z 1 
       .  8 .  5989 . 1 1  3 G N2   N -14.830  13.150 27.715 . . . 1.0 . . . . . . . . . . . . A .  3 G N2   . . . . . . . . . rr_2l5z 1 
       .  8 .  5990 . 1 1  3 G N3   N -16.680  12.463 26.513 . . . 1.0 . . . . . . . . . . . . A .  3 G N3   . . . . . . . . . rr_2l5z 1 
       .  8 .  5991 . 1 1  3 G N7   N -20.153  13.423 26.714 . . . 1.0 . . . . . . . . . . . . A .  3 G N7   . . . . . . . . . rr_2l5z 1 
       .  8 .  5992 . 1 1  3 G N9   N -18.851  12.034 25.516 . . . 1.0 . . . . . . . . . . . . A .  3 G N9   . . . . . . . . . rr_2l5z 1 
       .  8 .  5993 . 1 1  3 G O2'  O -17.375   8.910 24.992 . . . 1.0 . . . . . . . . . . . . A .  3 G O2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  5994 . 1 1  3 G O3'  O -19.279   7.576 23.998 . . . 1.0 . . . . . . . . . . . . A .  3 G O3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  5995 . 1 1  3 G O4'  O -19.481  11.044 23.418 . . . 1.0 . . . . . . . . . . . . A .  3 G O4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  5996 . 1 1  3 G O5'  O -22.147  10.166 23.032 . . . 1.0 . . . . . . . . . . . . A .  3 G O5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  5997 . 1 1  3 G O6   O -18.785  15.121 28.906 . . . 1.0 . . . . . . . . . . . . A .  3 G O6   . . . . . . . . . rr_2l5z 1 
       .  8 .  5998 . 1 1  3 G OP1  O -23.984   9.338 21.544 . . . 1.0 . . . . . . . . . . . . A .  3 G OP1  . . . . . . . . . rr_2l5z 1 
       .  8 .  5999 . 1 1  3 G OP2  O -24.449  11.109 23.336 . . . 1.0 . . . . . . . . . . . . A .  3 G OP2  . . . . . . . . . rr_2l5z 1 
       .  8 .  6000 . 1 1  3 G P    P -23.548  10.520 22.321 . . . 1.0 . . . . . . . . . . . . A .  3 G P    . . . . . . . . . rr_2l5z 1 
       .  8 .  6001 . 1 1  4 C C1'  C -15.761   8.126 28.415 . . . 1.0 . . . . . . . . . . . . A .  4 C C1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6002 . 1 1  4 C C2   C -16.475   9.983 29.937 . . . 1.0 . . . . . . . . . . . . A .  4 C C2   . . . . . . . . . rr_2l5z 1 
       .  8 .  6003 . 1 1  4 C C2'  C -15.695   6.804 29.188 . . . 1.0 . . . . . . . . . . . . A .  4 C C2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6004 . 1 1  4 C C3'  C -16.412   5.830 28.266 . . . 1.0 . . . . . . . . . . . . A .  4 C C3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6005 . 1 1  4 C C4   C -18.724  10.655 30.028 . . . 1.0 . . . . . . . . . . . . A .  4 C C4   . . . . . . . . . rr_2l5z 1 
       .  8 .  6006 . 1 1  4 C C4'  C -16.082   6.377 26.886 . . . 1.0 . . . . . . . . . . . . A .  4 C C4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6007 . 1 1  4 C C5   C -19.090   9.671 29.058 . . . 1.0 . . . . . . . . . . . . A .  4 C C5   . . . . . . . . . rr_2l5z 1 
       .  8 .  6008 . 1 1  4 C C5'  C -17.110   5.948 25.838 . . . 1.0 . . . . . . . . . . . . A .  4 C C5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6009 . 1 1  4 C C6   C -18.118   8.878 28.566 . . . 1.0 . . . . . . . . . . . . A .  4 C C6   . . . . . . . . . rr_2l5z 1 
       .  8 .  6010 . 1 1  4 C H1'  H -14.781   8.615 28.449 . . . 1.0 . . . . . . . . . . . . A .  4 C H1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6011 . 1 1  4 C H2'  H -16.239   6.895 30.130 . . . 1.0 . . . . . . . . . . . . A .  4 C H2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6012 . 1 1  4 C H3'  H -17.486   5.805 28.459 . . . 1.0 . . . . . . . . . . . . A .  4 C H3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6013 . 1 1  4 C H4'  H -15.092   6.036 26.586 . . . 1.0 . . . . . . . . . . . . A .  4 C H4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6014 . 1 1  4 C H41  H -19.404  12.158 31.221 . . . 1.0 . . . . . . . . . . . . A .  4 C H41  . . . . . . . . . rr_2l5z 1 
       .  8 .  6015 . 1 1  4 C H42  H -20.616  11.375 30.231 . . . 1.0 . . . . . . . . . . . . A .  4 C H42  . . . . . . . . . rr_2l5z 1 
       .  8 .  6016 . 1 1  4 C H5   H -20.113   9.567 28.730 . . . 1.0 . . . . . . . . . . . . A .  4 C H5   . . . . . . . . . rr_2l5z 1 
       .  8 .  6017 . 1 1  4 C H5'  H -16.773   6.278 24.855 . . . 1.0 . . . . . . . . . . . . A .  4 C H5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6018 . 1 1  4 C H5'' H -17.186   4.861 25.841 . . . 1.0 . . . . . . . . . . . . A .  4 C H5'' . . . . . . . . . rr_2l5z 1 
       .  8 .  6019 . 1 1  4 C H6   H -18.371   8.102 27.855 . . . 1.0 . . . . . . . . . . . . A .  4 C H6   . . . . . . . . . rr_2l5z 1 
       .  8 .  6020 . 1 1  4 C HO2' H -14.036   6.862 30.205 . . . 1.0 . . . . . . . . . . . . A .  4 C HO2' . . . . . . . . . rr_2l5z 1 
       .  8 .  6021 . 1 1  4 C N1   N -16.823   9.017 28.983 . . . 1.0 . . . . . . . . . . . . A .  4 C N1   . . . . . . . . . rr_2l5z 1 
       .  8 .  6022 . 1 1  4 C N3   N -17.455  10.783 30.435 . . . 1.0 . . . . . . . . . . . . A .  4 C N3   . . . . . . . . . rr_2l5z 1 
       .  8 .  6023 . 1 1  4 C N4   N -19.657  11.461 30.534 . . . 1.0 . . . . . . . . . . . . A .  4 C N4   . . . . . . . . . rr_2l5z 1 
       .  8 .  6024 . 1 1  4 C O2   O -15.307  10.091 30.310 . . . 1.0 . . . . . . . . . . . . A .  4 C O2   . . . . . . . . . rr_2l5z 1 
       .  8 .  6025 . 1 1  4 C O2'  O -14.340   6.402 29.419 . . . 1.0 . . . . . . . . . . . . A .  4 C O2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6026 . 1 1  4 C O3'  O -15.803   4.542 28.401 . . . 1.0 . . . . . . . . . . . . A .  4 C O3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6027 . 1 1  4 C O4'  O -16.060   7.792 27.046 . . . 1.0 . . . . . . . . . . . . A .  4 C O4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6028 . 1 1  4 C O5'  O -18.400   6.505 26.100 . . . 1.0 . . . . . . . . . . . . A .  4 C O5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6029 . 1 1  4 C OP1  O -19.399   5.090 24.291 . . . 1.0 . . . . . . . . . . . . A .  4 C OP1  . . . . . . . . . rr_2l5z 1 
       .  8 .  6030 . 1 1  4 C OP2  O -20.868   6.647 25.698 . . . 1.0 . . . . . . . . . . . . A .  4 C OP2  . . . . . . . . . rr_2l5z 1 
       .  8 .  6031 . 1 1  4 C P    P -19.585   6.366 25.017 . . . 1.0 . . . . . . . . . . . . A .  4 C P    . . . . . . . . . rr_2l5z 1 
       .  8 .  6032 . 1 1  5 U C1'  C -15.339   6.888 33.336 . . . 1.0 . . . . . . . . . . . . A .  5 U C1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6033 . 1 1  5 U C2   C -17.416   8.097 33.971 . . . 1.0 . . . . . . . . . . . . A .  5 U C2   . . . . . . . . . rr_2l5z 1 
       .  8 .  6034 . 1 1  5 U C2'  C -15.009   5.936 34.489 . . . 1.0 . . . . . . . . . . . . A .  5 U C2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6035 . 1 1  5 U C3'  C -14.807   4.606 33.785 . . . 1.0 . . . . . . . . . . . . A .  5 U C3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6036 . 1 1  5 U C4   C -19.599   7.456 33.022 . . . 1.0 . . . . . . . . . . . . A .  5 U C4   . . . . . . . . . rr_2l5z 1 
       .  8 .  6037 . 1 1  5 U C4'  C -14.236   5.017 32.430 . . . 1.0 . . . . . . . . . . . . A .  5 U C4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6038 . 1 1  5 U C5   C -18.897   6.432 32.282 . . . 1.0 . . . . . . . . . . . . A .  5 U C5   . . . . . . . . . rr_2l5z 1 
       .  8 .  6039 . 1 1  5 U C5'  C -14.555   4.001 31.330 . . . 1.0 . . . . . . . . . . . . A .  5 U C5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6040 . 1 1  5 U C6   C -17.555   6.284 32.399 . . . 1.0 . . . . . . . . . . . . A .  5 U C6   . . . . . . . . . rr_2l5z 1 
       .  8 .  6041 . 1 1  5 U H1'  H -14.830   7.843 33.497 . . . 1.0 . . . . . . . . . . . . A .  5 U H1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6042 . 1 1  5 U H2'  H -15.860   5.870 35.177 . . . 1.0 . . . . . . . . . . . . A .  5 U H2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6043 . 1 1  5 U H3   H -19.248   8.969 34.397 . . . 1.0 . . . . . . . . . . . . A .  5 U H3   . . . . . . . . . rr_2l5z 1 
       .  8 .  6044 . 1 1  5 U H3'  H -15.743   4.049 33.698 . . . 1.0 . . . . . . . . . . . . A .  5 U H3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6045 . 1 1  5 U H4'  H -13.157   5.133 32.514 . . . 1.0 . . . . . . . . . . . . A .  5 U H4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6046 . 1 1  5 U H5   H -19.452   5.761 31.645 . . . 1.0 . . . . . . . . . . . . A .  5 U H5   . . . . . . . . . rr_2l5z 1 
       .  8 .  6047 . 1 1  5 U H5'  H -13.881   4.164 30.489 . . . 1.0 . . . . . . . . . . . . A .  5 U H5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6048 . 1 1  5 U H5'' H -14.403   2.992 31.718 . . . 1.0 . . . . . . . . . . . . A .  5 U H5'' . . . . . . . . . rr_2l5z 1 
       .  8 .  6049 . 1 1  5 U H6   H -17.060   5.507 31.836 . . . 1.0 . . . . . . . . . . . . A .  5 U H6   . . . . . . . . . rr_2l5z 1 
       .  8 .  6050 . 1 1  5 U HO2' H -13.151   5.684 35.011 . . . 1.0 . . . . . . . . . . . . A .  5 U HO2' . . . . . . . . . rr_2l5z 1 
       .  8 .  6051 . 1 1  5 U N1   N -16.814   7.090 33.222 . . . 1.0 . . . . . . . . . . . . A .  5 U N1   . . . . . . . . . rr_2l5z 1 
       .  8 .  6052 . 1 1  5 U N3   N -18.784   8.228 33.832 . . . 1.0 . . . . . . . . . . . . A .  5 U N3   . . . . . . . . . rr_2l5z 1 
       .  8 .  6053 . 1 1  5 U O2   O -16.768   8.831 34.714 . . . 1.0 . . . . . . . . . . . . A .  5 U O2   . . . . . . . . . rr_2l5z 1 
       .  8 .  6054 . 1 1  5 U O2'  O -13.825   6.346 35.182 . . . 1.0 . . . . . . . . . . . . A .  5 U O2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6055 . 1 1  5 U O3'  O -13.804   3.870 34.490 . . . 1.0 . . . . . . . . . . . . A .  5 U O3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6056 . 1 1  5 U O4   O -20.809   7.665 32.968 . . . 1.0 . . . . . . . . . . . . A .  5 U O4   . . . . . . . . . rr_2l5z 1 
       .  8 .  6057 . 1 1  5 U O4'  O -14.819   6.286 32.137 . . . 1.0 . . . . . . . . . . . . A .  5 U O4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6058 . 1 1  5 U O5'  O -15.905   4.130 30.877 . . . 1.0 . . . . . . . . . . . . A .  5 U O5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6059 . 1 1  5 U OP1  O -15.633   2.208 29.294 . . . 1.0 . . . . . . . . . . . . A .  5 U OP1  . . . . . . . . . rr_2l5z 1 
       .  8 .  6060 . 1 1  5 U OP2  O -17.842   3.501 29.418 . . . 1.0 . . . . . . . . . . . . A .  5 U OP2  . . . . . . . . . rr_2l5z 1 
       .  8 .  6061 . 1 1  5 U P    P -16.363   3.482 29.476 . . . 1.0 . . . . . . . . . . . . A .  5 U P    . . . . . . . . . rr_2l5z 1 
       .  8 .  6062 . 1 1  6 G C1'  C -18.115   5.324 38.091 . . . 1.0 . . . . . . . . . . . . A .  6 G C1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6063 . 1 1  6 G C2   C -20.525   9.025 37.768 . . . 1.0 . . . . . . . . . . . . A .  6 G C2   . . . . . . . . . rr_2l5z 1 
       .  8 .  6064 . 1 1  6 G C2'  C -18.733   4.281 39.030 . . . 1.0 . . . . . . . . . . . . A .  6 G C2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6065 . 1 1  6 G C3'  C -17.790   3.072 38.922 . . . 1.0 . . . . . . . . . . . . A .  6 G C3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6066 . 1 1  6 G C4   C -19.818   7.006 37.135 . . . 1.0 . . . . . . . . . . . . A .  6 G C4   . . . . . . . . . rr_2l5z 1 
       .  8 .  6067 . 1 1  6 G C4'  C -16.541   3.648 38.258 . . . 1.0 . . . . . . . . . . . . A .  6 G C4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6068 . 1 1  6 G C5   C -20.652   6.948 36.027 . . . 1.0 . . . . . . . . . . . . A .  6 G C5   . . . . . . . . . rr_2l5z 1 
       .  8 .  6069 . 1 1  6 G C5'  C -15.759   2.596 37.466 . . . 1.0 . . . . . . . . . . . . A .  6 G C5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6070 . 1 1  6 G C6   C -21.520   8.037 35.747 . . . 1.0 . . . . . . . . . . . . A .  6 G C6   . . . . . . . . . rr_2l5z 1 
       .  8 .  6071 . 1 1  6 G C8   C -19.564   5.158 36.052 . . . 1.0 . . . . . . . . . . . . A .  6 G C8   . . . . . . . . . rr_2l5z 1 
       .  8 .  6072 . 1 1  6 G H1   H -21.989   9.884 36.547 . . . 1.0 . . . . . . . . . . . . A .  6 G H1   . . . . . . . . . rr_2l5z 1 
       .  8 .  6073 . 1 1  6 G H1'  H -17.733   6.156 38.682 . . . 1.0 . . . . . . . . . . . . A .  6 G H1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6074 . 1 1  6 G H2'  H -19.735   4.017 38.676 . . . 1.0 . . . . . . . . . . . . A .  6 G H2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6075 . 1 1  6 G H21  H -21.162  10.867 38.357 . . . 1.0 . . . . . . . . . . . . A .  6 G H21  . . . . . . . . . rr_2l5z 1 
       .  8 .  6076 . 1 1  6 G H22  H -19.936  10.137 39.369 . . . 1.0 . . . . . . . . . . . . A .  6 G H22  . . . . . . . . . rr_2l5z 1 
       .  8 .  6077 . 1 1  6 G H3'  H -18.233   2.251 38.345 . . . 1.0 . . . . . . . . . . . . A .  6 G H3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6078 . 1 1  6 G H4'  H -15.894   4.083 39.019 . . . 1.0 . . . . . . . . . . . . A .  6 G H4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6079 . 1 1  6 G H5'  H -15.364   1.853 38.158 . . . 1.0 . . . . . . . . . . . . A .  6 G H5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6080 . 1 1  6 G H5'' H -16.433   2.105 36.764 . . . 1.0 . . . . . . . . . . . . A .  6 G H5'' . . . . . . . . . rr_2l5z 1 
       .  8 .  6081 . 1 1  6 G H8   H -19.183   4.182 35.797 . . . 1.0 . . . . . . . . . . . . A .  6 G H8   . . . . . . . . . rr_2l5z 1 
       .  8 .  6082 . 1 1  6 G HO2' H -18.837   5.728 40.329 . . . 1.0 . . . . . . . . . . . . A .  6 G HO2' . . . . . . . . . rr_2l5z 1 
       .  8 .  6083 . 1 1  6 G N1   N -21.385   9.050 36.689 . . . 1.0 . . . . . . . . . . . . A .  6 G N1   . . . . . . . . . rr_2l5z 1 
       .  8 .  6084 . 1 1  6 G N2   N -20.542  10.097 38.562 . . . 1.0 . . . . . . . . . . . . A .  6 G N2   . . . . . . . . . rr_2l5z 1 
       .  8 .  6085 . 1 1  6 G N3   N -19.704   8.004 38.040 . . . 1.0 . . . . . . . . . . . . A .  6 G N3   . . . . . . . . . rr_2l5z 1 
       .  8 .  6086 . 1 1  6 G N7   N -20.471   5.738 35.336 . . . 1.0 . . . . . . . . . . . . A .  6 G N7   . . . . . . . . . rr_2l5z 1 
       .  8 .  6087 . 1 1  6 G N9   N -19.120   5.827 37.132 . . . 1.0 . . . . . . . . . . . . A .  6 G N9   . . . . . . . . . rr_2l5z 1 
       .  8 .  6088 . 1 1  6 G O2'  O -18.791   4.769 40.375 . . . 1.0 . . . . . . . . . . . . A .  6 G O2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6089 . 1 1  6 G O3'  O -17.439   2.663 40.246 . . . 1.0 . . . . . . . . . . . . A .  6 G O3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6090 . 1 1  6 G O4'  O -17.029   4.683 37.419 . . . 1.0 . . . . . . . . . . . . A .  6 G O4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6091 . 1 1  6 G O5'  O -14.674   3.182 36.743 . . . 1.0 . . . . . . . . . . . . A .  6 G O5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6092 . 1 1  6 G O6   O -22.326   8.155 34.827 . . . 1.0 . . . . . . . . . . . . A .  6 G O6   . . . . . . . . . rr_2l5z 1 
       .  8 .  6093 . 1 1  6 G OP1  O -12.960   1.777 35.577 . . . 1.0 . . . . . . . . . . . . A .  6 G OP1  . . . . . . . . . rr_2l5z 1 
       .  8 .  6094 . 1 1  6 G OP2  O -15.360   1.919 34.692 . . . 1.0 . . . . . . . . . . . . A .  6 G OP2  . . . . . . . . . rr_2l5z 1 
       .  8 .  6095 . 1 1  6 G P    P -14.193   2.559 35.338 . . . 1.0 . . . . . . . . . . . . A .  6 G P    . . . . . . . . . rr_2l5z 1 
       .  8 .  6096 . 1 1  7 C C1'  C -18.547   3.847 44.955 . . . 1.0 . . . . . . . . . . . . A .  7 C C1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6097 . 1 1  7 C C2   C -20.909   4.510 44.926 . . . 1.0 . . . . . . . . . . . . A .  7 C C2   . . . . . . . . . rr_2l5z 1 
       .  8 .  6098 . 1 1  7 C C2'  C -18.641   2.564 45.780 . . . 1.0 . . . . . . . . . . . . A .  7 C C2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6099 . 1 1  7 C C3'  C -17.907   1.559 44.914 . . . 1.0 . . . . . . . . . . . . A .  7 C C3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6100 . 1 1  7 C C4   C -22.152   4.514 42.932 . . . 1.0 . . . . . . . . . . . . A .  7 C C4   . . . . . . . . . rr_2l5z 1 
       .  8 .  6101 . 1 1  7 C C4'  C -16.824   2.411 44.267 . . . 1.0 . . . . . . . . . . . . A .  7 C C4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6102 . 1 1  7 C C5   C -21.013   4.072 42.188 . . . 1.0 . . . . . . . . . . . . A .  7 C C5   . . . . . . . . . rr_2l5z 1 
       .  8 .  6103 . 1 1  7 C C5'  C -16.330   1.803 42.951 . . . 1.0 . . . . . . . . . . . . A .  7 C C5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6104 . 1 1  7 C C6   C -19.864   3.869 42.861 . . . 1.0 . . . . . . . . . . . . A .  7 C C6   . . . . . . . . . rr_2l5z 1 
       .  8 .  6105 . 1 1  7 C H1'  H -18.355   4.692 45.616 . . . 1.0 . . . . . . . . . . . . A .  7 C H1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6106 . 1 1  7 C H2'  H -19.686   2.269 45.894 . . . 1.0 . . . . . . . . . . . . A .  7 C H2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6107 . 1 1  7 C H3'  H -18.570   1.099 44.179 . . . 1.0 . . . . . . . . . . . . A .  7 C H3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6108 . 1 1  7 C H4'  H -15.988   2.525 44.957 . . . 1.0 . . . . . . . . . . . . A .  7 C H4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6109 . 1 1  7 C H41  H -24.115   5.038 42.825 . . . 1.0 . . . . . . . . . . . . A .  7 C H41  . . . . . . . . . rr_2l5z 1 
       .  8 .  6110 . 1 1  7 C H42  H -23.378   4.574 41.309 . . . 1.0 . . . . . . . . . . . . A .  7 C H42  . . . . . . . . . rr_2l5z 1 
       .  8 .  6111 . 1 1  7 C H5   H -21.074   3.904 41.123 . . . 1.0 . . . . . . . . . . . . A .  7 C H5   . . . . . . . . . rr_2l5z 1 
       .  8 .  6112 . 1 1  7 C H5'  H -15.925   2.598 42.323 . . . 1.0 . . . . . . . . . . . . A .  7 C H5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6113 . 1 1  7 C H5'' H -15.542   1.079 43.162 . . . 1.0 . . . . . . . . . . . . A .  7 C H5'' . . . . . . . . . rr_2l5z 1 
       .  8 .  6114 . 1 1  7 C H6   H -18.986   3.534 42.330 . . . 1.0 . . . . . . . . . . . . A .  7 C H6   . . . . . . . . . rr_2l5z 1 
       .  8 .  6115 . 1 1  7 C HO2' H -18.706   2.760 47.716 . . . 1.0 . . . . . . . . . . . . A .  7 C HO2' . . . . . . . . . rr_2l5z 1 
       .  8 .  6116 . 1 1  7 C N1   N -19.800   4.080 44.207 . . . 1.0 . . . . . . . . . . . . A .  7 C N1   . . . . . . . . . rr_2l5z 1 
       .  8 .  6117 . 1 1  7 C N3   N -22.074   4.719 44.253 . . . 1.0 . . . . . . . . . . . . A .  7 C N3   . . . . . . . . . rr_2l5z 1 
       .  8 .  6118 . 1 1  7 C N4   N -23.308   4.726 42.304 . . . 1.0 . . . . . . . . . . . . A .  7 C N4   . . . . . . . . . rr_2l5z 1 
       .  8 .  6119 . 1 1  7 C O2   O -20.825   4.695 46.139 . . . 1.0 . . . . . . . . . . . . A .  7 C O2   . . . . . . . . . rr_2l5z 1 
       .  8 .  6120 . 1 1  7 C O2'  O -18.011   2.715 47.057 . . . 1.0 . . . . . . . . . . . . A .  7 C O2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6121 . 1 1  7 C O3'  O -17.286   0.594 45.766 . . . 1.0 . . . . . . . . . . . . A .  7 C O3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6122 . 1 1  7 C O4'  O -17.433   3.686 44.056 . . . 1.0 . . . . . . . . . . . . A .  7 C O4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6123 . 1 1  7 C O5'  O -17.389   1.145 42.247 . . . 1.0 . . . . . . . . . . . . A .  7 C O5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6124 . 1 1  7 C OP1  O -16.111   0.540 40.179 . . . 1.0 . . . . . . . . . . . . A .  7 C OP1  . . . . . . . . . rr_2l5z 1 
       .  8 .  6125 . 1 1  7 C OP2  O -18.673   0.484 40.201 . . . 1.0 . . . . . . . . . . . . A .  7 C OP2  . . . . . . . . . rr_2l5z 1 
       .  8 .  6126 . 1 1  7 C P    P -17.402   1.102 40.638 . . . 1.0 . . . . . . . . . . . . A .  7 C P    . . . . . . . . . rr_2l5z 1 
       .  8 .  6127 . 1 1  8 A C1'  C -22.855   0.385 44.180 . . . 1.0 . . . . . . . . . . . . A .  8 A C1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6128 . 1 1  8 A C2   C -26.259   3.170 43.701 . . . 1.0 . . . . . . . . . . . . A .  8 A C2   . . . . . . . . . rr_2l5z 1 
       .  8 .  6129 . 1 1  8 A C2'  C -21.537   0.682 43.488 . . . 1.0 . . . . . . . . . . . . A .  8 A C2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6130 . 1 1  8 A C3'  C -20.933  -0.705 43.356 . . . 1.0 . . . . . . . . . . . . A .  8 A C3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6131 . 1 1  8 A C4   C -24.440   2.363 44.657 . . . 1.0 . . . . . . . . . . . . A .  8 A C4   . . . . . . . . . rr_2l5z 1 
       .  8 .  6132 . 1 1  8 A C4'  C -21.458  -1.452 44.601 . . . 1.0 . . . . . . . . . . . . A .  8 A C4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6133 . 1 1  8 A C5   C -24.435   3.328 45.640 . . . 1.0 . . . . . . . . . . . . A .  8 A C5   . . . . . . . . . rr_2l5z 1 
       .  8 .  6134 . 1 1  8 A C5'  C -20.401  -1.586 45.707 . . . 1.0 . . . . . . . . . . . . A .  8 A C5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6135 . 1 1  8 A C6   C -25.466   4.272 45.590 . . . 1.0 . . . . . . . . . . . . A .  8 A C6   . . . . . . . . . rr_2l5z 1 
       .  8 .  6136 . 1 1  8 A C8   C -22.781   2.100 46.007 . . . 1.0 . . . . . . . . . . . . A .  8 A C8   . . . . . . . . . rr_2l5z 1 
       .  8 .  6137 . 1 1  8 A H1'  H -23.594   0.080 43.439 . . . 1.0 . . . . . . . . . . . . A .  8 A H1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6138 . 1 1  8 A H2   H -27.022   3.137 42.924 . . . 1.0 . . . . . . . . . . . . A .  8 A H2   . . . . . . . . . rr_2l5z 1 
       .  8 .  6139 . 1 1  8 A H2'  H -20.909   1.308 44.127 . . . 1.0 . . . . . . . . . . . . A .  8 A H2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6140 . 1 1  8 A H3'  H -19.839  -0.669 43.294 . . . 1.0 . . . . . . . . . . . . A .  8 A H3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6141 . 1 1  8 A H4'  H -21.791  -2.445 44.305 . . . 1.0 . . . . . . . . . . . . A .  8 A H4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6142 . 1 1  8 A H5'  H -20.904  -1.762 46.660 . . . 1.0 . . . . . . . . . . . . A .  8 A H5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6143 . 1 1  8 A H5'' H -19.759  -2.439 45.484 . . . 1.0 . . . . . . . . . . . . A .  8 A H5'' . . . . . . . . . rr_2l5z 1 
       .  8 .  6144 . 1 1  8 A H61  H -26.352   5.921 46.390 . . . 1.0 . . . . . . . . . . . . A .  8 A H61  . . . . . . . . . rr_2l5z 1 
       .  8 .  6145 . 1 1  8 A H62  H -24.915   5.365 47.217 . . . 1.0 . . . . . . . . . . . . A .  8 A H62  . . . . . . . . . rr_2l5z 1 
       .  8 .  6146 . 1 1  8 A H8   H -21.891   1.675 46.445 . . . 1.0 . . . . . . . . . . . . A .  8 A H8   . . . . . . . . . rr_2l5z 1 
       .  8 .  6147 . 1 1  8 A HO2' H -21.110   0.897 41.601 . . . 1.0 . . . . . . . . . . . . A .  8 A HO2' . . . . . . . . . rr_2l5z 1 
       .  8 .  6148 . 1 1  8 A N1   N -26.365   4.155 44.596 . . . 1.0 . . . . . . . . . . . . A .  8 A N1   . . . . . . . . . rr_2l5z 1 
       .  8 .  6149 . 1 1  8 A N3   N -25.325   2.223 43.652 . . . 1.0 . . . . . . . . . . . . A .  8 A N3   . . . . . . . . . rr_2l5z 1 
       .  8 .  6150 . 1 1  8 A N6   N -25.587   5.266 46.471 . . . 1.0 . . . . . . . . . . . . A .  8 A N6   . . . . . . . . . rr_2l5z 1 
       .  8 .  6151 . 1 1  8 A N7   N -23.350   3.146 46.513 . . . 1.0 . . . . . . . . . . . . A .  8 A N7   . . . . . . . . . rr_2l5z 1 
       .  8 .  6152 . 1 1  8 A N9   N -23.351   1.568 44.911 . . . 1.0 . . . . . . . . . . . . A .  8 A N9   . . . . . . . . . rr_2l5z 1 
       .  8 .  6153 . 1 1  8 A O2'  O -21.739   1.293 42.209 . . . 1.0 . . . . . . . . . . . . A .  8 A O2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6154 . 1 1  8 A O3'  O -21.506  -1.324 42.200 . . . 1.0 . . . . . . . . . . . . A .  8 A O3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6155 . 1 1  8 A O4'  O -22.591  -0.704 45.070 . . . 1.0 . . . . . . . . . . . . A .  8 A O4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6156 . 1 1  8 A O5'  O -19.593  -0.412 45.814 . . . 1.0 . . . . . . . . . . . . A .  8 A O5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6157 . 1 1  8 A OP1  O -18.390   0.081 47.957 . . . 1.0 . . . . . . . . . . . . A .  8 A OP1  . . . . . . . . . rr_2l5z 1 
       .  8 .  6158 . 1 1  8 A OP2  O -17.600  -1.807 46.415 . . . 1.0 . . . . . . . . . . . . A .  8 A OP2  . . . . . . . . . rr_2l5z 1 
       .  8 .  6159 . 1 1  8 A P    P -18.183  -0.458 46.593 . . . 1.0 . . . . . . . . . . . . A .  8 A P    . . . . . . . . . rr_2l5z 1 
       .  8 .  6160 . 1 1  9 G C1'  C -23.534   1.875 40.099 . . . 1.0 . . . . . . . . . . . . A .  9 G C1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6161 . 1 1  9 G C2   C -24.898   6.062 39.719 . . . 1.0 . . . . . . . . . . . . A .  9 G C2   . . . . . . . . . rr_2l5z 1 
       .  8 .  6162 . 1 1  9 G C2'  C -24.792   1.002 40.128 . . . 1.0 . . . . . . . . . . . . A .  9 G C2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6163 . 1 1  9 G C3'  C -24.298  -0.334 39.598 . . . 1.0 . . . . . . . . . . . . A .  9 G C3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6164 . 1 1  9 G C4   C -24.056   4.135 38.982 . . . 1.0 . . . . . . . . . . . . A .  9 G C4   . . . . . . . . . rr_2l5z 1 
       .  8 .  6165 . 1 1  9 G C4'  C -22.851  -0.358 40.061 . . . 1.0 . . . . . . . . . . . . A .  9 G C4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6166 . 1 1  9 G C5   C -23.927   4.570 37.672 . . . 1.0 . . . . . . . . . . . . A .  9 G C5   . . . . . . . . . rr_2l5z 1 
       .  8 .  6167 . 1 1  9 G C5'  C -21.994  -1.298 39.214 . . . 1.0 . . . . . . . . . . . . A .  9 G C5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6168 . 1 1  9 G C6   C -24.323   5.891 37.332 . . . 1.0 . . . . . . . . . . . . A .  9 G C6   . . . . . . . . . rr_2l5z 1 
       .  8 .  6169 . 1 1  9 G C8   C -23.235   2.593 37.718 . . . 1.0 . . . . . . . . . . . . A .  9 G C8   . . . . . . . . . rr_2l5z 1 
       .  8 .  6170 . 1 1  9 G H1   H -25.127   7.553 38.268 . . . 1.0 . . . . . . . . . . . . A .  9 G H1   . . . . . . . . . rr_2l5z 1 
       .  8 .  6171 . 1 1  9 G H1'  H -23.449   2.415 41.042 . . . 1.0 . . . . . . . . . . . . A .  9 G H1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6172 . 1 1  9 G H2'  H -25.546   1.416 39.455 . . . 1.0 . . . . . . . . . . . . A .  9 G H2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6173 . 1 1  9 G H21  H -25.660   7.819 40.408 . . . 1.0 . . . . . . . . . . . . A .  9 G H21  . . . . . . . . . rr_2l5z 1 
       .  8 .  6174 . 1 1  9 G H22  H -25.465   6.561 41.609 . . . 1.0 . . . . . . . . . . . . A .  9 G H22  . . . . . . . . . rr_2l5z 1 
       .  8 .  6175 . 1 1  9 G H3'  H -24.388  -0.398 38.512 . . . 1.0 . . . . . . . . . . . . A .  9 G H3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6176 . 1 1  9 G H4'  H -22.807  -0.666 41.105 . . . 1.0 . . . . . . . . . . . . A .  9 G H4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6177 . 1 1  9 G H5'  H -22.517  -2.248 39.100 . . . 1.0 . . . . . . . . . . . . A .  9 G H5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6178 . 1 1  9 G H5'' H -21.844  -0.853 38.231 . . . 1.0 . . . . . . . . . . . . A .  9 G H5'' . . . . . . . . . rr_2l5z 1 
       .  8 .  6179 . 1 1  9 G H8   H -22.828   1.636 37.424 . . . 1.0 . . . . . . . . . . . . A .  9 G H8   . . . . . . . . . rr_2l5z 1 
       .  8 .  6180 . 1 1  9 G HO2' H -24.573   0.977 42.063 . . . 1.0 . . . . . . . . . . . . A .  9 G HO2' . . . . . . . . . rr_2l5z 1 
       .  8 .  6181 . 1 1  9 G N1   N -24.808   6.578 38.440 . . . 1.0 . . . . . . . . . . . . A .  9 G N1   . . . . . . . . . rr_2l5z 1 
       .  8 .  6182 . 1 1  9 G N2   N -25.380   6.880 40.655 . . . 1.0 . . . . . . . . . . . . A .  9 G N2   . . . . . . . . . rr_2l5z 1 
       .  8 .  6183 . 1 1  9 G N3   N -24.528   4.820 40.045 . . . 1.0 . . . . . . . . . . . . A .  9 G N3   . . . . . . . . . rr_2l5z 1 
       .  8 .  6184 . 1 1  9 G N7   N -23.390   3.551 36.863 . . . 1.0 . . . . . . . . . . . . A .  9 G N7   . . . . . . . . . rr_2l5z 1 
       .  8 .  6185 . 1 1  9 G N9   N -23.600   2.843 38.988 . . . 1.0 . . . . . . . . . . . . A .  9 G N9   . . . . . . . . . rr_2l5z 1 
       .  8 .  6186 . 1 1  9 G O2'  O -25.311   0.877 41.457 . . . 1.0 . . . . . . . . . . . . A .  9 G O2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6187 . 1 1  9 G O3'  O -25.011  -1.379 40.266 . . . 1.0 . . . . . . . . . . . . A .  9 G O3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6188 . 1 1  9 G O4'  O -22.410   0.993 39.955 . . . 1.0 . . . . . . . . . . . . A .  9 G O4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6189 . 1 1  9 G O5'  O -20.721  -1.536 39.820 . . . 1.0 . . . . . . . . . . . . A .  9 G O5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6190 . 1 1  9 G O6   O -24.281   6.441 36.234 . . . 1.0 . . . . . . . . . . . . A .  9 G O6   . . . . . . . . . rr_2l5z 1 
       .  8 .  6191 . 1 1  9 G OP1  O -21.290  -3.584 41.144 . . . 1.0 . . . . . . . . . . . . A .  9 G OP1  . . . . . . . . . rr_2l5z 1 
       .  8 .  6192 . 1 1  9 G OP2  O -19.211  -2.197 41.707 . . . 1.0 . . . . . . . . . . . . A .  9 G OP2  . . . . . . . . . rr_2l5z 1 
       .  8 .  6193 . 1 1  9 G P    P -20.616  -2.271 41.249 . . . 1.0 . . . . . . . . . . . . A .  9 G P    . . . . . . . . . rr_2l5z 1 
       .  8 .  6194 . 1 1 10 C C1'  C -28.749   2.488 40.125 . . . 1.0 . . . . . . . . . . . . A . 10 C C1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6195 . 1 1 10 C C2   C -29.604   3.455 38.038 . . . 1.0 . . . . . . . . . . . . A . 10 C C2   . . . . . . . . . rr_2l5z 1 
       .  8 .  6196 . 1 1 10 C C2'  C -30.061   1.995 40.741 . . . 1.0 . . . . . . . . . . . . A . 10 C C2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6197 . 1 1 10 C C3'  C -29.726   0.573 41.156 . . . 1.0 . . . . . . . . . . . . A . 10 C C3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6198 . 1 1 10 C C4   C -29.011   2.568 35.946 . . . 1.0 . . . . . . . . . . . . A . 10 C C4   . . . . . . . . . rr_2l5z 1 
       .  8 .  6199 . 1 1 10 C C4'  C -28.252   0.673 41.519 . . . 1.0 . . . . . . . . . . . . A . 10 C C4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6200 . 1 1 10 C C5   C -28.211   1.558 36.566 . . . 1.0 . . . . . . . . . . . . A . 10 C C5   . . . . . . . . . rr_2l5z 1 
       .  8 .  6201 . 1 1 10 C C5'  C -27.545  -0.680 41.422 . . . 1.0 . . . . . . . . . . . . A . 10 C C5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6202 . 1 1 10 C C6   C -28.146   1.548 37.913 . . . 1.0 . . . . . . . . . . . . A . 10 C C6   . . . . . . . . . rr_2l5z 1 
       .  8 .  6203 . 1 1 10 C H1'  H -28.543   3.503 40.467 . . . 1.0 . . . . . . . . . . . . A . 10 C H1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6204 . 1 1 10 C H2'  H -30.849   1.988 39.983 . . . 1.0 . . . . . . . . . . . . A . 10 C H2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6205 . 1 1 10 C H3'  H -29.908  -0.139 40.348 . . . 1.0 . . . . . . . . . . . . A . 10 C H3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6206 . 1 1 10 C H4'  H -28.151   1.066 42.528 . . . 1.0 . . . . . . . . . . . . A . 10 C H4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6207 . 1 1 10 C H41  H -29.662   3.332 34.176 . . . 1.0 . . . . . . . . . . . . A . 10 C H41  . . . . . . . . . rr_2l5z 1 
       .  8 .  6208 . 1 1 10 C H42  H -28.600   1.949 34.052 . . . 1.0 . . . . . . . . . . . . A . 10 C H42  . . . . . . . . . rr_2l5z 1 
       .  8 .  6209 . 1 1 10 C H5   H -27.676   0.829 35.975 . . . 1.0 . . . . . . . . . . . . A . 10 C H5   . . . . . . . . . rr_2l5z 1 
       .  8 .  6210 . 1 1 10 C H5'  H -26.524  -0.572 41.790 . . . 1.0 . . . . . . . . . . . . A . 10 C H5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6211 . 1 1 10 C H5'' H -28.074  -1.402 42.045 . . . 1.0 . . . . . . . . . . . . A . 10 C H5'' . . . . . . . . . rr_2l5z 1 
       .  8 .  6212 . 1 1 10 C H6   H -27.558   0.794 38.414 . . . 1.0 . . . . . . . . . . . . A . 10 C H6   . . . . . . . . . rr_2l5z 1 
       .  8 .  6213 . 1 1 10 C HO2' H -31.280   2.453 42.187 . . . 1.0 . . . . . . . . . . . . A . 10 C HO2' . . . . . . . . . rr_2l5z 1 
       .  8 .  6214 . 1 1 10 C N1   N -28.827   2.478 38.647 . . . 1.0 . . . . . . . . . . . . A . 10 C N1   . . . . . . . . . rr_2l5z 1 
       .  8 .  6215 . 1 1 10 C N3   N -29.674   3.470 36.680 . . . 1.0 . . . . . . . . . . . . A . 10 C N3   . . . . . . . . . rr_2l5z 1 
       .  8 .  6216 . 1 1 10 C N4   N -29.099   2.620 34.617 . . . 1.0 . . . . . . . . . . . . A . 10 C N4   . . . . . . . . . rr_2l5z 1 
       .  8 .  6217 . 1 1 10 C O2   O -30.211   4.279 38.722 . . . 1.0 . . . . . . . . . . . . A . 10 C O2   . . . . . . . . . rr_2l5z 1 
       .  8 .  6218 . 1 1 10 C O2'  O -30.442   2.794 41.867 . . . 1.0 . . . . . . . . . . . . A . 10 C O2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6219 . 1 1 10 C O3'  O -30.467   0.257 42.337 . . . 1.0 . . . . . . . . . . . . A . 10 C O3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6220 . 1 1 10 C O4'  O -27.709   1.613 40.594 . . . 1.0 . . . . . . . . . . . . A . 10 C O4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6221 . 1 1 10 C O5'  O -27.510  -1.163 40.077 . . . 1.0 . . . . . . . . . . . . A . 10 C O5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6222 . 1 1 10 C OP1  O -26.445  -3.429 40.140 . . . 1.0 . . . . . . . . . . . . A . 10 C OP1  . . . . . . . . . rr_2l5z 1 
       .  8 .  6223 . 1 1 10 C OP2  O -26.159  -1.905 38.101 . . . 1.0 . . . . . . . . . . . . A . 10 C OP2  . . . . . . . . . rr_2l5z 1 
       .  8 .  6224 . 1 1 10 C P    P -26.285  -2.075 39.566 . . . 1.0 . . . . . . . . . . . . A . 10 C P    . . . . . . . . . rr_2l5z 1 
       .  8 .  6225 . 1 1 11 A C1'  C -35.301   2.729 39.994 . . . 1.0 . . . . . . . . . . . . A . 11 A C1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6226 . 1 1 11 A C2   C -35.251   4.253 35.838 . . . 1.0 . . . . . . . . . . . . A . 11 A C2   . . . . . . . . . rr_2l5z 1 
       .  8 .  6227 . 1 1 11 A C2'  C -36.356   1.657 40.257 . . . 1.0 . . . . . . . . . . . . A . 11 A C2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6228 . 1 1 11 A C3'  C -35.665   0.755 41.262 . . . 1.0 . . . . . . . . . . . . A . 11 A C3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6229 . 1 1 11 A C4   C -34.613   2.971 37.520 . . . 1.0 . . . . . . . . . . . . A . 11 A C4   . . . . . . . . . rr_2l5z 1 
       .  8 .  6230 . 1 1 11 A C4'  C -34.828   1.740 42.072 . . . 1.0 . . . . . . . . . . . . A . 11 A C4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6231 . 1 1 11 A C5   C -33.680   2.304 36.759 . . . 1.0 . . . . . . . . . . . . A . 11 A C5   . . . . . . . . . rr_2l5z 1 
       .  8 .  6232 . 1 1 11 A C5'  C -33.606   1.073 42.706 . . . 1.0 . . . . . . . . . . . . A . 11 A C5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6233 . 1 1 11 A C6   C -33.574   2.695 35.421 . . . 1.0 . . . . . . . . . . . . A . 11 A C6   . . . . . . . . . rr_2l5z 1 
       .  8 .  6234 . 1 1 11 A C8   C -33.572   1.481 38.680 . . . 1.0 . . . . . . . . . . . . A . 11 A C8   . . . . . . . . . rr_2l5z 1 
       .  8 .  6235 . 1 1 11 A H1'  H -35.789   3.696 39.878 . . . 1.0 . . . . . . . . . . . . A . 11 A H1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6236 . 1 1 11 A H2   H -35.858   5.063 35.433 . . . 1.0 . . . . . . . . . . . . A . 11 A H2   . . . . . . . . . rr_2l5z 1 
       .  8 .  6237 . 1 1 11 A H2'  H -36.564   1.104 39.338 . . . 1.0 . . . . . . . . . . . . A . 11 A H2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6238 . 1 1 11 A H3'  H -35.058  -0.008 40.770 . . . 1.0 . . . . . . . . . . . . A . 11 A H3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6239 . 1 1 11 A H4'  H -35.445   2.182 42.854 . . . 1.0 . . . . . . . . . . . . A . 11 A H4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6240 . 1 1 11 A H5'  H -32.924   1.845 43.061 . . . 1.0 . . . . . . . . . . . . A . 11 A H5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6241 . 1 1 11 A H5'' H -33.931   0.468 43.553 . . . 1.0 . . . . . . . . . . . . A . 11 A H5'' . . . . . . . . . rr_2l5z 1 
       .  8 .  6242 . 1 1 11 A H61  H -32.674   2.458 33.611 . . . 1.0 . . . . . . . . . . . . A . 11 A H61  . . . . . . . . . rr_2l5z 1 
       .  8 .  6243 . 1 1 11 A H62  H -32.098   1.401 34.881 . . . 1.0 . . . . . . . . . . . . A . 11 A H62  . . . . . . . . . rr_2l5z 1 
       .  8 .  6244 . 1 1 11 A H8   H -33.275   0.889 39.532 . . . 1.0 . . . . . . . . . . . . A . 11 A H8   . . . . . . . . . rr_2l5z 1 
       .  8 .  6245 . 1 1 11 A HO2' H -37.587   3.141 40.520 . . . 1.0 . . . . . . . . . . . . A . 11 A HO2' . . . . . . . . . rr_2l5z 1 
       .  8 .  6246 . 1 1 11 A N1   N -34.385   3.682 34.996 . . . 1.0 . . . . . . . . . . . . A . 11 A N1   . . . . . . . . . rr_2l5z 1 
       .  8 .  6247 . 1 1 11 A N3   N -35.437   3.960 37.122 . . . 1.0 . . . . . . . . . . . . A . 11 A N3   . . . . . . . . . rr_2l5z 1 
       .  8 .  6248 . 1 1 11 A N6   N -32.712   2.140 34.568 . . . 1.0 . . . . . . . . . . . . A . 11 A N6   . . . . . . . . . rr_2l5z 1 
       .  8 .  6249 . 1 1 11 A N7   N -33.010   1.335 37.525 . . . 1.0 . . . . . . . . . . . . A . 11 A N7   . . . . . . . . . rr_2l5z 1 
       .  8 .  6250 . 1 1 11 A N9   N -34.531   2.420 38.774 . . . 1.0 . . . . . . . . . . . . A . 11 A N9   . . . . . . . . . rr_2l5z 1 
       .  8 .  6251 . 1 1 11 A O2'  O -37.556   2.222 40.797 . . . 1.0 . . . . . . . . . . . . A . 11 A O2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6252 . 1 1 11 A O3'  O -36.659   0.186 42.120 . . . 1.0 . . . . . . . . . . . . A . 11 A O3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6253 . 1 1 11 A O4'  O -34.443   2.762 41.149 . . . 1.0 . . . . . . . . . . . . A . 11 A O4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6254 . 1 1 11 A O5'  O -32.917   0.237 41.772 . . . 1.0 . . . . . . . . . . . . A . 11 A O5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6255 . 1 1 11 A OP1  O -32.047  -1.187 43.640 . . . 1.0 . . . . . . . . . . . . A . 11 A OP1  . . . . . . . . . rr_2l5z 1 
       .  8 .  6256 . 1 1 11 A OP2  O -31.480  -1.733 41.202 . . . 1.0 . . . . . . . . . . . . A . 11 A OP2  . . . . . . . . . rr_2l5z 1 
       .  8 .  6257 . 1 1 11 A P    P -31.733  -0.736 42.266 . . . 1.0 . . . . . . . . . . . . A . 11 A P    . . . . . . . . . rr_2l5z 1 
       .  8 .  6258 . 1 1 12 C C1'  C -39.239   0.329 37.138 . . . 1.0 . . . . . . . . . . . . A . 12 C C1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6259 . 1 1 12 C C2   C -37.976   0.204 35.009 . . . 1.0 . . . . . . . . . . . . A . 12 C C2   . . . . . . . . . rr_2l5z 1 
       .  8 .  6260 . 1 1 12 C C2'  C -40.320  -0.755 37.009 . . . 1.0 . . . . . . . . . . . . A . 12 C C2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6261 . 1 1 12 C C3'  C -40.425  -1.326 38.420 . . . 1.0 . . . . . . . . . . . . A . 12 C C3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6262 . 1 1 12 C C4   C -35.808  -0.697 34.940 . . . 1.0 . . . . . . . . . . . . A . 12 C C4   . . . . . . . . . rr_2l5z 1 
       .  8 .  6263 . 1 1 12 C C4'  C -39.965  -0.170 39.292 . . . 1.0 . . . . . . . . . . . . A . 12 C C4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6264 . 1 1 12 C C5   C -35.840  -0.960 36.346 . . . 1.0 . . . . . . . . . . . . A . 12 C C5   . . . . . . . . . rr_2l5z 1 
       .  8 .  6265 . 1 1 12 C C5'  C -39.437  -0.637 40.653 . . . 1.0 . . . . . . . . . . . . A . 12 C C5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6266 . 1 1 12 C C6   C -36.955  -0.624 37.023 . . . 1.0 . . . . . . . . . . . . A . 12 C C6   . . . . . . . . . rr_2l5z 1 
       .  8 .  6267 . 1 1 12 C H1'  H -39.631   1.280 36.768 . . . 1.0 . . . . . . . . . . . . A . 12 C H1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6268 . 1 1 12 C H2'  H -39.986  -1.532 36.314 . . . 1.0 . . . . . . . . . . . . A . 12 C H2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6269 . 1 1 12 C H3'  H -39.804  -2.215 38.553 . . . 1.0 . . . . . . . . . . . . A . 12 C H3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6270 . 1 1 12 C H4'  H -40.788   0.526 39.438 . . . 1.0 . . . . . . . . . . . . A . 12 C H4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6271 . 1 1 12 C H41  H -34.695  -0.828 33.241 . . . 1.0 . . . . . . . . . . . . A . 12 C H41  . . . . . . . . . rr_2l5z 1 
       .  8 .  6272 . 1 1 12 C H42  H -33.928  -1.436 34.692 . . . 1.0 . . . . . . . . . . . . A . 12 C H42  . . . . . . . . . rr_2l5z 1 
       .  8 .  6273 . 1 1 12 C H5   H -34.998  -1.414 36.847 . . . 1.0 . . . . . . . . . . . . A . 12 C H5   . . . . . . . . . rr_2l5z 1 
       .  8 .  6274 . 1 1 12 C H5'  H -39.439   0.208 41.342 . . . 1.0 . . . . . . . . . . . . A . 12 C H5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6275 . 1 1 12 C H5'' H -40.090  -1.417 41.049 . . . 1.0 . . . . . . . . . . . . A . 12 C H5'' . . . . . . . . . rr_2l5z 1 
       .  8 .  6276 . 1 1 12 C H6   H -37.020  -0.828 38.083 . . . 1.0 . . . . . . . . . . . . A . 12 C H6   . . . . . . . . . rr_2l5z 1 
       .  8 .  6277 . 1 1 12 C HO2' H -42.044  -0.886 36.115 . . . 1.0 . . . . . . . . . . . . A . 12 C HO2' . . . . . . . . . rr_2l5z 1 
       .  8 .  6278 . 1 1 12 C N1   N -38.015  -0.049 36.381 . . . 1.0 . . . . . . . . . . . . A . 12 C N1   . . . . . . . . . rr_2l5z 1 
       .  8 .  6279 . 1 1 12 C N3   N -36.853  -0.135 34.320 . . . 1.0 . . . . . . . . . . . . A . 12 C N3   . . . . . . . . . rr_2l5z 1 
       .  8 .  6280 . 1 1 12 C N4   N -34.721  -1.012 34.234 . . . 1.0 . . . . . . . . . . . . A . 12 C N4   . . . . . . . . . rr_2l5z 1 
       .  8 .  6281 . 1 1 12 C O2   O -38.941   0.722 34.450 . . . 1.0 . . . . . . . . . . . . A . 12 C O2   . . . . . . . . . rr_2l5z 1 
       .  8 .  6282 . 1 1 12 C O2'  O -41.567  -0.196 36.581 . . . 1.0 . . . . . . . . . . . . A . 12 C O2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6283 . 1 1 12 C O3'  O -41.803  -1.581 38.705 . . . 1.0 . . . . . . . . . . . . A . 12 C O3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6284 . 1 1 12 C O4'  O -38.946   0.467 38.535 . . . 1.0 . . . . . . . . . . . . A . 12 C O4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6285 . 1 1 12 C O5'  O -38.105  -1.148 40.553 . . . 1.0 . . . . . . . . . . . . A . 12 C O5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6286 . 1 1 12 C OP1  O -38.074  -1.686 43.000 . . . 1.0 . . . . . . . . . . . . A . 12 C OP1  . . . . . . . . . rr_2l5z 1 
       .  8 .  6287 . 1 1 12 C OP2  O -36.034  -2.167 41.527 . . . 1.0 . . . . . . . . . . . . A . 12 C OP2  . . . . . . . . . rr_2l5z 1 
       .  8 .  6288 . 1 1 12 C P    P -37.193  -1.313 41.870 . . . 1.0 . . . . . . . . . . . . A . 12 C P    . . . . . . . . . rr_2l5z 1 
       .  8 .  6289 . 1 1 13 G C1'  C -39.839  -3.375 33.384 . . . 1.0 . . . . . . . . . . . . A . 13 G C1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6290 . 1 1 13 G C2   C -36.395  -3.149 30.612 . . . 1.0 . . . . . . . . . . . . A . 13 G C2   . . . . . . . . . rr_2l5z 1 
       .  8 .  6291 . 1 1 13 G C2'  C -40.304  -4.763 32.930 . . . 1.0 . . . . . . . . . . . . A . 13 G C2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6292 . 1 1 13 G C3'  C -40.946  -5.342 34.182 . . . 1.0 . . . . . . . . . . . . A . 13 G C3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6293 . 1 1 13 G C4   C -37.385  -3.275 32.606 . . . 1.0 . . . . . . . . . . . . A . 13 G C4   . . . . . . . . . rr_2l5z 1 
       .  8 .  6294 . 1 1 13 G C4'  C -41.468  -4.102 34.896 . . . 1.0 . . . . . . . . . . . . A . 13 G C4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6295 . 1 1 13 G C5   C -36.191  -3.295 33.315 . . . 1.0 . . . . . . . . . . . . A . 13 G C5   . . . . . . . . . rr_2l5z 1 
       .  8 .  6296 . 1 1 13 G C5'  C -41.626  -4.328 36.401 . . . 1.0 . . . . . . . . . . . . A . 13 G C5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6297 . 1 1 13 G C6   C -34.959  -3.235 32.609 . . . 1.0 . . . . . . . . . . . . A . 13 G C6   . . . . . . . . . rr_2l5z 1 
       .  8 .  6298 . 1 1 13 G C8   C -37.729  -3.400 34.732 . . . 1.0 . . . . . . . . . . . . A . 13 G C8   . . . . . . . . . rr_2l5z 1 
       .  8 .  6299 . 1 1 13 G H1   H -34.304  -3.116 30.650 . . . 1.0 . . . . . . . . . . . . A . 13 G H1   . . . . . . . . . rr_2l5z 1 
       .  8 .  6300 . 1 1 13 G H1'  H -40.133  -2.638 32.638 . . . 1.0 . . . . . . . . . . . . A . 13 G H1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6301 . 1 1 13 G H2'  H -39.441  -5.368 32.639 . . . 1.0 . . . . . . . . . . . . A . 13 G H2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6302 . 1 1 13 G H21  H -35.500  -3.035 28.786 . . . 1.0 . . . . . . . . . . . . A . 13 G H21  . . . . . . . . . rr_2l5z 1 
       .  8 .  6303 . 1 1 13 G H22  H -37.249  -3.065 28.767 . . . 1.0 . . . . . . . . . . . . A . 13 G H22  . . . . . . . . . rr_2l5z 1 
       .  8 .  6304 . 1 1 13 G H3'  H -40.227  -5.898 34.787 . . . 1.0 . . . . . . . . . . . . A . 13 G H3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6305 . 1 1 13 G H4'  H -42.427  -3.811 34.469 . . . 1.0 . . . . . . . . . . . . A . 13 G H4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6306 . 1 1 13 G H5'  H -42.094  -5.297 36.574 . . . 1.0 . . . . . . . . . . . . A . 13 G H5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6307 . 1 1 13 G H5'' H -40.641  -4.320 36.867 . . . 1.0 . . . . . . . . . . . . A . 13 G H5'' . . . . . . . . . rr_2l5z 1 
       .  8 .  6308 . 1 1 13 G H8   H -38.267  -3.460 35.667 . . . 1.0 . . . . . . . . . . . . A . 13 G H8   . . . . . . . . . rr_2l5z 1 
       .  8 .  6309 . 1 1 13 G HO2' H -42.003  -4.179 32.181 . . . 1.0 . . . . . . . . . . . . A . 13 G HO2' . . . . . . . . . rr_2l5z 1 
       .  8 .  6310 . 1 1 13 G N1   N -35.162  -3.163 31.235 . . . 1.0 . . . . . . . . . . . . A . 13 G N1   . . . . . . . . . rr_2l5z 1 
       .  8 .  6311 . 1 1 13 G N2   N -36.380  -3.077 29.281 . . . 1.0 . . . . . . . . . . . . A . 13 G N2   . . . . . . . . . rr_2l5z 1 
       .  8 .  6312 . 1 1 13 G N3   N -37.559  -3.205 31.268 . . . 1.0 . . . . . . . . . . . . A . 13 G N3   . . . . . . . . . rr_2l5z 1 
       .  8 .  6313 . 1 1 13 G N7   N -36.437  -3.376 34.696 . . . 1.0 . . . . . . . . . . . . A . 13 G N7   . . . . . . . . . rr_2l5z 1 
       .  8 .  6314 . 1 1 13 G N9   N -38.374  -3.345 33.552 . . . 1.0 . . . . . . . . . . . . A . 13 G N9   . . . . . . . . . rr_2l5z 1 
       .  8 .  6315 . 1 1 13 G O2'  O -41.247  -4.672 31.856 . . . 1.0 . . . . . . . . . . . . A . 13 G O2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6316 . 1 1 13 G O3'  O -42.063  -6.144 33.788 . . . 1.0 . . . . . . . . . . . . A . 13 G O3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6317 . 1 1 13 G O4'  O -40.508  -3.085 34.622 . . . 1.0 . . . . . . . . . . . . A . 13 G O4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6318 . 1 1 13 G O5'  O -42.434  -3.311 37.000 . . . 1.0 . . . . . . . . . . . . A . 13 G O5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6319 . 1 1 13 G O6   O -33.818  -3.241 33.066 . . . 1.0 . . . . . . . . . . . . A . 13 G O6   . . . . . . . . . rr_2l5z 1 
       .  8 .  6320 . 1 1 13 G OP1  O -43.793  -3.052 39.087 . . . 1.0 . . . . . . . . . . . . A . 13 G OP1  . . . . . . . . . rr_2l5z 1 
       .  8 .  6321 . 1 1 13 G OP2  O -41.418  -4.009 39.180 . . . 1.0 . . . . . . . . . . . . A . 13 G OP2  . . . . . . . . . rr_2l5z 1 
       .  8 .  6322 . 1 1 13 G P    P -42.399  -3.070 38.591 . . . 1.0 . . . . . . . . . . . . A . 13 G P    . . . . . . . . . rr_2l5z 1 
       .  8 .  6323 . 1 1 14 A C1'  C -42.332  -9.102 28.659 . . . 1.0 . . . . . . . . . . . . A . 14 A C1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6324 . 1 1 14 A C2   C -44.120  -6.403 25.647 . . . 1.0 . . . . . . . . . . . . A . 14 A C2   . . . . . . . . . rr_2l5z 1 
       .  8 .  6325 . 1 1 14 A C2'  C -40.948  -8.550 28.321 . . . 1.0 . . . . . . . . . . . . A . 14 A C2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6326 . 1 1 14 A C3'  C -40.293  -8.429 29.684 . . . 1.0 . . . . . . . . . . . . A . 14 A C3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6327 . 1 1 14 A C4   C -43.816  -7.243 27.667 . . . 1.0 . . . . . . . . . . . . A . 14 A C4   . . . . . . . . . rr_2l5z 1 
       .  8 .  6328 . 1 1 14 A C4'  C -40.905  -9.592 30.459 . . . 1.0 . . . . . . . . . . . . A . 14 A C4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6329 . 1 1 14 A C5   C -44.730  -6.390 28.243 . . . 1.0 . . . . . . . . . . . . A . 14 A C5   . . . . . . . . . rr_2l5z 1 
       .  8 .  6330 . 1 1 14 A C5'  C -40.920  -9.333 31.968 . . . 1.0 . . . . . . . . . . . . A . 14 A C5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6331 . 1 1 14 A C6   C -45.363  -5.484 27.386 . . . 1.0 . . . . . . . . . . . . A . 14 A C6   . . . . . . . . . rr_2l5z 1 
       .  8 .  6332 . 1 1 14 A C8   C -43.986  -7.593 29.786 . . . 1.0 . . . . . . . . . . . . A . 14 A C8   . . . . . . . . . rr_2l5z 1 
       .  8 .  6333 . 1 1 14 A H1'  H -42.619  -9.842 27.910 . . . 1.0 . . . . . . . . . . . . A . 14 A H1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6334 . 1 1 14 A H2   H -43.899  -6.381 24.580 . . . 1.0 . . . . . . . . . . . . A . 14 A H2   . . . . . . . . . rr_2l5z 1 
       .  8 .  6335 . 1 1 14 A H2'  H -41.042  -7.563 27.862 . . . 1.0 . . . . . . . . . . . . A . 14 A H2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6336 . 1 1 14 A H3'  H -40.498  -7.458 30.144 . . . 1.0 . . . . . . . . . . . . A . 14 A H3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6337 . 1 1 14 A H4'  H -40.340 -10.500 30.255 . . . 1.0 . . . . . . . . . . . . A . 14 A H4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6338 . 1 1 14 A H5'  H -41.444 -10.151 32.463 . . . 1.0 . . . . . . . . . . . . A . 14 A H5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6339 . 1 1 14 A H5'' H -39.894  -9.296 32.333 . . . 1.0 . . . . . . . . . . . . A . 14 A H5'' . . . . . . . . . rr_2l5z 1 
       .  8 .  6340 . 1 1 14 A H61  H -46.698  -3.967 27.142 . . . 1.0 . . . . . . . . . . . . A . 14 A H61  . . . . . . . . . rr_2l5z 1 
       .  8 .  6341 . 1 1 14 A H62  H -46.528  -4.563 28.777 . . . 1.0 . . . . . . . . . . . . A . 14 A H62  . . . . . . . . . rr_2l5z 1 
       .  8 .  6342 . 1 1 14 A H8   H -43.813  -8.036 30.757 . . . 1.0 . . . . . . . . . . . . A . 14 A H8   . . . . . . . . . rr_2l5z 1 
       .  8 .  6343 . 1 1 14 A HO2' H -40.858 -10.054 27.087 . . . 1.0 . . . . . . . . . . . . A . 14 A HO2' . . . . . . . . . rr_2l5z 1 
       .  8 .  6344 . 1 1 14 A N1   N -45.026  -5.525 26.084 . . . 1.0 . . . . . . . . . . . . A . 14 A N1   . . . . . . . . . rr_2l5z 1 
       .  8 .  6345 . 1 1 14 A N3   N -43.460  -7.305 26.368 . . . 1.0 . . . . . . . . . . . . A . 14 A N3   . . . . . . . . . rr_2l5z 1 
       .  8 .  6346 . 1 1 14 A N6   N -46.270  -4.600 27.802 . . . 1.0 . . . . . . . . . . . . A . 14 A N6   . . . . . . . . . rr_2l5z 1 
       .  8 .  6347 . 1 1 14 A N7   N -44.832  -6.628 29.625 . . . 1.0 . . . . . . . . . . . . A . 14 A N7   . . . . . . . . . rr_2l5z 1 
       .  8 .  6348 . 1 1 14 A N9   N -43.337  -8.022 28.688 . . . 1.0 . . . . . . . . . . . . A . 14 A N9   . . . . . . . . . rr_2l5z 1 
       .  8 .  6349 . 1 1 14 A O2'  O -40.222  -9.443 27.468 . . . 1.0 . . . . . . . . . . . . A . 14 A O2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6350 . 1 1 14 A O3'  O -38.891  -8.672 29.535 . . . 1.0 . . . . . . . . . . . . A . 14 A O3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6351 . 1 1 14 A O4'  O -42.229  -9.740 29.943 . . . 1.0 . . . . . . . . . . . . A . 14 A O4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6352 . 1 1 14 A O5'  O -41.573  -8.100 32.285 . . . 1.0 . . . . . . . . . . . . A . 14 A O5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6353 . 1 1 14 A OP1  O -43.311  -8.296 34.078 . . . 1.0 . . . . . . . . . . . . A . 14 A OP1  . . . . . . . . . rr_2l5z 1 
       .  8 .  6354 . 1 1 14 A OP2  O -40.825  -8.132 34.676 . . . 1.0 . . . . . . . . . . . . A . 14 A OP2  . . . . . . . . . rr_2l5z 1 
       .  8 .  6355 . 1 1 14 A P    P -41.962  -7.751 33.808 . . . 1.0 . . . . . . . . . . . . A . 14 A P    . . . . . . . . . rr_2l5z 1 
       .  8 .  6356 . 1 1 15 A C1'  C -40.906  -5.139 26.169 . . . 1.0 . . . . . . . . . . . . A . 15 A C1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6357 . 1 1 15 A C2   C -43.525  -1.582 26.391 . . . 1.0 . . . . . . . . . . . . A . 15 A C2   . . . . . . . . . rr_2l5z 1 
       .  8 .  6358 . 1 1 15 A C2'  C -39.819  -4.309 25.479 . . . 1.0 . . . . . . . . . . . . A . 15 A C2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6359 . 1 1 15 A C3'  C -38.523  -5.003 25.888 . . . 1.0 . . . . . . . . . . . . A . 15 A C3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6360 . 1 1 15 A C4   C -42.353  -3.270 27.199 . . . 1.0 . . . . . . . . . . . . A . 15 A C4   . . . . . . . . . rr_2l5z 1 
       .  8 .  6361 . 1 1 15 A C4'  C -38.967  -6.437 26.145 . . . 1.0 . . . . . . . . . . . . A . 15 A C4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6362 . 1 1 15 A C5   C -42.684  -2.978 28.502 . . . 1.0 . . . . . . . . . . . . A . 15 A C5   . . . . . . . . . rr_2l5z 1 
       .  8 .  6363 . 1 1 15 A C5'  C -38.032  -7.164 27.116 . . . 1.0 . . . . . . . . . . . . A . 15 A C5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6364 . 1 1 15 A C6   C -43.518  -1.872 28.700 . . . 1.0 . . . . . . . . . . . . A . 15 A C6   . . . . . . . . . rr_2l5z 1 
       .  8 .  6365 . 1 1 15 A C8   C -41.442  -4.660 28.570 . . . 1.0 . . . . . . . . . . . . A . 15 A C8   . . . . . . . . . rr_2l5z 1 
       .  8 .  6366 . 1 1 15 A H1'  H -41.665  -5.415 25.437 . . . 1.0 . . . . . . . . . . . . A . 15 A H1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6367 . 1 1 15 A H2   H -43.874  -0.975 25.554 . . . 1.0 . . . . . . . . . . . . A . 15 A H2   . . . . . . . . . rr_2l5z 1 
       .  8 .  6368 . 1 1 15 A H2'  H -39.835  -3.283 25.861 . . . 1.0 . . . . . . . . . . . . A . 15 A H2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6369 . 1 1 15 A H3'  H -38.072  -4.537 26.770 . . . 1.0 . . . . . . . . . . . . A . 15 A H3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6370 . 1 1 15 A H4'  H -39.005  -6.981 25.202 . . . 1.0 . . . . . . . . . . . . A . 15 A H4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6371 . 1 1 15 A H5'  H -38.337  -8.208 27.187 . . . 1.0 . . . . . . . . . . . . A . 15 A H5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6372 . 1 1 15 A H5'' H -37.014  -7.115 26.731 . . . 1.0 . . . . . . . . . . . . A . 15 A H5'' . . . . . . . . . rr_2l5z 1 
       .  8 .  6373 . 1 1 15 A H61  H -44.526  -0.665 29.993 . . . 1.0 . . . . . . . . . . . . A . 15 A H61  . . . . . . . . . rr_2l5z 1 
       .  8 .  6374 . 1 1 15 A H62  H -43.626  -1.971 30.731 . . . 1.0 . . . . . . . . . . . . A . 15 A H62  . . . . . . . . . rr_2l5z 1 
       .  8 .  6375 . 1 1 15 A H8   H -40.832  -5.478 28.926 . . . 1.0 . . . . . . . . . . . . A . 15 A H8   . . . . . . . . . rr_2l5z 1 
       .  8 .  6376 . 1 1 15 A HO2' H -40.926  -4.374 23.878 . . . 1.0 . . . . . . . . . . . . A . 15 A HO2' . . . . . . . . . rr_2l5z 1 
       .  8 .  6377 . 1 1 15 A N1   N -43.920  -1.197 27.608 . . . 1.0 . . . . . . . . . . . . A . 15 A N1   . . . . . . . . . rr_2l5z 1 
       .  8 .  6378 . 1 1 15 A N3   N -42.740  -2.612 26.089 . . . 1.0 . . . . . . . . . . . . A . 15 A N3   . . . . . . . . . rr_2l5z 1 
       .  8 .  6379 . 1 1 15 A N6   N -43.923  -1.470 29.905 . . . 1.0 . . . . . . . . . . . . A . 15 A N6   . . . . . . . . . rr_2l5z 1 
       .  8 .  6380 . 1 1 15 A N7   N -42.085  -3.891 29.387 . . . 1.0 . . . . . . . . . . . . A . 15 A N7   . . . . . . . . . rr_2l5z 1 
       .  8 .  6381 . 1 1 15 A N9   N -41.542  -4.374 27.259 . . . 1.0 . . . . . . . . . . . . A . 15 A N9   . . . . . . . . . rr_2l5z 1 
       .  8 .  6382 . 1 1 15 A O2'  O -39.984  -4.320 24.056 . . . 1.0 . . . . . . . . . . . . A . 15 A O2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6383 . 1 1 15 A O3'  O -37.639  -5.002 24.764 . . . 1.0 . . . . . . . . . . . . A . 15 A O3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6384 . 1 1 15 A O4'  O -40.283  -6.329 26.675 . . . 1.0 . . . . . . . . . . . . A . 15 A O4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6385 . 1 1 15 A O5'  O -38.067  -6.576 28.419 . . . 1.0 . . . . . . . . . . . . A . 15 A O5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6386 . 1 1 15 A OP1  O -36.466  -8.054 29.655 . . . 1.0 . . . . . . . . . . . . A . 15 A OP1  . . . . . . . . . rr_2l5z 1 
       .  8 .  6387 . 1 1 15 A OP2  O -38.231  -6.689 30.916 . . . 1.0 . . . . . . . . . . . . A . 15 A OP2  . . . . . . . . . rr_2l5z 1 
       .  8 .  6388 . 1 1 15 A P    P -37.828  -7.478 29.731 . . . 1.0 . . . . . . . . . . . . A . 15 A P    . . . . . . . . . rr_2l5z 1 
       .  8 .  6389 . 1 1 16 A C1'  C -40.165  -0.688 25.217 . . . 1.0 . . . . . . . . . . . . A . 16 A C1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6390 . 1 1 16 A C2   C -41.356   0.303 29.359 . . . 1.0 . . . . . . . . . . . . A . 16 A C2   . . . . . . . . . rr_2l5z 1 
       .  8 .  6391 . 1 1 16 A C2'  C -39.661   0.542 24.470 . . . 1.0 . . . . . . . . . . . . A . 16 A C2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6392 . 1 1 16 A C3'  C -38.539  -0.025 23.618 . . . 1.0 . . . . . . . . . . . . A . 16 A C3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6393 . 1 1 16 A C4   C -40.012  -0.456 27.779 . . . 1.0 . . . . . . . . . . . . A . 16 A C4   . . . . . . . . . rr_2l5z 1 
       .  8 .  6394 . 1 1 16 A C4'  C -39.020  -1.445 23.307 . . . 1.0 . . . . . . . . . . . . A . 16 A C4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6395 . 1 1 16 A C5   C -39.022  -0.793 28.675 . . . 1.0 . . . . . . . . . . . . A . 16 A C5   . . . . . . . . . rr_2l5z 1 
       .  8 .  6396 . 1 1 16 A C5'  C -37.859  -2.429 23.131 . . . 1.0 . . . . . . . . . . . . A . 16 A C5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6397 . 1 1 16 A C6   C -39.287  -0.529 30.023 . . . 1.0 . . . . . . . . . . . . A . 16 A C6   . . . . . . . . . rr_2l5z 1 
       .  8 .  6398 . 1 1 16 A C8   C -38.309  -1.314 26.778 . . . 1.0 . . . . . . . . . . . . A . 16 A C8   . . . . . . . . . rr_2l5z 1 
       .  8 .  6399 . 1 1 16 A H1'  H -41.244  -0.616 25.341 . . . 1.0 . . . . . . . . . . . . A . 16 A H1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6400 . 1 1 16 A H2   H -42.298   0.750 29.676 . . . 1.0 . . . . . . . . . . . . A . 16 A H2   . . . . . . . . . rr_2l5z 1 
       .  8 .  6401 . 1 1 16 A H2'  H -39.262   1.274 25.178 . . . 1.0 . . . . . . . . . . . . A . 16 A H2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6402 . 1 1 16 A H3'  H -37.581  -0.003 24.149 . . . 1.0 . . . . . . . . . . . . A . 16 A H3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6403 . 1 1 16 A H4'  H -39.617  -1.430 22.396 . . . 1.0 . . . . . . . . . . . . A . 16 A H4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6404 . 1 1 16 A H5'  H -38.257  -3.401 22.836 . . . 1.0 . . . . . . . . . . . . A . 16 A H5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6405 . 1 1 16 A H5'' H -37.196  -2.062 22.347 . . . 1.0 . . . . . . . . . . . . A . 16 A H5'' . . . . . . . . . rr_2l5z 1 
       .  8 .  6406 . 1 1 16 A H61  H -38.666  -0.592 31.961 . . . 1.0 . . . . . . . . . . . . A . 16 A H61  . . . . . . . . . rr_2l5z 1 
       .  8 .  6407 . 1 1 16 A H62  H -37.532  -1.223 30.788 . . . 1.0 . . . . . . . . . . . . A . 16 A H62  . . . . . . . . . rr_2l5z 1 
       .  8 .  6408 . 1 1 16 A H8   H -37.685  -1.679 25.975 . . . 1.0 . . . . . . . . . . . . A . 16 A H8   . . . . . . . . . rr_2l5z 1 
       .  8 .  6409 . 1 1 16 A HO2' H -41.433   0.513 23.663 . . . 1.0 . . . . . . . . . . . . A . 16 A HO2' . . . . . . . . . rr_2l5z 1 
       .  8 .  6410 . 1 1 16 A N1   N -40.476   0.025 30.324 . . . 1.0 . . . . . . . . . . . . A . 16 A N1   . . . . . . . . . rr_2l5z 1 
       .  8 .  6411 . 1 1 16 A N3   N -41.209   0.098 28.053 . . . 1.0 . . . . . . . . . . . . A . 16 A N3   . . . . . . . . . rr_2l5z 1 
       .  8 .  6412 . 1 1 16 A N6   N -38.425  -0.803 31.003 . . . 1.0 . . . . . . . . . . . . A . 16 A N6   . . . . . . . . . rr_2l5z 1 
       .  8 .  6413 . 1 1 16 A N7   N -37.916  -1.350 28.010 . . . 1.0 . . . . . . . . . . . . A . 16 A N7   . . . . . . . . . rr_2l5z 1 
       .  8 .  6414 . 1 1 16 A N9   N -39.531  -0.804 26.544 . . . 1.0 . . . . . . . . . . . . A . 16 A N9   . . . . . . . . . rr_2l5z 1 
       .  8 .  6415 . 1 1 16 A O2'  O -40.691   1.122 23.660 . . . 1.0 . . . . . . . . . . . . A . 16 A O2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6416 . 1 1 16 A O3'  O -38.493   0.712 22.393 . . . 1.0 . . . . . . . . . . . . A . 16 A O3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6417 . 1 1 16 A O4'  O -39.857  -1.828 24.402 . . . 1.0 . . . . . . . . . . . . A . 16 A O4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6418 . 1 1 16 A O5'  O -37.113  -2.579 24.342 . . . 1.0 . . . . . . . . . . . . A . 16 A O5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6419 . 1 1 16 A OP1  O -35.539  -4.362 23.555 . . . 1.0 . . . . . . . . . . . . A . 16 A OP1  . . . . . . . . . rr_2l5z 1 
       .  8 .  6420 . 1 1 16 A OP2  O -35.814  -3.869 26.054 . . . 1.0 . . . . . . . . . . . . A . 16 A OP2  . . . . . . . . . rr_2l5z 1 
       .  8 .  6421 . 1 1 16 A P    P -36.398  -3.977 24.698 . . . 1.0 . . . . . . . . . . . . A . 16 A P    . . . . . . . . . rr_2l5z 1 
       .  8 .  6422 . 1 1 17 G C1'  C -37.560   2.678 26.778 . . . 1.0 . . . . . . . . . . . . A . 17 G C1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6423 . 1 1 17 G C2   C -38.051   1.934 31.115 . . . 1.0 . . . . . . . . . . . . A . 17 G C2   . . . . . . . . . rr_2l5z 1 
       .  8 .  6424 . 1 1 17 G C2'  C -37.247   4.157 26.570 . . . 1.0 . . . . . . . . . . . . A . 17 G C2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6425 . 1 1 17 G C3'  C -36.228   4.103 25.449 . . . 1.0 . . . . . . . . . . . . A . 17 G C3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6426 . 1 1 17 G C4   C -36.965   1.920 29.168 . . . 1.0 . . . . . . . . . . . . A . 17 G C4   . . . . . . . . . rr_2l5z 1 
       .  8 .  6427 . 1 1 17 G C4'  C -36.763   2.966 24.592 . . . 1.0 . . . . . . . . . . . . A . 17 G C4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6428 . 1 1 17 G C5   C -35.816   1.345 29.694 . . . 1.0 . . . . . . . . . . . . A . 17 G C5   . . . . . . . . . rr_2l5z 1 
       .  8 .  6429 . 1 1 17 G C5'  C -35.664   2.329 23.739 . . . 1.0 . . . . . . . . . . . . A . 17 G C5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6430 . 1 1 17 G C6   C -35.765   1.025 31.076 . . . 1.0 . . . . . . . . . . . . A . 17 G C6   . . . . . . . . . rr_2l5z 1 
       .  8 .  6431 . 1 1 17 G C8   C -35.454   1.643 27.654 . . . 1.0 . . . . . . . . . . . . A . 17 G C8   . . . . . . . . . rr_2l5z 1 
       .  8 .  6432 . 1 1 17 G H1   H -36.990   1.152 32.736 . . . 1.0 . . . . . . . . . . . . A . 17 G H1   . . . . . . . . . rr_2l5z 1 
       .  8 .  6433 . 1 1 17 G H1'  H -38.608   2.561 27.058 . . . 1.0 . . . . . . . . . . . . A . 17 G H1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6434 . 1 1 17 G H2'  H -36.795   4.578 27.471 . . . 1.0 . . . . . . . . . . . . A . 17 G H2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6435 . 1 1 17 G H21  H -39.053   1.948 32.887 . . . 1.0 . . . . . . . . . . . . A . 17 G H21  . . . . . . . . . rr_2l5z 1 
       .  8 .  6436 . 1 1 17 G H22  H -39.934   2.596 31.521 . . . 1.0 . . . . . . . . . . . . A . 17 G H22  . . . . . . . . . rr_2l5z 1 
       .  8 .  6437 . 1 1 17 G H3'  H -35.222   3.904 25.826 . . . 1.0 . . . . . . . . . . . . A . 17 G H3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6438 . 1 1 17 G H4'  H -37.553   3.344 23.946 . . . 1.0 . . . . . . . . . . . . A . 17 G H4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6439 . 1 1 17 G H5'  H -35.339   3.046 22.986 . . . 1.0 . . . . . . . . . . . . A . 17 G H5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6440 . 1 1 17 G H5'' H -34.819   2.080 24.380 . . . 1.0 . . . . . . . . . . . . A . 17 G H5'' . . . . . . . . . rr_2l5z 1 
       .  8 .  6441 . 1 1 17 G H8   H -34.981   1.663 26.685 . . . 1.0 . . . . . . . . . . . . A . 17 G H8   . . . . . . . . . rr_2l5z 1 
       .  8 .  6442 . 1 1 17 G HO2' H -38.371   5.747 26.625 . . . 1.0 . . . . . . . . . . . . A . 17 G HO2' . . . . . . . . . rr_2l5z 1 
       .  8 .  6443 . 1 1 17 G N1   N -36.950   1.360 31.720 . . . 1.0 . . . . . . . . . . . . A . 17 G N1   . . . . . . . . . rr_2l5z 1 
       .  8 .  6444 . 1 1 17 G N2   N -39.098   2.179 31.905 . . . 1.0 . . . . . . . . . . . . A . 17 G N2   . . . . . . . . . rr_2l5z 1 
       .  8 .  6445 . 1 1 17 G N3   N -38.108   2.239 29.814 . . . 1.0 . . . . . . . . . . . . A . 17 G N3   . . . . . . . . . rr_2l5z 1 
       .  8 .  6446 . 1 1 17 G N7   N -34.846   1.174 28.693 . . . 1.0 . . . . . . . . . . . . A . 17 G N7   . . . . . . . . . rr_2l5z 1 
       .  8 .  6447 . 1 1 17 G N9   N -36.705   2.105 27.835 . . . 1.0 . . . . . . . . . . . . A . 17 G N9   . . . . . . . . . rr_2l5z 1 
       .  8 .  6448 . 1 1 17 G O2'  O -38.414   4.894 26.186 . . . 1.0 . . . . . . . . . . . . A . 17 G O2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6449 . 1 1 17 G O3'  O -36.300   5.316 24.695 . . . 1.0 . . . . . . . . . . . . A . 17 G O3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6450 . 1 1 17 G O4'  O -37.323   2.029 25.517 . . . 1.0 . . . . . . . . . . . . A . 17 G O4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6451 . 1 1 17 G O5'  O -36.121   1.143 23.089 . . . 1.0 . . . . . . . . . . . . A . 17 G O5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6452 . 1 1 17 G O6   O -34.841   0.517 31.709 . . . 1.0 . . . . . . . . . . . . A . 17 G O6   . . . . . . . . . rr_2l5z 1 
       .  8 .  6453 . 1 1 17 G OP1  O -37.242   2.662 21.443 . . . 1.0 . . . . . . . . . . . . A . 17 G OP1  . . . . . . . . . rr_2l5z 1 
       .  8 .  6454 . 1 1 17 G OP2  O -36.615   0.262 20.797 . . . 1.0 . . . . . . . . . . . . A . 17 G OP2  . . . . . . . . . rr_2l5z 1 
       .  8 .  6455 . 1 1 17 G P    P -37.089   1.235 21.806 . . . 1.0 . . . . . . . . . . . . A . 17 G P    . . . . . . . . . rr_2l5z 1 
       .  8 .  6456 . 1 1 18 U C1'  C -36.395   6.935 30.019 . . . 1.0 . . . . . . . . . . . . A . 18 U C1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6457 . 1 1 18 U C2   C -35.610   5.442 31.832 . . . 1.0 . . . . . . . . . . . . A . 18 U C2   . . . . . . . . . rr_2l5z 1 
       .  8 .  6458 . 1 1 18 U C2'  C -35.616   8.245 30.222 . . . 1.0 . . . . . . . . . . . . A . 18 U C2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6459 . 1 1 18 U C3'  C -35.361   8.734 28.798 . . . 1.0 . . . . . . . . . . . . A . 18 U C3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6460 . 1 1 18 U C4   C -34.066   3.575 31.365 . . . 1.0 . . . . . . . . . . . . A . 18 U C4   . . . . . . . . . rr_2l5z 1 
       .  8 .  6461 . 1 1 18 U C4'  C -36.508   8.117 28.024 . . . 1.0 . . . . . . . . . . . . A . 18 U C4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6462 . 1 1 18 U C5   C -34.106   3.986 29.979 . . . 1.0 . . . . . . . . . . . . A . 18 U C5   . . . . . . . . . rr_2l5z 1 
       .  8 .  6463 . 1 1 18 U C5'  C -36.202   8.008 26.531 . . . 1.0 . . . . . . . . . . . . A . 18 U C5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6464 . 1 1 18 U C6   C -34.851   5.046 29.586 . . . 1.0 . . . . . . . . . . . . A . 18 U C6   . . . . . . . . . rr_2l5z 1 
       .  8 .  6465 . 1 1 18 U H1'  H -37.340   6.988 30.563 . . . 1.0 . . . . . . . . . . . . A . 18 U H1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6466 . 1 1 18 U H2'  H -34.667   8.038 30.723 . . . 1.0 . . . . . . . . . . . . A . 18 U H2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6467 . 1 1 18 U H3   H -34.851   4.096 33.214 . . . 1.0 . . . . . . . . . . . . A . 18 U H3   . . . . . . . . . rr_2l5z 1 
       .  8 .  6468 . 1 1 18 U H3'  H -34.387   8.412 28.423 . . . 1.0 . . . . . . . . . . . . A . 18 U H3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6469 . 1 1 18 U H4'  H -37.411   8.705 28.171 . . . 1.0 . . . . . . . . . . . . A . 18 U H4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6470 . 1 1 18 U H5   H -33.532   3.439 29.245 . . . 1.0 . . . . . . . . . . . . A . 18 U H5   . . . . . . . . . rr_2l5z 1 
       .  8 .  6471 . 1 1 18 U H5'  H -37.127   7.800 25.994 . . . 1.0 . . . . . . . . . . . . A . 18 U H5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6472 . 1 1 18 U H5'' H -35.795   8.957 26.183 . . . 1.0 . . . . . . . . . . . . A . 18 U H5'' . . . . . . . . . rr_2l5z 1 
       .  8 .  6473 . 1 1 18 U H6   H -34.850   5.334 28.546 . . . 1.0 . . . . . . . . . . . . A . 18 U H6   . . . . . . . . . rr_2l5z 1 
       .  8 .  6474 . 1 1 18 U HO2' H -35.794   9.608 31.600 . . . 1.0 . . . . . . . . . . . . A . 18 U HO2' . . . . . . . . . rr_2l5z 1 
       .  8 .  6475 . 1 1 18 U N1   N -35.593   5.769 30.479 . . . 1.0 . . . . . . . . . . . . A . 18 U N1   . . . . . . . . . rr_2l5z 1 
       .  8 .  6476 . 1 1 18 U N3   N -34.841   4.355 32.206 . . . 1.0 . . . . . . . . . . . . A . 18 U N3   . . . . . . . . . rr_2l5z 1 
       .  8 .  6477 . 1 1 18 U O2   O -36.269   6.081 32.650 . . . 1.0 . . . . . . . . . . . . A . 18 U O2   . . . . . . . . . rr_2l5z 1 
       .  8 .  6478 . 1 1 18 U O2'  O -36.385   9.196 30.967 . . . 1.0 . . . . . . . . . . . . A . 18 U O2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6479 . 1 1 18 U O3'  O -35.508  10.157 28.770 . . . 1.0 . . . . . . . . . . . . A . 18 U O3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6480 . 1 1 18 U O4   O -33.420   2.628 31.806 . . . 1.0 . . . . . . . . . . . . A . 18 U O4   . . . . . . . . . rr_2l5z 1 
       .  8 .  6481 . 1 1 18 U O4'  O -36.682   6.838 28.615 . . . 1.0 . . . . . . . . . . . . A . 18 U O4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6482 . 1 1 18 U O5'  O -35.262   6.969 26.262 . . . 1.0 . . . . . . . . . . . . A . 18 U O5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6483 . 1 1 18 U OP1  O -35.393   7.479 23.814 . . . 1.0 . . . . . . . . . . . . A . 18 U OP1  . . . . . . . . . rr_2l5z 1 
       .  8 .  6484 . 1 1 18 U OP2  O -33.818   5.658 24.693 . . . 1.0 . . . . . . . . . . . . A . 18 U OP2  . . . . . . . . . rr_2l5z 1 
       .  8 .  6485 . 1 1 18 U P    P -35.102   6.388 24.771 . . . 1.0 . . . . . . . . . . . . A . 18 U P    . . . . . . . . . rr_2l5z 1 
       .  8 .  6486 . 1 1 19 G C1'  C -34.092   9.741 34.142 . . . 1.0 . . . . . . . . . . . . A . 19 G C1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6487 . 1 1 19 G C2   C -31.943   6.666 36.479 . . . 1.0 . . . . . . . . . . . . A . 19 G C2   . . . . . . . . . rr_2l5z 1 
       .  8 .  6488 . 1 1 19 G C2'  C -33.437  11.019 34.676 . . . 1.0 . . . . . . . . . . . . A . 19 G C2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6489 . 1 1 19 G C3'  C -33.557  11.980 33.504 . . . 1.0 . . . . . . . . . . . . A . 19 G C3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6490 . 1 1 19 G C4   C -32.467   7.808 34.639 . . . 1.0 . . . . . . . . . . . . A . 19 G C4   . . . . . . . . . rr_2l5z 1 
       .  8 .  6491 . 1 1 19 G C4'  C -34.841  11.525 32.832 . . . 1.0 . . . . . . . . . . . . A . 19 G C4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6492 . 1 1 19 G C5   C -31.597   7.099 33.823 . . . 1.0 . . . . . . . . . . . . A . 19 G C5   . . . . . . . . . rr_2l5z 1 
       .  8 .  6493 . 1 1 19 G C5'  C -34.896  11.945 31.362 . . . 1.0 . . . . . . . . . . . . A . 19 G C5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6494 . 1 1 19 G C6   C -30.808   6.058 34.382 . . . 1.0 . . . . . . . . . . . . A . 19 G C6   . . . . . . . . . rr_2l5z 1 
       .  8 .  6495 . 1 1 19 G C8   C -32.542   8.515 32.603 . . . 1.0 . . . . . . . . . . . . A . 19 G C8   . . . . . . . . . rr_2l5z 1 
       .  8 .  6496 . 1 1 19 G H1   H -30.517   5.160 36.221 . . . 1.0 . . . . . . . . . . . . A . 19 G H1   . . . . . . . . . rr_2l5z 1 
       .  8 .  6497 . 1 1 19 G H1'  H -34.771   9.342 34.895 . . . 1.0 . . . . . . . . . . . . A . 19 G H1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6498 . 1 1 19 G H2'  H -32.384  10.831 34.901 . . . 1.0 . . . . . . . . . . . . A . 19 G H2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6499 . 1 1 19 G H21  H -31.469   5.630 38.167 . . . 1.0 . . . . . . . . . . . . A . 19 G H21  . . . . . . . . . rr_2l5z 1 
       .  8 .  6500 . 1 1 19 G H22  H -32.666   6.889 38.370 . . . 1.0 . . . . . . . . . . . . A . 19 G H22  . . . . . . . . . rr_2l5z 1 
       .  8 .  6501 . 1 1 19 G H3'  H -32.692  11.917 32.838 . . . 1.0 . . . . . . . . . . . . A . 19 G H3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6502 . 1 1 19 G H4'  H -35.697  11.939 33.362 . . . 1.0 . . . . . . . . . . . . A . 19 G H4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6503 . 1 1 19 G H5'  H -35.921  11.844 31.003 . . . 1.0 . . . . . . . . . . . . A . 19 G H5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6504 . 1 1 19 G H5'' H -34.592  12.989 31.278 . . . 1.0 . . . . . . . . . . . . A . 19 G H5'' . . . . . . . . . rr_2l5z 1 
       .  8 .  6505 . 1 1 19 G H8   H -32.841   9.102 31.749 . . . 1.0 . . . . . . . . . . . . A . 19 G H8   . . . . . . . . . rr_2l5z 1 
       .  8 .  6506 . 1 1 19 G HO2' H -34.902  10.966 35.958 . . . 1.0 . . . . . . . . . . . . A . 19 G HO2' . . . . . . . . . rr_2l5z 1 
       .  8 .  6507 . 1 1 19 G N1   N -31.052   5.909 35.742 . . . 1.0 . . . . . . . . . . . . A . 19 G N1   . . . . . . . . . rr_2l5z 1 
       .  8 .  6508 . 1 1 19 G N2   N -32.033   6.370 37.777 . . . 1.0 . . . . . . . . . . . . A . 19 G N2   . . . . . . . . . rr_2l5z 1 
       .  8 .  6509 . 1 1 19 G N3   N -32.689   7.646 35.962 . . . 1.0 . . . . . . . . . . . . A . 19 G N3   . . . . . . . . . rr_2l5z 1 
       .  8 .  6510 . 1 1 19 G N7   N -31.660   7.574 32.503 . . . 1.0 . . . . . . . . . . . . A . 19 G N7   . . . . . . . . . rr_2l5z 1 
       .  8 .  6511 . 1 1 19 G N9   N -33.073   8.725 33.821 . . . 1.0 . . . . . . . . . . . . A . 19 G N9   . . . . . . . . . rr_2l5z 1 
       .  8 .  6512 . 1 1 19 G O2'  O -34.124  11.515 35.830 . . . 1.0 . . . . . . . . . . . . A . 19 G O2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6513 . 1 1 19 G O3'  O -33.753  13.300 34.015 . . . 1.0 . . . . . . . . . . . . A . 19 G O3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6514 . 1 1 19 G O4'  O -34.844  10.107 32.973 . . . 1.0 . . . . . . . . . . . . A . 19 G O4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6515 . 1 1 19 G O5'  O -34.037  11.142 30.550 . . . 1.0 . . . . . . . . . . . . A . 19 G O5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6516 . 1 1 19 G O6   O -29.993   5.330 33.819 . . . 1.0 . . . . . . . . . . . . A . 19 G O6   . . . . . . . . . rr_2l5z 1 
       .  8 .  6517 . 1 1 19 G OP1  O -34.593  12.473 28.503 . . . 1.0 . . . . . . . . . . . . A . 19 G OP1  . . . . . . . . . rr_2l5z 1 
       .  8 .  6518 . 1 1 19 G OP2  O -33.052  10.430 28.361 . . . 1.0 . . . . . . . . . . . . A . 19 G OP2  . . . . . . . . . rr_2l5z 1 
       .  8 .  6519 . 1 1 19 G P    P -34.225  11.112 28.953 . . . 1.0 . . . . . . . . . . . . A . 19 G P    . . . . . . . . . rr_2l5z 1 
       .  8 .  6520 . 1 1 20 A C1'  C -30.670  11.311 38.060 . . . 1.0 . . . . . . . . . . . . A . 20 A C1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6521 . 1 1 20 A C2   C -27.704   8.088 38.613 . . . 1.0 . . . . . . . . . . . . A . 20 A C2   . . . . . . . . . rr_2l5z 1 
       .  8 .  6522 . 1 1 20 A C2'  C -30.006  12.561 38.654 . . . 1.0 . . . . . . . . . . . . A . 20 A C2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6523 . 1 1 20 A C3'  C -30.787  13.713 38.029 . . . 1.0 . . . . . . . . . . . . A . 20 A C3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6524 . 1 1 20 A C4   C -28.854   9.585 37.471 . . . 1.0 . . . . . . . . . . . . A . 20 A C4   . . . . . . . . . rr_2l5z 1 
       .  8 .  6525 . 1 1 20 A C4'  C -32.136  13.083 37.718 . . . 1.0 . . . . . . . . . . . . A . 20 A C4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6526 . 1 1 20 A C5   C -28.248   9.255 36.280 . . . 1.0 . . . . . . . . . . . . A . 20 A C5   . . . . . . . . . rr_2l5z 1 
       .  8 .  6527 . 1 1 20 A C5'  C -32.875  13.828 36.606 . . . 1.0 . . . . . . . . . . . . A . 20 A C5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6528 . 1 1 20 A C6   C -27.289   8.238 36.329 . . . 1.0 . . . . . . . . . . . . A . 20 A C6   . . . . . . . . . rr_2l5z 1 
       .  8 .  6529 . 1 1 20 A C8   C -29.606  10.789 35.852 . . . 1.0 . . . . . . . . . . . . A . 20 A C8   . . . . . . . . . rr_2l5z 1 
       .  8 .  6530 . 1 1 20 A H1'  H -30.981  10.651 38.870 . . . 1.0 . . . . . . . . . . . . A . 20 A H1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6531 . 1 1 20 A H2   H -27.457   7.589 39.548 . . . 1.0 . . . . . . . . . . . . A . 20 A H2   . . . . . . . . . rr_2l5z 1 
       .  8 .  6532 . 1 1 20 A H2'  H -28.954  12.606 38.347 . . . 1.0 . . . . . . . . . . . . A . 20 A H2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6533 . 1 1 20 A H3'  H -30.293  14.104 37.135 . . . 1.0 . . . . . . . . . . . . A . 20 A H3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6534 . 1 1 20 A H4'  H -32.748  13.067 38.617 . . . 1.0 . . . . . . . . . . . . A . 20 A H4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6535 . 1 1 20 A H5'  H -33.653  13.181 36.200 . . . 1.0 . . . . . . . . . . . . A . 20 A H5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6536 . 1 1 20 A H5'' H -33.340  14.721 37.026 . . . 1.0 . . . . . . . . . . . . A . 20 A H5'' . . . . . . . . . rr_2l5z 1 
       .  8 .  6537 . 1 1 20 A H61  H -25.942   7.071 35.348 . . . 1.0 . . . . . . . . . . . . A . 20 A H61  . . . . . . . . . rr_2l5z 1 
       .  8 .  6538 . 1 1 20 A H62  H -26.804   8.223 34.353 . . . 1.0 . . . . . . . . . . . . A . 20 A H62  . . . . . . . . . rr_2l5z 1 
       .  8 .  6539 . 1 1 20 A H8   H -30.186  11.538 35.333 . . . 1.0 . . . . . . . . . . . . A . 20 A H8   . . . . . . . . . rr_2l5z 1 
       .  8 .  6540 . 1 1 20 A HO2' H -29.741  11.752 40.405 . . . 1.0 . . . . . . . . . . . . A . 20 A HO2' . . . . . . . . . rr_2l5z 1 
       .  8 .  6541 . 1 1 20 A N1   N -27.045   7.676 37.528 . . . 1.0 . . . . . . . . . . . . A . 20 A N1   . . . . . . . . . rr_2l5z 1 
       .  8 .  6542 . 1 1 20 A N3   N -28.630   9.039 38.680 . . . 1.0 . . . . . . . . . . . . A . 20 A N3   . . . . . . . . . rr_2l5z 1 
       .  8 .  6543 . 1 1 20 A N6   N -26.624   7.809 35.257 . . . 1.0 . . . . . . . . . . . . A . 20 A N6   . . . . . . . . . rr_2l5z 1 
       .  8 .  6544 . 1 1 20 A N7   N -28.747  10.048 35.232 . . . 1.0 . . . . . . . . . . . . A . 20 A N7   . . . . . . . . . rr_2l5z 1 
       .  8 .  6545 . 1 1 20 A N9   N -29.739  10.587 37.175 . . . 1.0 . . . . . . . . . . . . A . 20 A N9   . . . . . . . . . rr_2l5z 1 
       .  8 .  6546 . 1 1 20 A O2'  O -30.114  12.576 40.082 . . . 1.0 . . . . . . . . . . . . A . 20 A O2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6547 . 1 1 20 A O3'  O -30.984  14.720 39.024 . . . 1.0 . . . . . . . . . . . . A . 20 A O3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6548 . 1 1 20 A O4'  O -31.831  11.748 37.339 . . . 1.0 . . . . . . . . . . . . A . 20 A O4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6549 . 1 1 20 A O5'  O -31.992  14.216 35.552 . . . 1.0 . . . . . . . . . . . . A . 20 A O5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6550 . 1 1 20 A OP1  O -33.096  15.714 33.876 . . . 1.0 . . . . . . . . . . . . A . 20 A OP1  . . . . . . . . . rr_2l5z 1 
       .  8 .  6551 . 1 1 20 A OP2  O -31.482  13.871 33.123 . . . 1.0 . . . . . . . . . . . . A . 20 A OP2  . . . . . . . . . rr_2l5z 1 
       .  8 .  6552 . 1 1 20 A P    P -32.536  14.354 34.044 . . . 1.0 . . . . . . . . . . . . A . 20 A P    . . . . . . . . . rr_2l5z 1 
       .  8 .  6553 . 1 1 21 C C1'  C -25.205  13.025 38.739 . . . 1.0 . . . . . . . . . . . . A . 21 C C1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6554 . 1 1 21 C C2   C -24.061  11.250 37.489 . . . 1.0 . . . . . . . . . . . . A . 21 C C2   . . . . . . . . . rr_2l5z 1 
       .  8 .  6555 . 1 1 21 C C2'  C -24.231  14.182 38.496 . . . 1.0 . . . . . . . . . . . . A . 21 C C2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6556 . 1 1 21 C C3'  C -25.152  15.342 38.160 . . . 1.0 . . . . . . . . . . . . A . 21 C C3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6557 . 1 1 21 C C4   C -24.975  10.360 35.517 . . . 1.0 . . . . . . . . . . . . A . 21 C C4   . . . . . . . . . rr_2l5z 1 
       .  8 .  6558 . 1 1 21 C C4'  C -26.394  15.022 38.971 . . . 1.0 . . . . . . . . . . . . A . 21 C C4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6559 . 1 1 21 C C5   C -26.121  11.208 35.631 . . . 1.0 . . . . . . . . . . . . A . 21 C C5   . . . . . . . . . rr_2l5z 1 
       .  8 .  6560 . 1 1 21 C C5'  C -27.639  15.719 38.418 . . . 1.0 . . . . . . . . . . . . A . 21 C C5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6561 . 1 1 21 C C6   C -26.179  12.047 36.685 . . . 1.0 . . . . . . . . . . . . A . 21 C C6   . . . . . . . . . rr_2l5z 1 
       .  8 .  6562 . 1 1 21 C H1'  H -24.927  12.504 39.658 . . . 1.0 . . . . . . . . . . . . A . 21 C H1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6563 . 1 1 21 C H2'  H -23.591  13.957 37.640 . . . 1.0 . . . . . . . . . . . . A . 21 C H2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6564 . 1 1 21 C H3'  H -25.363  15.397 37.090 . . . 1.0 . . . . . . . . . . . . A . 21 C H3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6565 . 1 1 21 C H4'  H -26.240  15.317 40.008 . . . 1.0 . . . . . . . . . . . . A . 21 C H4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6566 . 1 1 21 C H41  H -24.066   8.921 34.401 . . . 1.0 . . . . . . . . . . . . A . 21 C H41  . . . . . . . . . rr_2l5z 1 
       .  8 .  6567 . 1 1 21 C H42  H -25.605   9.486 33.790 . . . 1.0 . . . . . . . . . . . . A . 21 C H42  . . . . . . . . . rr_2l5z 1 
       .  8 .  6568 . 1 1 21 C H5   H -26.914  11.177 34.898 . . . 1.0 . . . . . . . . . . . . A . 21 C H5   . . . . . . . . . rr_2l5z 1 
       .  8 .  6569 . 1 1 21 C H5'  H -27.397  16.755 38.171 . . . 1.0 . . . . . . . . . . . . A . 21 C H5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6570 . 1 1 21 C H5'' H -27.963  15.204 37.514 . . . 1.0 . . . . . . . . . . . . A . 21 C H5'' . . . . . . . . . rr_2l5z 1 
       .  8 .  6571 . 1 1 21 C H6   H -27.031  12.700 36.802 . . . 1.0 . . . . . . . . . . . . A . 21 C H6   . . . . . . . . . rr_2l5z 1 
       .  8 .  6572 . 1 1 21 C HO2' H -23.602  13.748 40.286 . . . 1.0 . . . . . . . . . . . . A . 21 C HO2' . . . . . . . . . rr_2l5z 1 
       .  8 .  6573 . 1 1 21 C N1   N -25.171  12.077 37.603 . . . 1.0 . . . . . . . . . . . . A . 21 C N1   . . . . . . . . . rr_2l5z 1 
       .  8 .  6574 . 1 1 21 C N3   N -23.994  10.399 36.428 . . . 1.0 . . . . . . . . . . . . A . 21 C N3   . . . . . . . . . rr_2l5z 1 
       .  8 .  6575 . 1 1 21 C N4   N -24.874   9.521 34.486 . . . 1.0 . . . . . . . . . . . . A . 21 C N4   . . . . . . . . . rr_2l5z 1 
       .  8 .  6576 . 1 1 21 C O2   O -23.167  11.294 38.332 . . . 1.0 . . . . . . . . . . . . A . 21 C O2   . . . . . . . . . rr_2l5z 1 
       .  8 .  6577 . 1 1 21 C O2'  O -23.445  14.460 39.661 . . . 1.0 . . . . . . . . . . . . A . 21 C O2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6578 . 1 1 21 C O3'  O -24.571  16.548 38.661 . . . 1.0 . . . . . . . . . . . . A . 21 C O3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6579 . 1 1 21 C O4'  O -26.512  13.603 38.901 . . . 1.0 . . . . . . . . . . . . A . 21 C O4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6580 . 1 1 21 C O5'  O -28.704  15.709 39.369 . . . 1.0 . . . . . . . . . . . . A . 21 C O5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6581 . 1 1 21 C OP1  O -30.747  17.031 39.961 . . . 1.0 . . . . . . . . . . . . A . 21 C OP1  . . . . . . . . . rr_2l5z 1 
       .  8 .  6582 . 1 1 21 C OP2  O -30.165  16.544 37.514 . . . 1.0 . . . . . . . . . . . . A . 21 C OP2  . . . . . . . . . rr_2l5z 1 
       .  8 .  6583 . 1 1 21 C P    P -30.197  16.121 38.932 . . . 1.0 . . . . . . . . . . . . A . 21 C P    . . . . . . . . . rr_2l5z 1 
       .  8 .  6584 . 1 1 22 G C1'  C -19.722  14.207 39.898 . . . 1.0 . . . . . . . . . . . . A . 22 G C1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6585 . 1 1 22 G C2   C -17.515  10.870 37.998 . . . 1.0 . . . . . . . . . . . . A . 22 G C2   . . . . . . . . . rr_2l5z 1 
       .  8 .  6586 . 1 1 22 G C2'  C -18.589  15.233 39.903 . . . 1.0 . . . . . . . . . . . . A . 22 G C2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6587 . 1 1 22 G C3'  C -19.328  16.518 39.583 . . . 1.0 . . . . . . . . . . . . A . 22 G C3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6588 . 1 1 22 G C4   C -19.044  12.491 38.098 . . . 1.0 . . . . . . . . . . . . A . 22 G C4   . . . . . . . . . rr_2l5z 1 
       .  8 .  6589 . 1 1 22 G C4'  C -20.633  16.321 40.334 . . . 1.0 . . . . . . . . . . . . A . 22 G C4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6590 . 1 1 22 G C5   C -19.506  12.280 36.808 . . . 1.0 . . . . . . . . . . . . A . 22 G C5   . . . . . . . . . rr_2l5z 1 
       .  8 .  6591 . 1 1 22 G C5'  C -21.745  17.206 39.776 . . . 1.0 . . . . . . . . . . . . A . 22 G C5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6592 . 1 1 22 G C6   C -18.920  11.258 36.015 . . . 1.0 . . . . . . . . . . . . A . 22 G C6   . . . . . . . . . rr_2l5z 1 
       .  8 .  6593 . 1 1 22 G C8   C -20.633  13.859 37.594 . . . 1.0 . . . . . . . . . . . . A . 22 G C8   . . . . . . . . . rr_2l5z 1 
       .  8 .  6594 . 1 1 22 G H1   H -17.409   9.859 36.169 . . . 1.0 . . . . . . . . . . . . A . 22 G H1   . . . . . . . . . rr_2l5z 1 
       .  8 .  6595 . 1 1 22 G H1'  H -19.553  13.468 40.681 . . . 1.0 . . . . . . . . . . . . A . 22 G H1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6596 . 1 1 22 G H2'  H -17.871  15.004 39.111 . . . 1.0 . . . . . . . . . . . . A . 22 G H2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6597 . 1 1 22 G H21  H -16.118   9.392 37.915 . . . 1.0 . . . . . . . . . . . . A . 22 G H21  . . . . . . . . . rr_2l5z 1 
       .  8 .  6598 . 1 1 22 G H22  H -16.197  10.270 39.427 . . . 1.0 . . . . . . . . . . . . A . 22 G H22  . . . . . . . . . rr_2l5z 1 
       .  8 .  6599 . 1 1 22 G H3'  H -19.483  16.643 38.511 . . . 1.0 . . . . . . . . . . . . A . 22 G H3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6600 . 1 1 22 G H4'  H -20.485  16.540 41.389 . . . 1.0 . . . . . . . . . . . . A . 22 G H4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6601 . 1 1 22 G H5'  H -22.629  17.105 40.406 . . . 1.0 . . . . . . . . . . . . A . 22 G H5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6602 . 1 1 22 G H5'' H -21.414  18.244 39.792 . . . 1.0 . . . . . . . . . . . . A . 22 G H5'' . . . . . . . . . rr_2l5z 1 
       .  8 .  6603 . 1 1 22 G H8   H -21.352  14.657 37.702 . . . 1.0 . . . . . . . . . . . . A . 22 G H8   . . . . . . . . . rr_2l5z 1 
       .  8 .  6604 . 1 1 22 G HO2' H -17.055  15.629 41.034 . . . 1.0 . . . . . . . . . . . . A . 22 G HO2' . . . . . . . . . rr_2l5z 1 
       .  8 .  6605 . 1 1 22 G N1   N -17.911  10.594 36.703 . . . 1.0 . . . . . . . . . . . . A . 22 G N1   . . . . . . . . . rr_2l5z 1 
       .  8 .  6606 . 1 1 22 G N2   N -16.530  10.116 38.486 . . . 1.0 . . . . . . . . . . . . A . 22 G N2   . . . . . . . . . rr_2l5z 1 
       .  8 .  6607 . 1 1 22 G N3   N -18.063  11.830 38.752 . . . 1.0 . . . . . . . . . . . . A . 22 G N3   . . . . . . . . . rr_2l5z 1 
       .  8 .  6608 . 1 1 22 G N7   N -20.540  13.179 36.499 . . . 1.0 . . . . . . . . . . . . A . 22 G N7   . . . . . . . . . rr_2l5z 1 
       .  8 .  6609 . 1 1 22 G N9   N -19.796  13.528 38.591 . . . 1.0 . . . . . . . . . . . . A . 22 G N9   . . . . . . . . . rr_2l5z 1 
       .  8 .  6610 . 1 1 22 G O2'  O -17.944  15.299 41.180 . . . 1.0 . . . . . . . . . . . . A . 22 G O2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6611 . 1 1 22 G O3'  O -18.618  17.615 40.165 . . . 1.0 . . . . . . . . . . . . A . 22 G O3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6612 . 1 1 22 G O4'  O -20.935  14.932 40.179 . . . 1.0 . . . . . . . . . . . . A . 22 G O4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6613 . 1 1 22 G O5'  O -22.087  16.848 38.436 . . . 1.0 . . . . . . . . . . . . A . 22 G O5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6614 . 1 1 22 G O6   O -19.205  10.925 34.866 . . . 1.0 . . . . . . . . . . . . A . 22 G O6   . . . . . . . . . rr_2l5z 1 
       .  8 .  6615 . 1 1 22 G OP1  O -23.624  18.791 38.073 . . . 1.0 . . . . . . . . . . . . A . 22 G OP1  . . . . . . . . . rr_2l5z 1 
       .  8 .  6616 . 1 1 22 G OP2  O -23.542  16.853 36.398 . . . 1.0 . . . . . . . . . . . . A . 22 G OP2  . . . . . . . . . rr_2l5z 1 
       .  8 .  6617 . 1 1 22 G P    P -23.475  17.346 37.793 . . . 1.0 . . . . . . . . . . . . A . 22 G P    . . . . . . . . . rr_2l5z 1 
       .  8 .  6618 . 1 1 23 G C1'  C -15.064  14.634 37.073 . . . 1.0 . . . . . . . . . . . . A . 23 G C1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6619 . 1 1 23 G C2   C -15.342  12.442 33.244 . . . 1.0 . . . . . . . . . . . . A . 23 G C2   . . . . . . . . . rr_2l5z 1 
       .  8 .  6620 . 1 1 23 G C2'  C -13.885  15.460 36.549 . . . 1.0 . . . . . . . . . . . . A . 23 G C2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6621 . 1 1 23 G C3'  C -14.121  16.813 37.200 . . . 1.0 . . . . . . . . . . . . A . 23 G C3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6622 . 1 1 23 G C4   C -16.084  13.776 34.871 . . . 1.0 . . . . . . . . . . . . A . 23 G C4   . . . . . . . . . rr_2l5z 1 
       .  8 .  6623 . 1 1 23 G C4'  C -14.721  16.421 38.536 . . . 1.0 . . . . . . . . . . . . A . 23 G C4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6624 . 1 1 23 G C5   C -17.323  13.982 34.282 . . . 1.0 . . . . . . . . . . . . A . 23 G C5   . . . . . . . . . rr_2l5z 1 
       .  8 .  6625 . 1 1 23 G C5'  C -15.492  17.575 39.171 . . . 1.0 . . . . . . . . . . . . A . 23 G C5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6626 . 1 1 23 G C6   C -17.618  13.355 33.040 . . . 1.0 . . . . . . . . . . . . A . 23 G C6   . . . . . . . . . rr_2l5z 1 
       .  8 .  6627 . 1 1 23 G C8   C -17.320  15.075 36.070 . . . 1.0 . . . . . . . . . . . . A . 23 G C8   . . . . . . . . . rr_2l5z 1 
       .  8 .  6628 . 1 1 23 G H1   H -16.690  12.100 31.681 . . . 1.0 . . . . . . . . . . . . A . 23 G H1   . . . . . . . . . rr_2l5z 1 
       .  8 .  6629 . 1 1 23 G H1'  H -14.721  13.640 37.362 . . . 1.0 . . . . . . . . . . . . A . 23 G H1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6630 . 1 1 23 G H2'  H -13.944  15.551 35.463 . . . 1.0 . . . . . . . . . . . . A . 23 G H2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6631 . 1 1 23 G H21  H -14.652  11.225 31.764 . . . 1.0 . . . . . . . . . . . . A . 23 G H21  . . . . . . . . . rr_2l5z 1 
       .  8 .  6632 . 1 1 23 G H22  H -13.534  11.520 33.078 . . . 1.0 . . . . . . . . . . . . A . 23 G H22  . . . . . . . . . rr_2l5z 1 
       .  8 .  6633 . 1 1 23 G H3'  H -14.799  17.434 36.612 . . . 1.0 . . . . . . . . . . . . A . 23 G H3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6634 . 1 1 23 G H4'  H -13.932  16.093 39.210 . . . 1.0 . . . . . . . . . . . . A . 23 G H4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6635 . 1 1 23 G H5'  H -15.690  17.337 40.216 . . . 1.0 . . . . . . . . . . . . A . 23 G H5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6636 . 1 1 23 G H5'' H -14.882  18.478 39.123 . . . 1.0 . . . . . . . . . . . . A . 23 G H5'' . . . . . . . . . rr_2l5z 1 
       .  8 .  6637 . 1 1 23 G H8   H -17.618  15.715 36.887 . . . 1.0 . . . . . . . . . . . . A . 23 G H8   . . . . . . . . . rr_2l5z 1 
       .  8 .  6638 . 1 1 23 G HO2' H -12.761  14.494 37.812 . . . 1.0 . . . . . . . . . . . . A . 23 G HO2' . . . . . . . . . rr_2l5z 1 
       .  8 .  6639 . 1 1 23 G N1   N -16.549  12.591 32.588 . . . 1.0 . . . . . . . . . . . . A . 23 G N1   . . . . . . . . . rr_2l5z 1 
       .  8 .  6640 . 1 1 23 G N2   N -14.436  11.666 32.647 . . . 1.0 . . . . . . . . . . . . A . 23 G N2   . . . . . . . . . rr_2l5z 1 
       .  8 .  6641 . 1 1 23 G N3   N -15.057  13.027 34.412 . . . 1.0 . . . . . . . . . . . . A . 23 G N3   . . . . . . . . . rr_2l5z 1 
       .  8 .  6642 . 1 1 23 G N7   N -18.113  14.830 35.078 . . . 1.0 . . . . . . . . . . . . A . 23 G N7   . . . . . . . . . rr_2l5z 1 
       .  8 .  6643 . 1 1 23 G N9   N -16.105  14.497 36.036 . . . 1.0 . . . . . . . . . . . . A . 23 G N9   . . . . . . . . . rr_2l5z 1 
       .  8 .  6644 . 1 1 23 G O2'  O -12.631  14.898 36.951 . . . 1.0 . . . . . . . . . . . . A . 23 G O2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6645 . 1 1 23 G O3'  O -12.858  17.445 37.425 . . . 1.0 . . . . . . . . . . . . A . 23 G O3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6646 . 1 1 23 G O4'  O -15.571  15.316 38.234 . . . 1.0 . . . . . . . . . . . . A . 23 G O4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6647 . 1 1 23 G O5'  O -16.734  17.817 38.506 . . . 1.0 . . . . . . . . . . . . A . 23 G O5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6648 . 1 1 23 G O6   O -18.653  13.421 32.380 . . . 1.0 . . . . . . . . . . . . A . 23 G O6   . . . . . . . . . rr_2l5z 1 
       .  8 .  6649 . 1 1 23 G OP1  O -17.225  19.697 40.090 . . . 1.0 . . . . . . . . . . . . A . 23 G OP1  . . . . . . . . . rr_2l5z 1 
       .  8 .  6650 . 1 1 23 G OP2  O -18.842  19.132 38.184 . . . 1.0 . . . . . . . . . . . . A . 23 G OP2  . . . . . . . . . rr_2l5z 1 
       .  8 .  6651 . 1 1 23 G P    P -17.882  18.694 39.222 . . . 1.0 . . . . . . . . . . . . A . 23 G P    . . . . . . . . . rr_2l5z 1 
       .  8 .  6652 . 1 1 24 C C1'  C -12.536  15.571 32.177 . . . 1.0 . . . . . . . . . . . . A . 24 C C1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6653 . 1 1 24 C C2   C -14.678  14.956 31.068 . . . 1.0 . . . . . . . . . . . . A . 24 C C2   . . . . . . . . . rr_2l5z 1 
       .  8 .  6654 . 1 1 24 C C2'  C -11.864  16.621 31.282 . . . 1.0 . . . . . . . . . . . . A . 24 C C2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6655 . 1 1 24 C C3'  C -11.323  17.632 32.280 . . . 1.0 . . . . . . . . . . . . A . 24 C C3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6656 . 1 1 24 C C4   C -16.715  15.878 31.783 . . . 1.0 . . . . . . . . . . . . A . 24 C C4   . . . . . . . . . rr_2l5z 1 
       .  8 .  6657 . 1 1 24 C C4'  C -11.020  16.767 33.485 . . . 1.0 . . . . . . . . . . . . A . 24 C C4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6658 . 1 1 24 C C5   C -16.053  16.621 32.812 . . . 1.0 . . . . . . . . . . . . A . 24 C C5   . . . . . . . . . rr_2l5z 1 
       .  8 .  6659 . 1 1 24 C C5'  C -10.938  17.589 34.770 . . . 1.0 . . . . . . . . . . . . A . 24 C C5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6660 . 1 1 24 C C6   C -14.714  16.493 32.919 . . . 1.0 . . . . . . . . . . . . A . 24 C C6   . . . . . . . . . rr_2l5z 1 
       .  8 .  6661 . 1 1 24 C H1'  H -12.197  14.572 31.884 . . . 1.0 . . . . . . . . . . . . A . 24 C H1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6662 . 1 1 24 C H2'  H -12.610  17.094 30.642 . . . 1.0 . . . . . . . . . . . . A . 24 C H2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6663 . 1 1 24 C H3'  H -12.053  18.411 32.507 . . . 1.0 . . . . . . . . . . . . A . 24 C H3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6664 . 1 1 24 C H4'  H -10.085  16.234 33.330 . . . 1.0 . . . . . . . . . . . . A . 24 C H4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6665 . 1 1 24 C H41  H -18.507  15.459 30.915 . . . 1.0 . . . . . . . . . . . . A . 24 C H41  . . . . . . . . . rr_2l5z 1 
       .  8 .  6666 . 1 1 24 C H42  H -18.565  16.582 32.255 . . . 1.0 . . . . . . . . . . . . A . 24 C H42  . . . . . . . . . rr_2l5z 1 
       .  8 .  6667 . 1 1 24 C H5   H -16.607  17.263 33.479 . . . 1.0 . . . . . . . . . . . . A . 24 C H5   . . . . . . . . . rr_2l5z 1 
       .  8 .  6668 . 1 1 24 C H5'  H -10.619  16.941 35.586 . . . 1.0 . . . . . . . . . . . . A . 24 C H5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6669 . 1 1 24 C H5'' H -10.201  18.381 34.638 . . . 1.0 . . . . . . . . . . . . A . 24 C H5'' . . . . . . . . . rr_2l5z 1 
       .  8 .  6670 . 1 1 24 C H6   H -14.182  17.054 33.673 . . . 1.0 . . . . . . . . . . . . A . 24 C H6   . . . . . . . . . rr_2l5z 1 
       .  8 .  6671 . 1 1 24 C HO2' H -10.713  15.132 30.782 . . . 1.0 . . . . . . . . . . . . A . 24 C HO2' . . . . . . . . . rr_2l5z 1 
       .  8 .  6672 . 1 1 24 C N1   N -14.021  15.677 32.069 . . . 1.0 . . . . . . . . . . . . A . 24 C N1   . . . . . . . . . rr_2l5z 1 
       .  8 .  6673 . 1 1 24 C N3   N -16.027  15.083 30.955 . . . 1.0 . . . . . . . . . . . . A . 24 C N3   . . . . . . . . . rr_2l5z 1 
       .  8 .  6674 . 1 1 24 C N4   N -18.035  15.981 31.639 . . . 1.0 . . . . . . . . . . . . A . 24 C N4   . . . . . . . . . rr_2l5z 1 
       .  8 .  6675 . 1 1 24 C O2   O -14.036  14.228 30.312 . . . 1.0 . . . . . . . . . . . . A . 24 C O2   . . . . . . . . . rr_2l5z 1 
       .  8 .  6676 . 1 1 24 C O2'  O -10.812  16.044 30.500 . . . 1.0 . . . . . . . . . . . . A . 24 C O2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6677 . 1 1 24 C O3'  O -10.100  18.166 31.769 . . . 1.0 . . . . . . . . . . . . A . 24 C O3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6678 . 1 1 24 C O4'  O -12.093  15.833 33.523 . . . 1.0 . . . . . . . . . . . . A . 24 C O4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6679 . 1 1 24 C O5'  O -12.195  18.177 35.108 . . . 1.0 . . . . . . . . . . . . A . 24 C O5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6680 . 1 1 24 C OP1  O -11.158  19.258 37.115 . . . 1.0 . . . . . . . . . . . . A . 24 C OP1  . . . . . . . . . rr_2l5z 1 
       .  8 .  6681 . 1 1 24 C OP2  O -13.622  19.661 36.538 . . . 1.0 . . . . . . . . . . . . A . 24 C OP2  . . . . . . . . . rr_2l5z 1 
       .  8 .  6682 . 1 1 24 C P    P -12.448  18.759 36.589 . . . 1.0 . . . . . . . . . . . . A . 24 C P    . . . . . . . . . rr_2l5z 1 
       .  8 .  6683 . 1 1 25 U C1'  C -11.686  16.228 26.716 . . . 1.0 . . . . . . . . . . . . A . 25 U C1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6684 . 1 1 25 U C2   C -14.166  16.011 26.557 . . . 1.0 . . . . . . . . . . . . A . 25 U C2   . . . . . . . . . rr_2l5z 1 
       .  8 .  6685 . 1 1 25 U C2'  C -11.188  17.153 25.602 . . . 1.0 . . . . . . . . . . . . A . 25 U C2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6686 . 1 1 25 U C3'  C -10.361  18.166 26.371 . . . 1.0 . . . . . . . . . . . . A . 25 U C3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6687 . 1 1 25 U C4   C -15.651  17.427 27.928 . . . 1.0 . . . . . . . . . . . . A . 25 U C4   . . . . . . . . . rr_2l5z 1 
       .  8 .  6688 . 1 1 25 U C4'  C  -9.729  17.299 27.440 . . . 1.0 . . . . . . . . . . . . A . 25 U C4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6689 . 1 1 25 U C5   C -14.455  18.011 28.491 . . . 1.0 . . . . . . . . . . . . A . 25 U C5   . . . . . . . . . rr_2l5z 1 
       .  8 .  6690 . 1 1 25 U C5'  C  -9.260  18.122 28.638 . . . 1.0 . . . . . . . . . . . . A . 25 U C5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6691 . 1 1 25 U C6   C -13.225  17.602 28.097 . . . 1.0 . . . . . . . . . . . . A . 25 U C6   . . . . . . . . . rr_2l5z 1 
       .  8 .  6692 . 1 1 25 U H1'  H -11.664  15.194 26.356 . . . 1.0 . . . . . . . . . . . . A . 25 U H1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6693 . 1 1 25 U H2'  H -12.032  17.644 25.117 . . . 1.0 . . . . . . . . . . . . A . 25 U H2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6694 . 1 1 25 U H3   H -16.239  16.015 26.530 . . . 1.0 . . . . . . . . . . . . A . 25 U H3   . . . . . . . . . rr_2l5z 1 
       .  8 .  6695 . 1 1 25 U H3'  H -10.974  18.962 26.794 . . . 1.0 . . . . . . . . . . . . A . 25 U H3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6696 . 1 1 25 U H4'  H  -8.886  16.760 27.014 . . . 1.0 . . . . . . . . . . . . A . 25 U H4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6697 . 1 1 25 U H5   H -14.542  18.806 29.218 . . . 1.0 . . . . . . . . . . . . A . 25 U H5   . . . . . . . . . rr_2l5z 1 
       .  8 .  6698 . 1 1 25 U H5'  H  -8.724  17.470 29.328 . . . 1.0 . . . . . . . . . . . . A . 25 U H5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6699 . 1 1 25 U H5'' H  -8.583  18.902 28.289 . . . 1.0 . . . . . . . . . . . . A . 25 U H5'' . . . . . . . . . rr_2l5z 1 
       .  8 .  6700 . 1 1 25 U H6   H -12.352  18.071 28.525 . . . 1.0 . . . . . . . . . . . . A . 25 U H6   . . . . . . . . . rr_2l5z 1 
       .  8 .  6701 . 1 1 25 U HO2' H  -9.666  16.035 25.130 . . . 1.0 . . . . . . . . . . . . A . 25 U HO2' . . . . . . . . . rr_2l5z 1 
       .  8 .  6702 . 1 1 25 U N1   N -13.062  16.624 27.151 . . . 1.0 . . . . . . . . . . . . A . 25 U N1   . . . . . . . . . rr_2l5z 1 
       .  8 .  6703 . 1 1 25 U N3   N -15.408  16.450 26.979 . . . 1.0 . . . . . . . . . . . . A . 25 U N3   . . . . . . . . . rr_2l5z 1 
       .  8 .  6704 . 1 1 25 U O2   O -14.045  15.133 25.707 . . . 1.0 . . . . . . . . . . . . A . 25 U O2   . . . . . . . . . rr_2l5z 1 
       .  8 .  6705 . 1 1 25 U O2'  O -10.391  16.442 24.649 . . . 1.0 . . . . . . . . . . . . A . 25 U O2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6706 . 1 1 25 U O3'  O  -9.329  18.665 25.514 . . . 1.0 . . . . . . . . . . . . A . 25 U O3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6707 . 1 1 25 U O4   O -16.802  17.735 28.229 . . . 1.0 . . . . . . . . . . . . A . 25 U O4   . . . . . . . . . rr_2l5z 1 
       .  8 .  6708 . 1 1 25 U O4'  O -10.747  16.365 27.803 . . . 1.0 . . . . . . . . . . . . A . 25 U O4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6709 . 1 1 25 U O5'  O -10.353  18.730 29.329 . . . 1.0 . . . . . . . . . . . . A . 25 U O5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6710 . 1 1 25 U OP1  O  -8.775  20.041 30.766 . . . 1.0 . . . . . . . . . . . . A . 25 U OP1  . . . . . . . . . rr_2l5z 1 
       .  8 .  6711 . 1 1 25 U OP2  O -11.309  20.249 31.077 . . . 1.0 . . . . . . . . . . . . A . 25 U OP2  . . . . . . . . . rr_2l5z 1 
       .  8 .  6712 . 1 1 25 U P    P -10.120  19.425 30.764 . . . 1.0 . . . . . . . . . . . . A . 25 U P    . . . . . . . . . rr_2l5z 1 
       .  8 .  6713 . 1 1 26 C C1'  C -14.246  19.406 22.671 . . . 1.0 . . . . . . . . . . . . A . 26 C C1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6714 . 1 1 26 C C2   C -16.307  20.145 23.776 . . . 1.0 . . . . . . . . . . . . A . 26 C C2   . . . . . . . . . rr_2l5z 1 
       .  8 .  6715 . 1 1 26 C C2'  C -14.010  20.598 21.737 . . . 1.0 . . . . . . . . . . . . A . 26 C C2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6716 . 1 1 26 C C3'  C -12.512  20.853 21.860 . . . 1.0 . . . . . . . . . . . . A . 26 C C3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6717 . 1 1 26 C C4   C -16.361  20.590 26.082 . . . 1.0 . . . . . . . . . . . . A . 26 C C4   . . . . . . . . . rr_2l5z 1 
       .  8 .  6718 . 1 1 26 C C4'  C -11.983  19.456 22.142 . . . 1.0 . . . . . . . . . . . . A . 26 C C4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6719 . 1 1 26 C C5   C -14.974  20.265 26.208 . . . 1.0 . . . . . . . . . . . . A . 26 C C5   . . . . . . . . . rr_2l5z 1 
       .  8 .  6720 . 1 1 26 C C5'  C -10.606  19.489 22.805 . . . 1.0 . . . . . . . . . . . . A . 26 C C5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6721 . 1 1 26 C C6   C -14.315  19.890 25.095 . . . 1.0 . . . . . . . . . . . . A . 26 C C6   . . . . . . . . . rr_2l5z 1 
       .  8 .  6722 . 1 1 26 C H1'  H -14.835  18.651 22.150 . . . 1.0 . . . . . . . . . . . . A . 26 C H1'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6723 . 1 1 26 C H2'  H -14.572  21.467 22.093 . . . 1.0 . . . . . . . . . . . . A . 26 C H2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6724 . 1 1 26 C H3'  H -12.309  21.518 22.707 . . . 1.0 . . . . . . . . . . . . A . 26 C H3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6725 . 1 1 26 C H4'  H -11.928  18.893 21.214 . . . 1.0 . . . . . . . . . . . . A . 26 C H4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6726 . 1 1 26 C H41  H -18.032  21.193 27.075 . . . 1.0 . . . . . . . . . . . . A . 26 C H41  . . . . . . . . . rr_2l5z 1 
       .  8 .  6727 . 1 1 26 C H42  H -16.596  21.012 28.059 . . . 1.0 . . . . . . . . . . . . A . 26 C H42  . . . . . . . . . rr_2l5z 1 
       .  8 .  6728 . 1 1 26 C H5   H -14.472  20.317 27.163 . . . 1.0 . . . . . . . . . . . . A . 26 C H5   . . . . . . . . . rr_2l5z 1 
       .  8 .  6729 . 1 1 26 C H5'  H -10.285  18.468 23.007 . . . 1.0 . . . . . . . . . . . . A . 26 C H5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6730 . 1 1 26 C H5'' H  -9.895  19.956 22.122 . . . 1.0 . . . . . . . . . . . . A . 26 C H5'' . . . . . . . . . rr_2l5z 1 
       .  8 .  6731 . 1 1 26 C H6   H -13.264  19.640 25.152 . . . 1.0 . . . . . . . . . . . . A . 26 C H6   . . . . . . . . . rr_2l5z 1 
       .  8 .  6732 . 1 1 26 C HO2' H -14.093  21.013 19.836 . . . 1.0 . . . . . . . . . . . . A . 26 C HO2' . . . . . . . . . rr_2l5z 1 
       .  8 .  6733 . 1 1 26 C HO3' H -12.067  22.339 20.683 . . . 1.0 . . . . . . . . . . . . A . 26 C HO3' . . . . . . . . . rr_2l5z 1 
       .  8 .  6734 . 1 1 26 C N1   N -14.960  19.826 23.893 . . . 1.0 . . . . . . . . . . . . A . 26 C N1   . . . . . . . . . rr_2l5z 1 
       .  8 .  6735 . 1 1 26 C N3   N -16.980  20.525 24.896 . . . 1.0 . . . . . . . . . . . . A . 26 C N3   . . . . . . . . . rr_2l5z 1 
       .  8 .  6736 . 1 1 26 C N4   N -17.052  20.962 27.159 . . . 1.0 . . . . . . . . . . . . A . 26 C N4   . . . . . . . . . rr_2l5z 1 
       .  8 .  6737 . 1 1 26 C O2   O -16.864  20.083 22.680 . . . 1.0 . . . . . . . . . . . . A . 26 C O2   . . . . . . . . . rr_2l5z 1 
       .  8 .  6738 . 1 1 26 C O2'  O -14.373  20.279 20.388 . . . 1.0 . . . . . . . . . . . . A . 26 C O2'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6739 . 1 1 26 C O3'  O -11.968  21.384 20.646 . . . 1.0 . . . . . . . . . . . . A . 26 C O3'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6740 . 1 1 26 C O4'  O -12.958  18.863 22.990 . . . 1.0 . . . . . . . . . . . . A . 26 C O4'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6741 . 1 1 26 C O5'  O -10.626  20.224 24.031 . . . 1.0 . . . . . . . . . . . . A . 26 C O5'  . . . . . . . . . rr_2l5z 1 
       .  8 .  6742 . 1 1 26 C OP1  O  -8.138  20.442 24.212 . . . 1.0 . . . . . . . . . . . . A . 26 C OP1  . . . . . . . . . rr_2l5z 1 
       .  8 .  6743 . 1 1 26 C OP2  O  -9.654  21.057 26.183 . . . 1.0 . . . . . . . . . . . . A . 26 C OP2  . . . . . . . . . rr_2l5z 1 
       .  8 .  6744 . 1 1 26 C P    P  -9.354  20.196 25.018 . . . 1.0 . . . . . . . . . . . . A . 26 C P    . . . . . . . . . rr_2l5z 1 
       .  9 .  6745 . 1 1  1 G C1'  C -24.774  19.173 21.954 . . . 1.0 . . . . . . . . . . . . A .  1 G C1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6746 . 1 1  1 G C2   C -20.552  20.488 22.159 . . . 1.0 . . . . . . . . . . . . A .  1 G C2   . . . . . . . . . rr_2l5z 1 
       .  9 .  6747 . 1 1  1 G C2'  C -24.716  17.682 21.626 . . . 1.0 . . . . . . . . . . . . A .  1 G C2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6748 . 1 1  1 G C3'  C -25.887  17.128 22.416 . . . 1.0 . . . . . . . . . . . . A .  1 G C3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6749 . 1 1  1 G C4   C -22.535  19.907 22.998 . . . 1.0 . . . . . . . . . . . . A .  1 G C4   . . . . . . . . . rr_2l5z 1 
       .  9 .  6750 . 1 1  1 G C4'  C -26.903  18.264 22.349 . . . 1.0 . . . . . . . . . . . . A .  1 G C4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6751 . 1 1  1 G C5   C -22.144  20.077 24.318 . . . 1.0 . . . . . . . . . . . . A .  1 G C5   . . . . . . . . . rr_2l5z 1 
       .  9 .  6752 . 1 1  1 G C5'  C -27.866  18.244 23.539 . . . 1.0 . . . . . . . . . . . . A .  1 G C5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6753 . 1 1  1 G C6   C -20.818  20.497 24.606 . . . 1.0 . . . . . . . . . . . . A .  1 G C6   . . . . . . . . . rr_2l5z 1 
       .  9 .  6754 . 1 1  1 G C8   C -24.145  19.460 24.360 . . . 1.0 . . . . . . . . . . . . A .  1 G C8   . . . . . . . . . rr_2l5z 1 
       .  9 .  6755 . 1 1  1 G H1   H -19.094  20.990 23.574 . . . 1.0 . . . . . . . . . . . . A .  1 G H1   . . . . . . . . . rr_2l5z 1 
       .  9 .  6756 . 1 1  1 G H1'  H -24.506  19.748 21.068 . . . 1.0 . . . . . . . . . . . . A .  1 G H1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6757 . 1 1  1 G H2'  H -23.780  17.252 21.993 . . . 1.0 . . . . . . . . . . . . A .  1 G H2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6758 . 1 1  1 G H21  H -18.747  21.017 21.383 . . . 1.0 . . . . . . . . . . . . A .  1 G H21  . . . . . . . . . rr_2l5z 1 
       .  9 .  6759 . 1 1  1 G H22  H -19.974  20.595 20.210 . . . 1.0 . . . . . . . . . . . . A .  1 G H22  . . . . . . . . . rr_2l5z 1 
       .  9 .  6760 . 1 1  1 G H3'  H -25.598  16.877 23.441 . . . 1.0 . . . . . . . . . . . . A .  1 G H3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6761 . 1 1  1 G H4'  H -27.471  18.186 21.423 . . . 1.0 . . . . . . . . . . . . A .  1 G H4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6762 . 1 1  1 G H5'  H -28.626  19.013 23.394 . . . 1.0 . . . . . . . . . . . . A .  1 G H5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6763 . 1 1  1 G H5'' H -28.350  17.269 23.589 . . . 1.0 . . . . . . . . . . . . A .  1 G H5'' . . . . . . . . . rr_2l5z 1 
       .  9 .  6764 . 1 1  1 G H8   H -25.127  19.170 24.704 . . . 1.0 . . . . . . . . . . . . A .  1 G H8   . . . . . . . . . rr_2l5z 1 
       .  9 .  6765 . 1 1  1 G HO2' H -24.368  16.659 20.006 . . . 1.0 . . . . . . . . . . . . A .  1 G HO2' . . . . . . . . . rr_2l5z 1 
       .  9 .  6766 . 1 1  1 G HO5' H -27.218  17.680 25.284 . . . 1.0 . . . . . . . . . . . . A .  1 G HO5' . . . . . . . . . rr_2l5z 1 
       .  9 .  6767 . 1 1  1 G N1   N -20.079  20.682 23.443 . . . 1.0 . . . . . . . . . . . . A .  1 G N1   . . . . . . . . . rr_2l5z 1 
       .  9 .  6768 . 1 1  1 G N2   N -19.687  20.719 21.171 . . . 1.0 . . . . . . . . . . . . A .  1 G N2   . . . . . . . . . rr_2l5z 1 
       .  9 .  6769 . 1 1  1 G N3   N -21.798  20.093 21.880 . . . 1.0 . . . . . . . . . . . . A .  1 G N3   . . . . . . . . . rr_2l5z 1 
       .  9 .  6770 . 1 1  1 G N7   N -23.206  19.781 25.189 . . . 1.0 . . . . . . . . . . . . A .  1 G N7   . . . . . . . . . rr_2l5z 1 
       .  9 .  6771 . 1 1  1 G N9   N -23.844  19.504 23.051 . . . 1.0 . . . . . . . . . . . . A .  1 G N9   . . . . . . . . . rr_2l5z 1 
       .  9 .  6772 . 1 1  1 G O2'  O -24.872  17.447 20.222 . . . 1.0 . . . . . . . . . . . . A .  1 G O2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6773 . 1 1  1 G O3'  O -26.415  16.001 21.711 . . . 1.0 . . . . . . . . . . . . A .  1 G O3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6774 . 1 1  1 G O4'  O -26.130  19.467 22.324 . . . 1.0 . . . . . . . . . . . . A .  1 G O4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6775 . 1 1  1 G O5'  O -27.183  18.491 24.772 . . . 1.0 . . . . . . . . . . . . A .  1 G O5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6776 . 1 1  1 G O6   O -20.302  20.695 25.704 . . . 1.0 . . . . . . . . . . . . A .  1 G O6   . . . . . . . . . rr_2l5z 1 
       .  9 .  6777 . 1 1  2 A C1'  C -20.879  13.951 21.332 . . . 1.0 . . . . . . . . . . . . A .  2 A C1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6778 . 1 1  2 A C2   C -17.481  15.317 23.818 . . . 1.0 . . . . . . . . . . . . A .  2 A C2   . . . . . . . . . rr_2l5z 1 
       .  9 .  6779 . 1 1  2 A C2'  C -21.052  12.487 21.735 . . . 1.0 . . . . . . . . . . . . A .  2 A C2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6780 . 1 1  2 A C3'  C -22.558  12.305 21.670 . . . 1.0 . . . . . . . . . . . . A .  2 A C3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6781 . 1 1  2 A C4   C -19.602  15.162 23.216 . . . 1.0 . . . . . . . . . . . . A .  2 A C4   . . . . . . . . . rr_2l5z 1 
       .  9 .  6782 . 1 1  2 A C4'  C -22.947  13.209 20.507 . . . 1.0 . . . . . . . . . . . . A .  2 A C4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6783 . 1 1  2 A C5   C -20.033  15.970 24.244 . . . 1.0 . . . . . . . . . . . . A .  2 A C5   . . . . . . . . . rr_2l5z 1 
       .  9 .  6784 . 1 1  2 A C5'  C -24.405  13.664 20.600 . . . 1.0 . . . . . . . . . . . . A .  2 A C5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6785 . 1 1  2 A C6   C -19.046  16.465 25.103 . . . 1.0 . . . . . . . . . . . . A .  2 A C6   . . . . . . . . . rr_2l5z 1 
       .  9 .  6786 . 1 1  2 A C8   C -21.741  15.415 23.170 . . . 1.0 . . . . . . . . . . . . A .  2 A C8   . . . . . . . . . rr_2l5z 1 
       .  9 .  6787 . 1 1  2 A H1'  H -19.994  14.051 20.702 . . . 1.0 . . . . . . . . . . . . A .  2 A H1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6788 . 1 1  2 A H2   H -16.428  15.071 23.677 . . . 1.0 . . . . . . . . . . . . A .  2 A H2   . . . . . . . . . rr_2l5z 1 
       .  9 .  6789 . 1 1  2 A H2'  H -20.700  12.336 22.759 . . . 1.0 . . . . . . . . . . . . A .  2 A H2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6790 . 1 1  2 A H3'  H -23.039  12.596 22.606 . . . 1.0 . . . . . . . . . . . . A .  2 A H3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6791 . 1 1  2 A H4'  H -22.792  12.679 19.568 . . . 1.0 . . . . . . . . . . . . A .  2 A H4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6792 . 1 1  2 A H5'  H -24.579  14.453 19.869 . . . 1.0 . . . . . . . . . . . . A .  2 A H5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6793 . 1 1  2 A H5'' H -25.056  12.819 20.374 . . . 1.0 . . . . . . . . . . . . A .  2 A H5'' . . . . . . . . . rr_2l5z 1 
       .  9 .  6794 . 1 1  2 A H61  H -18.567  17.587 26.731 . . . 1.0 . . . . . . . . . . . . A .  2 A H61  . . . . . . . . . rr_2l5z 1 
       .  9 .  6795 . 1 1  2 A H62  H -20.270  17.527 26.334 . . . 1.0 . . . . . . . . . . . . A .  2 A H62  . . . . . . . . . rr_2l5z 1 
       .  9 .  6796 . 1 1  2 A H8   H -22.765  15.313 22.844 . . . 1.0 . . . . . . . . . . . . A .  2 A H8   . . . . . . . . . rr_2l5z 1 
       .  9 .  6797 . 1 1  2 A HO2' H -20.339  12.052 19.977 . . . 1.0 . . . . . . . . . . . . A .  2 A HO2' . . . . . . . . . rr_2l5z 1 
       .  9 .  6798 . 1 1  2 A N1   N -17.772  16.111 24.853 . . . 1.0 . . . . . . . . . . . . A .  2 A N1   . . . . . . . . . rr_2l5z 1 
       .  9 .  6799 . 1 1  2 A N3   N -18.335  14.793 22.942 . . . 1.0 . . . . . . . . . . . . A .  2 A N3   . . . . . . . . . rr_2l5z 1 
       .  9 .  6800 . 1 1  2 A N6   N -19.317  17.256 26.140 . . . 1.0 . . . . . . . . . . . . A .  2 A N6   . . . . . . . . . rr_2l5z 1 
       .  9 .  6801 . 1 1  2 A N7   N -21.428  16.127 24.204 . . . 1.0 . . . . . . . . . . . . A .  2 A N7   . . . . . . . . . rr_2l5z 1 
       .  9 .  6802 . 1 1  2 A N9   N -20.731  14.808 22.523 . . . 1.0 . . . . . . . . . . . . A .  2 A N9   . . . . . . . . . rr_2l5z 1 
       .  9 .  6803 . 1 1  2 A O2'  O -20.378  11.607 20.827 . . . 1.0 . . . . . . . . . . . . A .  2 A O2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6804 . 1 1  2 A O3'  O -22.838  10.950 21.311 . . . 1.0 . . . . . . . . . . . . A .  2 A O3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6805 . 1 1  2 A O4'  O -22.046  14.317 20.574 . . . 1.0 . . . . . . . . . . . . A .  2 A O4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6806 . 1 1  2 A O5'  O -24.718  14.158 21.905 . . . 1.0 . . . . . . . . . . . . A .  2 A O5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6807 . 1 1  2 A OP1  O -27.137  13.607 21.550 . . . 1.0 . . . . . . . . . . . . A .  2 A OP1  . . . . . . . . . rr_2l5z 1 
       .  9 .  6808 . 1 1  2 A OP2  O -26.328  14.587 23.776 . . . 1.0 . . . . . . . . . . . . A .  2 A OP2  . . . . . . . . . rr_2l5z 1 
       .  9 .  6809 . 1 1  2 A P    P -26.238  14.514 22.301 . . . 1.0 . . . . . . . . . . . . A .  2 A P    . . . . . . . . . rr_2l5z 1 
       .  9 .  6810 . 1 1  3 G C1'  C -17.881  10.490 23.750 . . . 1.0 . . . . . . . . . . . . A .  3 G C1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6811 . 1 1  3 G C2   C -15.926  13.127 26.710 . . . 1.0 . . . . . . . . . . . . A .  3 G C2   . . . . . . . . . rr_2l5z 1 
       .  9 .  6812 . 1 1  3 G C2'  C -17.660   9.060 24.248 . . . 1.0 . . . . . . . . . . . . A .  3 G C2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6813 . 1 1  3 G C3'  C -18.885   8.330 23.725 . . . 1.0 . . . . . . . . . . . . A .  3 G C3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6814 . 1 1  3 G C4   C -17.658  12.138 25.714 . . . 1.0 . . . . . . . . . . . . A .  3 G C4   . . . . . . . . . rr_2l5z 1 
       .  9 .  6815 . 1 1  3 G C4'  C -19.162   9.054 22.418 . . . 1.0 . . . . . . . . . . . . A .  3 G C4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6816 . 1 1  3 G C5   C -18.604  12.720 26.545 . . . 1.0 . . . . . . . . . . . . A .  3 G C5   . . . . . . . . . rr_2l5z 1 
       .  9 .  6817 . 1 1  3 G C5'  C -20.616   8.891 21.975 . . . 1.0 . . . . . . . . . . . . A .  3 G C5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6818 . 1 1  3 G C6   C -18.181  13.604 27.574 . . . 1.0 . . . . . . . . . . . . A .  3 G C6   . . . . . . . . . rr_2l5z 1 
       .  9 .  6819 . 1 1  3 G C8   C -19.654  11.511 25.195 . . . 1.0 . . . . . . . . . . . . A .  3 G C8   . . . . . . . . . rr_2l5z 1 
       .  9 .  6820 . 1 1  3 G H1   H -16.411  14.385 28.311 . . . 1.0 . . . . . . . . . . . . A .  3 G H1   . . . . . . . . . rr_2l5z 1 
       .  9 .  6821 . 1 1  3 G H1'  H -16.942  10.890 23.367 . . . 1.0 . . . . . . . . . . . . A .  3 G H1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6822 . 1 1  3 G H2'  H -17.653   9.041 25.341 . . . 1.0 . . . . . . . . . . . . A .  3 G H2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6823 . 1 1  3 G H21  H -14.336  14.024 27.609 . . . 1.0 . . . . . . . . . . . . A .  3 G H21  . . . . . . . . . rr_2l5z 1 
       .  9 .  6824 . 1 1  3 G H22  H -13.945  12.969 26.270 . . . 1.0 . . . . . . . . . . . . A .  3 G H22  . . . . . . . . . rr_2l5z 1 
       .  9 .  6825 . 1 1  3 G H3'  H -19.723   8.394 24.422 . . . 1.0 . . . . . . . . . . . . A .  3 G H3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6826 . 1 1  3 G H4'  H -18.500   8.674 21.643 . . . 1.0 . . . . . . . . . . . . A .  3 G H4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6827 . 1 1  3 G H5'  H -20.741   9.346 20.992 . . . 1.0 . . . . . . . . . . . . A .  3 G H5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6828 . 1 1  3 G H5'' H -20.850   7.830 21.907 . . . 1.0 . . . . . . . . . . . . A .  3 G H5'' . . . . . . . . . rr_2l5z 1 
       .  9 .  6829 . 1 1  3 G H8   H -20.449  10.999 24.674 . . . 1.0 . . . . . . . . . . . . A .  3 G H8   . . . . . . . . . rr_2l5z 1 
       .  9 .  6830 . 1 1  3 G HO2' H -16.642   8.208 22.825 . . . 1.0 . . . . . . . . . . . . A .  3 G HO2' . . . . . . . . . rr_2l5z 1 
       .  9 .  6831 . 1 1  3 G N1   N -16.798  13.752 27.582 . . . 1.0 . . . . . . . . . . . . A .  3 G N1   . . . . . . . . . rr_2l5z 1 
       .  9 .  6832 . 1 1  3 G N2   N -14.631  13.396 26.876 . . . 1.0 . . . . . . . . . . . . A .  3 G N2   . . . . . . . . . rr_2l5z 1 
       .  9 .  6833 . 1 1  3 G N3   N -16.316  12.296 25.740 . . . 1.0 . . . . . . . . . . . . A .  3 G N3   . . . . . . . . . rr_2l5z 1 
       .  9 .  6834 . 1 1  3 G N7   N -19.898  12.300 26.191 . . . 1.0 . . . . . . . . . . . . A .  3 G N7   . . . . . . . . . rr_2l5z 1 
       .  9 .  6835 . 1 1  3 G N9   N -18.366  11.353 24.843 . . . 1.0 . . . . . . . . . . . . A .  3 G N9   . . . . . . . . . rr_2l5z 1 
       .  9 .  6836 . 1 1  3 G O2'  O -16.452   8.502 23.719 . . . 1.0 . . . . . . . . . . . . A .  3 G O2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6837 . 1 1  3 G O3'  O -18.522   6.978 23.432 . . . 1.0 . . . . . . . . . . . . A .  3 G O3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6838 . 1 1  3 G O4'  O -18.842  10.420 22.680 . . . 1.0 . . . . . . . . . . . . A .  3 G O4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6839 . 1 1  3 G O5'  O -21.521   9.511 22.893 . . . 1.0 . . . . . . . . . . . . A .  3 G O5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6840 . 1 1  3 G O6   O -18.871  14.205 28.397 . . . 1.0 . . . . . . . . . . . . A .  3 G O6   . . . . . . . . . rr_2l5z 1 
       .  9 .  6841 . 1 1  3 G OP1  O -23.598   8.617 21.816 . . . 1.0 . . . . . . . . . . . . A .  3 G OP1  . . . . . . . . . rr_2l5z 1 
       .  9 .  6842 . 1 1  3 G OP2  O -23.732  10.453 23.598 . . . 1.0 . . . . . . . . . . . . A .  3 G OP2  . . . . . . . . . rr_2l5z 1 
       .  9 .  6843 . 1 1  3 G P    P -23.035   9.829 22.451 . . . 1.0 . . . . . . . . . . . . A .  3 G P    . . . . . . . . . rr_2l5z 1 
       .  9 .  6844 . 1 1  4 C C1'  C -15.900   8.299 28.202 . . . 1.0 . . . . . . . . . . . . A .  4 C C1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6845 . 1 1  4 C C2   C -16.719  10.086 29.726 . . . 1.0 . . . . . . . . . . . . A .  4 C C2   . . . . . . . . . rr_2l5z 1 
       .  9 .  6846 . 1 1  4 C C2'  C -15.777   7.027 29.054 . . . 1.0 . . . . . . . . . . . . A .  4 C C2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6847 . 1 1  4 C C3'  C -16.141   5.903 28.084 . . . 1.0 . . . . . . . . . . . . A .  4 C C3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6848 . 1 1  4 C C4   C -18.961  10.780 29.677 . . . 1.0 . . . . . . . . . . . . A .  4 C C4   . . . . . . . . . rr_2l5z 1 
       .  9 .  6849 . 1 1  4 C C4'  C -15.808   6.504 26.730 . . . 1.0 . . . . . . . . . . . . A .  4 C C4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6850 . 1 1  4 C C5   C -19.260   9.848 28.635 . . . 1.0 . . . . . . . . . . . . A .  4 C C5   . . . . . . . . . rr_2l5z 1 
       .  9 .  6851 . 1 1  4 C C5'  C -16.573   5.825 25.594 . . . 1.0 . . . . . . . . . . . . A .  4 C C5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6852 . 1 1  4 C C6   C -18.259   9.066 28.183 . . . 1.0 . . . . . . . . . . . . A .  4 C C6   . . . . . . . . . rr_2l5z 1 
       .  9 .  6853 . 1 1  4 C H1'  H -14.947   8.837 28.218 . . . 1.0 . . . . . . . . . . . . A .  4 C H1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6854 . 1 1  4 C H2'  H -16.498   7.062 29.876 . . . 1.0 . . . . . . . . . . . . A .  4 C H2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6855 . 1 1  4 C H3'  H -17.192   5.616 28.163 . . . 1.0 . . . . . . . . . . . . A .  4 C H3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6856 . 1 1  4 C H4'  H -14.737   6.428 26.548 . . . 1.0 . . . . . . . . . . . . A .  4 C H4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6857 . 1 1  4 C H41  H -19.719  12.226 30.892 . . . 1.0 . . . . . . . . . . . . A .  4 C H41  . . . . . . . . . rr_2l5z 1 
       .  9 .  6858 . 1 1  4 C H42  H -20.861  11.501 29.785 . . . 1.0 . . . . . . . . . . . . A .  4 C H42  . . . . . . . . . rr_2l5z 1 
       .  9 .  6859 . 1 1  4 C H5   H -20.255   9.774 28.225 . . . 1.0 . . . . . . . . . . . . A .  4 C H5   . . . . . . . . . rr_2l5z 1 
       .  9 .  6860 . 1 1  4 C H5'  H -16.223   6.225 24.642 . . . 1.0 . . . . . . . . . . . . A .  4 C H5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6861 . 1 1  4 C H5'' H -16.374   4.755 25.623 . . . 1.0 . . . . . . . . . . . . A .  4 C H5'' . . . . . . . . . rr_2l5z 1 
       .  9 .  6862 . 1 1  4 C H6   H -18.462   8.321 27.426 . . . 1.0 . . . . . . . . . . . . A .  4 C H6   . . . . . . . . . rr_2l5z 1 
       .  9 .  6863 . 1 1  4 C HO2' H -14.353   7.454 30.312 . . . 1.0 . . . . . . . . . . . . A .  4 C HO2' . . . . . . . . . rr_2l5z 1 
       .  9 .  6864 . 1 1  4 C N1   N -17.001   9.171 28.707 . . . 1.0 . . . . . . . . . . . . A .  4 C N1   . . . . . . . . . rr_2l5z 1 
       .  9 .  6865 . 1 1  4 C N3   N -17.727  10.874 30.186 . . . 1.0 . . . . . . . . . . . . A .  4 C N3   . . . . . . . . . rr_2l5z 1 
       .  9 .  6866 . 1 1  4 C N4   N -19.925  11.566 30.157 . . . 1.0 . . . . . . . . . . . . A .  4 C N4   . . . . . . . . . rr_2l5z 1 
       .  9 .  6867 . 1 1  4 C O2   O -15.581  10.163 30.189 . . . 1.0 . . . . . . . . . . . . A .  4 C O2   . . . . . . . . . rr_2l5z 1 
       .  9 .  6868 . 1 1  4 C O2'  O -14.446   6.867 29.558 . . . 1.0 . . . . . . . . . . . . A .  4 C O2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6869 . 1 1  4 C O3'  O -15.259   4.799 28.318 . . . 1.0 . . . . . . . . . . . . A .  4 C O3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6870 . 1 1  4 C O4'  O -16.163   7.873 26.856 . . . 1.0 . . . . . . . . . . . . A .  4 C O4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6871 . 1 1  4 C O5'  O -17.981   6.042 25.700 . . . 1.0 . . . . . . . . . . . . A .  4 C O5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6872 . 1 1  4 C OP1  O -18.557   4.501 23.811 . . . 1.0 . . . . . . . . . . . . A .  4 C OP1  . . . . . . . . . rr_2l5z 1 
       .  9 .  6873 . 1 1  4 C OP2  O -20.341   6.013 24.859 . . . 1.0 . . . . . . . . . . . . A .  4 C OP2  . . . . . . . . . rr_2l5z 1 
       .  9 .  6874 . 1 1  4 C P    P -18.942   5.788 24.433 . . . 1.0 . . . . . . . . . . . . A .  4 C P    . . . . . . . . . rr_2l5z 1 
       .  9 .  6875 . 1 1  5 U C1'  C -15.357   7.058 33.382 . . . 1.0 . . . . . . . . . . . . A .  5 U C1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6876 . 1 1  5 U C2   C -17.402   8.332 33.989 . . . 1.0 . . . . . . . . . . . . A .  5 U C2   . . . . . . . . . rr_2l5z 1 
       .  9 .  6877 . 1 1  5 U C2'  C -15.113   6.053 34.515 . . . 1.0 . . . . . . . . . . . . A .  5 U C2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6878 . 1 1  5 U C3'  C -14.716   4.778 33.779 . . . 1.0 . . . . . . . . . . . . A .  5 U C3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6879 . 1 1  5 U C4   C -19.577   7.820 32.945 . . . 1.0 . . . . . . . . . . . . A .  5 U C4   . . . . . . . . . rr_2l5z 1 
       .  9 .  6880 . 1 1  5 U C4'  C -14.087   5.303 32.497 . . . 1.0 . . . . . . . . . . . . A .  5 U C4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6881 . 1 1  5 U C5   C -18.890   6.795 32.191 . . . 1.0 . . . . . . . . . . . . A .  5 U C5   . . . . . . . . . rr_2l5z 1 
       .  9 .  6882 . 1 1  5 U C5'  C -14.162   4.288 31.352 . . . 1.0 . . . . . . . . . . . . A .  5 U C5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6883 . 1 1  5 U C6   C -17.561   6.586 32.346 . . . 1.0 . . . . . . . . . . . . A .  5 U C6   . . . . . . . . . rr_2l5z 1 
       .  9 .  6884 . 1 1  5 U H1'  H -14.815   7.985 33.597 . . . 1.0 . . . . . . . . . . . . A .  5 U H1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6885 . 1 1  5 U H2'  H -16.040   5.889 35.076 . . . 1.0 . . . . . . . . . . . . A .  5 U H2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6886 . 1 1  5 U H3   H -19.213   9.256 34.395 . . . 1.0 . . . . . . . . . . . . A .  5 U H3   . . . . . . . . . rr_2l5z 1 
       .  9 .  6887 . 1 1  5 U H3'  H -15.578   4.132 33.588 . . . 1.0 . . . . . . . . . . . . A .  5 U H3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6888 . 1 1  5 U H4'  H -13.048   5.566 32.682 . . . 1.0 . . . . . . . . . . . . A .  5 U H4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6889 . 1 1  5 U H5   H -19.451   6.171 31.510 . . . 1.0 . . . . . . . . . . . . A .  5 U H5   . . . . . . . . . rr_2l5z 1 
       .  9 .  6890 . 1 1  5 U H5'  H -13.433   4.562 30.589 . . . 1.0 . . . . . . . . . . . . A .  5 U H5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6891 . 1 1  5 U H5'' H -13.919   3.294 31.731 . . . 1.0 . . . . . . . . . . . . A .  5 U H5'' . . . . . . . . . rr_2l5z 1 
       .  9 .  6892 . 1 1  5 U H6   H -17.079   5.808 31.773 . . . 1.0 . . . . . . . . . . . . A .  5 U H6   . . . . . . . . . rr_2l5z 1 
       .  9 .  6893 . 1 1  5 U HO2' H -13.917   7.425 35.203 . . . 1.0 . . . . . . . . . . . . A .  5 U HO2' . . . . . . . . . rr_2l5z 1 
       .  9 .  6894 . 1 1  5 U N1   N -16.816   7.329 33.222 . . . 1.0 . . . . . . . . . . . . A .  5 U N1   . . . . . . . . . rr_2l5z 1 
       .  9 .  6895 . 1 1  5 U N3   N -18.760   8.525 33.810 . . . 1.0 . . . . . . . . . . . . A .  5 U N3   . . . . . . . . . rr_2l5z 1 
       .  9 .  6896 . 1 1  5 U O2   O -16.750   9.010 34.779 . . . 1.0 . . . . . . . . . . . . A .  5 U O2   . . . . . . . . . rr_2l5z 1 
       .  9 .  6897 . 1 1  5 U O2'  O -14.067   6.495 35.387 . . . 1.0 . . . . . . . . . . . . A .  5 U O2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6898 . 1 1  5 U O3'  O -13.702   4.116 34.540 . . . 1.0 . . . . . . . . . . . . A .  5 U O3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6899 . 1 1  5 U O4   O -20.773   8.082 32.860 . . . 1.0 . . . . . . . . . . . . A .  5 U O4   . . . . . . . . . rr_2l5z 1 
       .  9 .  6900 . 1 1  5 U O4'  O -14.817   6.481 32.182 . . . 1.0 . . . . . . . . . . . . A .  5 U O4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6901 . 1 1  5 U O5'  O -15.463   4.261 30.762 . . . 1.0 . . . . . . . . . . . . A .  5 U O5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6902 . 1 1  5 U OP1  O -14.722   2.496 29.147 . . . 1.0 . . . . . . . . . . . . A .  5 U OP1  . . . . . . . . . rr_2l5z 1 
       .  9 .  6903 . 1 1  5 U OP2  O -17.136   3.354 29.135 . . . 1.0 . . . . . . . . . . . . A .  5 U OP2  . . . . . . . . . rr_2l5z 1 
       .  9 .  6904 . 1 1  5 U P    P -15.689   3.605 29.310 . . . 1.0 . . . . . . . . . . . . A .  5 U P    . . . . . . . . . rr_2l5z 1 
       .  9 .  6905 . 1 1  6 G C1'  C -18.492   5.227 37.827 . . . 1.0 . . . . . . . . . . . . A .  6 G C1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6906 . 1 1  6 G C2   C -20.720   9.040 37.493 . . . 1.0 . . . . . . . . . . . . A .  6 G C2   . . . . . . . . . rr_2l5z 1 
       .  9 .  6907 . 1 1  6 G C2'  C -19.102   4.082 38.645 . . . 1.0 . . . . . . . . . . . . A .  6 G C2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6908 . 1 1  6 G C3'  C -18.121   2.915 38.450 . . . 1.0 . . . . . . . . . . . . A .  6 G C3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6909 . 1 1  6 G C4   C -20.114   6.987 36.868 . . . 1.0 . . . . . . . . . . . . A .  6 G C4   . . . . . . . . . rr_2l5z 1 
       .  9 .  6910 . 1 1  6 G C4'  C -16.865   3.593 37.905 . . . 1.0 . . . . . . . . . . . . A .  6 G C4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6911 . 1 1  6 G C5   C -20.946   6.967 35.757 . . . 1.0 . . . . . . . . . . . . A .  6 G C5   . . . . . . . . . rr_2l5z 1 
       .  9 .  6912 . 1 1  6 G C5'  C -16.015   2.647 37.051 . . . 1.0 . . . . . . . . . . . . A .  6 G C5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6913 . 1 1  6 G C6   C -21.757   8.098 35.471 . . . 1.0 . . . . . . . . . . . . A .  6 G C6   . . . . . . . . . rr_2l5z 1 
       .  9 .  6914 . 1 1  6 G C8   C -19.952   5.125 35.791 . . . 1.0 . . . . . . . . . . . . A .  6 G C8   . . . . . . . . . rr_2l5z 1 
       .  9 .  6915 . 1 1  6 G H1   H -22.138   9.968 36.266 . . . 1.0 . . . . . . . . . . . . A .  6 G H1   . . . . . . . . . rr_2l5z 1 
       .  9 .  6916 . 1 1  6 G H1'  H -18.170   6.019 38.503 . . . 1.0 . . . . . . . . . . . . A .  6 G H1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6917 . 1 1  6 G H2'  H -20.087   3.825 38.239 . . . 1.0 . . . . . . . . . . . . A .  6 G H2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6918 . 1 1  6 G H21  H -21.269  10.913 38.074 . . . 1.0 . . . . . . . . . . . . A .  6 G H21  . . . . . . . . . rr_2l5z 1 
       .  9 .  6919 . 1 1  6 G H22  H -20.085  10.126 39.094 . . . 1.0 . . . . . . . . . . . . A .  6 G H22  . . . . . . . . . rr_2l5z 1 
       .  9 .  6920 . 1 1  6 G H3'  H -18.516   2.153 37.768 . . . 1.0 . . . . . . . . . . . . A .  6 G H3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6921 . 1 1  6 G H4'  H -16.267   3.968 38.734 . . . 1.0 . . . . . . . . . . . . A .  6 G H4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6922 . 1 1  6 G H5'  H -15.782   1.756 37.633 . . . 1.0 . . . . . . . . . . . . A .  6 G H5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6923 . 1 1  6 G H5'' H -16.585   2.354 36.169 . . . 1.0 . . . . . . . . . . . . A .  6 G H5'' . . . . . . . . . rr_2l5z 1 
       .  9 .  6924 . 1 1  6 G H8   H -19.622   4.128 35.540 . . . 1.0 . . . . . . . . . . . . A .  6 G H8   . . . . . . . . . rr_2l5z 1 
       .  9 .  6925 . 1 1  6 G HO2' H -19.571   5.326 40.066 . . . 1.0 . . . . . . . . . . . . A .  6 G HO2' . . . . . . . . . rr_2l5z 1 
       .  9 .  6926 . 1 1  6 G N1   N -21.576   9.105 36.410 . . . 1.0 . . . . . . . . . . . . A .  6 G N1   . . . . . . . . . rr_2l5z 1 
       .  9 .  6927 . 1 1  6 G N2   N -20.689  10.114 38.284 . . . 1.0 . . . . . . . . . . . . A .  6 G N2   . . . . . . . . . rr_2l5z 1 
       .  9 .  6928 . 1 1  6 G N3   N -19.953   7.981 37.771 . . . 1.0 . . . . . . . . . . . . A .  6 G N3   . . . . . . . . . rr_2l5z 1 
       .  9 .  6929 . 1 1  6 G N7   N -20.825   5.748 35.070 . . . 1.0 . . . . . . . . . . . . A .  6 G N7   . . . . . . . . . rr_2l5z 1 
       .  9 .  6930 . 1 1  6 G N9   N -19.475   5.773 36.870 . . . 1.0 . . . . . . . . . . . . A .  6 G N9   . . . . . . . . . rr_2l5z 1 
       .  9 .  6931 . 1 1  6 G O2'  O -19.209   4.438 40.027 . . . 1.0 . . . . . . . . . . . . A .  6 G O2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6932 . 1 1  6 G O3'  O -17.811   2.375 39.738 . . . 1.0 . . . . . . . . . . . . A .  6 G O3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6933 . 1 1  6 G O4'  O -17.352   4.691 37.149 . . . 1.0 . . . . . . . . . . . . A .  6 G O4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6934 . 1 1  6 G O5'  O -14.796   3.264 36.634 . . . 1.0 . . . . . . . . . . . . A .  6 G O5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6935 . 1 1  6 G O6   O -22.546   8.253 34.542 . . . 1.0 . . . . . . . . . . . . A .  6 G O6   . . . . . . . . . rr_2l5z 1 
       .  9 .  6936 . 1 1  6 G OP1  O -12.745   2.138 35.741 . . . 1.0 . . . . . . . . . . . . A .  6 G OP1  . . . . . . . . . rr_2l5z 1 
       .  9 .  6937 . 1 1  6 G OP2  O -14.982   1.963 34.503 . . . 1.0 . . . . . . . . . . . . A .  6 G OP2  . . . . . . . . . rr_2l5z 1 
       .  9 .  6938 . 1 1  6 G P    P -14.027   2.745 35.319 . . . 1.0 . . . . . . . . . . . . A .  6 G P    . . . . . . . . . rr_2l5z 1 
       .  9 .  6939 . 1 1  7 C C1'  C -17.892   3.479 44.615 . . . 1.0 . . . . . . . . . . . . A .  7 C C1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6940 . 1 1  7 C C2   C -20.037   4.590 45.061 . . . 1.0 . . . . . . . . . . . . A .  7 C C2   . . . . . . . . . rr_2l5z 1 
       .  9 .  6941 . 1 1  7 C C2'  C -18.059   2.205 45.443 . . . 1.0 . . . . . . . . . . . . A .  7 C C2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6942 . 1 1  7 C C3'  C -17.720   1.112 44.447 . . . 1.0 . . . . . . . . . . . . A .  7 C C3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6943 . 1 1  7 C C4   C -21.623   4.906 43.357 . . . 1.0 . . . . . . . . . . . . A .  7 C C4   . . . . . . . . . rr_2l5z 1 
       .  9 .  6944 . 1 1  7 C C4'  C -16.663   1.773 43.570 . . . 1.0 . . . . . . . . . . . . A .  7 C C4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6945 . 1 1  7 C C5   C -20.769   4.270 42.402 . . . 1.0 . . . . . . . . . . . . A .  7 C C5   . . . . . . . . . rr_2l5z 1 
       .  9 .  6946 . 1 1  7 C C5'  C -16.602   1.149 42.175 . . . 1.0 . . . . . . . . . . . . A .  7 C C5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6947 . 1 1  7 C C6   C -19.574   3.820 42.833 . . . 1.0 . . . . . . . . . . . . A .  7 C C6   . . . . . . . . . rr_2l5z 1 
       .  9 .  6948 . 1 1  7 C H1'  H -17.413   4.247 45.224 . . . 1.0 . . . . . . . . . . . . A .  7 C H1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6949 . 1 1  7 C H2'  H -19.098   2.104 45.770 . . . 1.0 . . . . . . . . . . . . A .  7 C H2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6950 . 1 1  7 C H3'  H -18.598   0.798 43.880 . . . 1.0 . . . . . . . . . . . . A .  7 C H3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6951 . 1 1  7 C H4'  H -15.689   1.687 44.049 . . . 1.0 . . . . . . . . . . . . A .  7 C H4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6952 . 1 1  7 C H41  H -23.422   5.816 43.643 . . . 1.0 . . . . . . . . . . . . A .  7 C H41  . . . . . . . . . rr_2l5z 1 
       .  9 .  6953 . 1 1  7 C H42  H -23.109   5.265 42.012 . . . 1.0 . . . . . . . . . . . . A .  7 C H42  . . . . . . . . . rr_2l5z 1 
       .  9 .  6954 . 1 1  7 C H5   H -21.070   4.154 41.372 . . . 1.0 . . . . . . . . . . . . A .  7 C H5   . . . . . . . . . rr_2l5z 1 
       .  9 .  6955 . 1 1  7 C H5'  H -16.146   1.861 41.487 . . . 1.0 . . . . . . . . . . . . A .  7 C H5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6956 . 1 1  7 C H5'' H -15.988   0.250 42.213 . . . 1.0 . . . . . . . . . . . . A .  7 C H5'' . . . . . . . . . rr_2l5z 1 
       .  9 .  6957 . 1 1  7 C H6   H -18.906   3.331 42.140 . . . 1.0 . . . . . . . . . . . . A .  7 C H6   . . . . . . . . . rr_2l5z 1 
       .  9 .  6958 . 1 1  7 C HO2' H -17.549   1.605 47.224 . . . 1.0 . . . . . . . . . . . . A .  7 C HO2' . . . . . . . . . rr_2l5z 1 
       .  9 .  6959 . 1 1  7 C N1   N -19.203   3.972 44.138 . . . 1.0 . . . . . . . . . . . . A .  7 C N1   . . . . . . . . . rr_2l5z 1 
       .  9 .  6960 . 1 1  7 C N3   N -21.245   5.047 44.634 . . . 1.0 . . . . . . . . . . . . A .  7 C N3   . . . . . . . . . rr_2l5z 1 
       .  9 .  6961 . 1 1  7 C N4   N -22.814   5.366 42.973 . . . 1.0 . . . . . . . . . . . . A .  7 C N4   . . . . . . . . . rr_2l5z 1 
       .  9 .  6962 . 1 1  7 C O2   O -19.678   4.713 46.230 . . . 1.0 . . . . . . . . . . . . A .  7 C O2   . . . . . . . . . rr_2l5z 1 
       .  9 .  6963 . 1 1  7 C O2'  O -17.167   2.188 46.564 . . . 1.0 . . . . . . . . . . . . A .  7 C O2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6964 . 1 1  7 C O3'  O -17.114   0.026 45.154 . . . 1.0 . . . . . . . . . . . . A .  7 C O3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6965 . 1 1  7 C O4'  O -17.033   3.151 43.507 . . . 1.0 . . . . . . . . . . . . A .  7 C O4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6966 . 1 1  7 C O5'  O -17.906   0.803 41.697 . . . 1.0 . . . . . . . . . . . . A .  7 C O5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6967 . 1 1  7 C OP1  O -17.362  -0.068 39.412 . . . 1.0 . . . . . . . . . . . . A .  7 C OP1  . . . . . . . . . rr_2l5z 1 
       .  9 .  6968 . 1 1  7 C OP2  O -19.719   0.769 39.968 . . . 1.0 . . . . . . . . . . . . A .  7 C OP2  . . . . . . . . . rr_2l5z 1 
       .  9 .  6969 . 1 1  7 C P    P -18.251   0.876 40.125 . . . 1.0 . . . . . . . . . . . . A .  7 C P    . . . . . . . . . rr_2l5z 1 
       .  9 .  6970 . 1 1  8 A C1'  C -23.206   0.753 45.276 . . . 1.0 . . . . . . . . . . . . A .  8 A C1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6971 . 1 1  8 A C2   C -25.312   4.640 45.135 . . . 1.0 . . . . . . . . . . . . A .  8 A C2   . . . . . . . . . rr_2l5z 1 
       .  9 .  6972 . 1 1  8 A C2'  C -22.935   0.769 43.766 . . . 1.0 . . . . . . . . . . . . A .  8 A C2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6973 . 1 1  8 A C3'  C -21.811  -0.258 43.579 . . . 1.0 . . . . . . . . . . . . A .  8 A C3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6974 . 1 1  8 A C4   C -23.723   3.233 45.749 . . . 1.0 . . . . . . . . . . . . A .  8 A C4   . . . . . . . . . rr_2l5z 1 
       .  9 .  6975 . 1 1  8 A C4'  C -21.892  -1.110 44.843 . . . 1.0 . . . . . . . . . . . . A .  8 A C4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6976 . 1 1  8 A C5   C -23.076   4.176 46.514 . . . 1.0 . . . . . . . . . . . . A .  8 A C5   . . . . . . . . . rr_2l5z 1 
       .  9 .  6977 . 1 1  8 A C5'  C -20.547  -1.750 45.200 . . . 1.0 . . . . . . . . . . . . A .  8 A C5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6978 . 1 1  8 A C6   C -23.651   5.451 46.550 . . . 1.0 . . . . . . . . . . . . A .  8 A C6   . . . . . . . . . rr_2l5z 1 
       .  9 .  6979 . 1 1  8 A C8   C -21.962   2.413 46.680 . . . 1.0 . . . . . . . . . . . . A .  8 A C8   . . . . . . . . . rr_2l5z 1 
       .  9 .  6980 . 1 1  8 A H1'  H -24.239   0.452 45.451 . . . 1.0 . . . . . . . . . . . . A .  8 A H1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6981 . 1 1  8 A H2   H -26.224   4.866 44.585 . . . 1.0 . . . . . . . . . . . . A .  8 A H2   . . . . . . . . . rr_2l5z 1 
       .  9 .  6982 . 1 1  8 A H2'  H -22.595   1.766 43.462 . . . 1.0 . . . . . . . . . . . . A .  8 A H2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6983 . 1 1  8 A H3'  H -20.834   0.221 43.456 . . . 1.0 . . . . . . . . . . . . A .  8 A H3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6984 . 1 1  8 A H4'  H -22.640  -1.889 44.708 . . . 1.0 . . . . . . . . . . . . A .  8 A H4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6985 . 1 1  8 A H5'  H -20.623  -2.209 46.187 . . . 1.0 . . . . . . . . . . . . A .  8 A H5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6986 . 1 1  8 A H5'' H -20.313  -2.521 44.467 . . . 1.0 . . . . . . . . . . . . A .  8 A H5'' . . . . . . . . . rr_2l5z 1 
       .  9 .  6987 . 1 1  8 A H61  H -23.594   7.365 47.241 . . . 1.0 . . . . . . . . . . . . A .  8 A H61  . . . . . . . . . rr_2l5z 1 
       .  9 .  6988 . 1 1  8 A H62  H -22.293   6.330 47.784 . . . 1.0 . . . . . . . . . . . . A .  8 A H62  . . . . . . . . . rr_2l5z 1 
       .  9 .  6989 . 1 1  8 A H8   H -21.206   1.693 46.955 . . . 1.0 . . . . . . . . . . . . A .  8 A H8   . . . . . . . . . rr_2l5z 1 
       .  9 .  6990 . 1 1  8 A HO2' H -24.596  -0.227 43.572 . . . 1.0 . . . . . . . . . . . . A .  8 A HO2' . . . . . . . . . rr_2l5z 1 
       .  9 .  6991 . 1 1  8 A N1   N -24.779   5.641 45.841 . . . 1.0 . . . . . . . . . . . . A .  8 A N1   . . . . . . . . . rr_2l5z 1 
       .  9 .  6992 . 1 1  8 A N3   N -24.851   3.396 45.030 . . . 1.0 . . . . . . . . . . . . A .  8 A N3   . . . . . . . . . rr_2l5z 1 
       .  9 .  6993 . 1 1  8 A N6   N -23.138   6.464 47.248 . . . 1.0 . . . . . . . . . . . . A .  8 A N6   . . . . . . . . . rr_2l5z 1 
       .  9 .  6994 . 1 1  8 A N7   N -21.928   3.630 47.115 . . . 1.0 . . . . . . . . . . . . A .  8 A N7   . . . . . . . . . rr_2l5z 1 
       .  9 .  6995 . 1 1  8 A N9   N -22.984   2.086 45.868 . . . 1.0 . . . . . . . . . . . . A .  8 A N9   . . . . . . . . . rr_2l5z 1 
       .  9 .  6996 . 1 1  8 A O2'  O -24.104   0.392 43.029 . . . 1.0 . . . . . . . . . . . . A .  8 A O2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6997 . 1 1  8 A O3'  O -22.147  -1.085 42.461 . . . 1.0 . . . . . . . . . . . . A .  8 A O3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6998 . 1 1  8 A O4'  O -22.327  -0.217 45.856 . . . 1.0 . . . . . . . . . . . . A .  8 A O4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  6999 . 1 1  8 A O5'  O -19.492  -0.785 45.215 . . . 1.0 . . . . . . . . . . . . A .  8 A O5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7000 . 1 1  8 A OP1  O -17.979  -1.177 47.174 . . . 1.0 . . . . . . . . . . . . A .  8 A OP1  . . . . . . . . . rr_2l5z 1 
       .  9 .  7001 . 1 1  8 A OP2  O -17.612  -2.421 44.964 . . . 1.0 . . . . . . . . . . . . A .  8 A OP2  . . . . . . . . . rr_2l5z 1 
       .  9 .  7002 . 1 1  8 A P    P -18.011  -1.197 45.694 . . . 1.0 . . . . . . . . . . . . A .  8 A P    . . . . . . . . . rr_2l5z 1 
       .  9 .  7003 . 1 1  9 G C1'  C -24.043   1.648 39.844 . . . 1.0 . . . . . . . . . . . . A .  9 G C1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7004 . 1 1  9 G C2   C -25.097   5.936 39.957 . . . 1.0 . . . . . . . . . . . . A .  9 G C2   . . . . . . . . . rr_2l5z 1 
       .  9 .  7005 . 1 1  9 G C2'  C -25.256   0.740 39.598 . . . 1.0 . . . . . . . . . . . . A .  9 G C2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7006 . 1 1  9 G C3'  C -24.651  -0.664 39.462 . . . 1.0 . . . . . . . . . . . . A .  9 G C3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7007 . 1 1  9 G C4   C -24.368   4.058 39.004 . . . 1.0 . . . . . . . . . . . . A .  9 G C4   . . . . . . . . . rr_2l5z 1 
       .  9 .  7008 . 1 1  9 G C4'  C -23.255  -0.509 40.062 . . . 1.0 . . . . . . . . . . . . A .  9 G C4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7009 . 1 1  9 G C5   C -24.175   4.638 37.759 . . . 1.0 . . . . . . . . . . . . A .  9 G C5   . . . . . . . . . rr_2l5z 1 
       .  9 .  7010 . 1 1  9 G C5'  C -22.258  -1.520 39.494 . . . 1.0 . . . . . . . . . . . . A .  9 G C5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7011 . 1 1  9 G C6   C -24.472   6.015 37.576 . . . 1.0 . . . . . . . . . . . . A .  9 G C6   . . . . . . . . . rr_2l5z 1 
       .  9 .  7012 . 1 1  9 G C8   C -23.621   2.626 37.576 . . . 1.0 . . . . . . . . . . . . A .  9 G C8   . . . . . . . . . rr_2l5z 1 
       .  9 .  7013 . 1 1  9 G H1   H -25.188   7.605 38.695 . . . 1.0 . . . . . . . . . . . . A .  9 G H1   . . . . . . . . . rr_2l5z 1 
       .  9 .  7014 . 1 1  9 G H1'  H -24.107   2.068 40.848 . . . 1.0 . . . . . . . . . . . . A .  9 G H1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7015 . 1 1  9 G H2'  H -25.754   1.033 38.666 . . . 1.0 . . . . . . . . . . . . A .  9 G H2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7016 . 1 1  9 G H21  H -25.752   7.647 40.845 . . . 1.0 . . . . . . . . . . . . A .  9 G H21  . . . . . . . . . rr_2l5z 1 
       .  9 .  7017 . 1 1  9 G H22  H -25.671   6.243 41.885 . . . 1.0 . . . . . . . . . . . . A .  9 G H22  . . . . . . . . . rr_2l5z 1 
       .  9 .  7018 . 1 1  9 G H3'  H -24.622  -1.004 38.421 . . . 1.0 . . . . . . . . . . . . A .  9 G H3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7019 . 1 1  9 G H4'  H -23.311  -0.621 41.144 . . . 1.0 . . . . . . . . . . . . A .  9 G H4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7020 . 1 1  9 G H5'  H -22.706  -2.515 39.518 . . . 1.0 . . . . . . . . . . . . A .  9 G H5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7021 . 1 1  9 G H5'' H -22.033  -1.257 38.460 . . . 1.0 . . . . . . . . . . . . A .  9 G H5'' . . . . . . . . . rr_2l5z 1 
       .  9 .  7022 . 1 1  9 G H8   H -23.273   1.685 37.175 . . . 1.0 . . . . . . . . . . . . A .  9 G H8   . . . . . . . . . rr_2l5z 1 
       .  9 .  7023 . 1 1  9 G HO2' H -26.112   1.681 41.071 . . . 1.0 . . . . . . . . . . . . A .  9 G HO2' . . . . . . . . . rr_2l5z 1 
       .  9 .  7024 . 1 1  9 G N1   N -24.938   6.596 38.753 . . . 1.0 . . . . . . . . . . . . A .  9 G N1   . . . . . . . . . rr_2l5z 1 
       .  9 .  7025 . 1 1  9 G N2   N -25.543   6.668 40.978 . . . 1.0 . . . . . . . . . . . . A .  9 G N2   . . . . . . . . . rr_2l5z 1 
       .  9 .  7026 . 1 1  9 G N3   N -24.821   4.641 40.135 . . . 1.0 . . . . . . . . . . . . A .  9 G N3   . . . . . . . . . rr_2l5z 1 
       .  9 .  7027 . 1 1  9 G N7   N -23.688   3.690 36.844 . . . 1.0 . . . . . . . . . . . . A .  9 G N7   . . . . . . . . . rr_2l5z 1 
       .  9 .  7028 . 1 1  9 G N9   N -24.002   2.746 38.860 . . . 1.0 . . . . . . . . . . . . A .  9 G N9   . . . . . . . . . rr_2l5z 1 
       .  9 .  7029 . 1 1  9 G O2'  O -26.173   0.799 40.695 . . . 1.0 . . . . . . . . . . . . A .  9 G O2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7030 . 1 1  9 G O3'  O -25.403  -1.553 40.296 . . . 1.0 . . . . . . . . . . . . A .  9 G O3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7031 . 1 1  9 G O4'  O -22.880   0.823 39.752 . . . 1.0 . . . . . . . . . . . . A .  9 G O4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7032 . 1 1  9 G O5'  O -21.042  -1.538 40.247 . . . 1.0 . . . . . . . . . . . . A .  9 G O5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7033 . 1 1  9 G O6   O -24.364   6.690 36.556 . . . 1.0 . . . . . . . . . . . . A .  9 G O6   . . . . . . . . . rr_2l5z 1 
       .  9 .  7034 . 1 1  9 G OP1  O -21.527  -3.426 41.820 . . . 1.0 . . . . . . . . . . . . A .  9 G OP1  . . . . . . . . . rr_2l5z 1 
       .  9 .  7035 . 1 1  9 G OP2  O -19.719  -1.696 42.369 . . . 1.0 . . . . . . . . . . . . A .  9 G OP2  . . . . . . . . . rr_2l5z 1 
       .  9 .  7036 . 1 1  9 G P    P -21.035  -2.032 41.781 . . . 1.0 . . . . . . . . . . . . A .  9 G P    . . . . . . . . . rr_2l5z 1 
       .  9 .  7037 . 1 1 10 C C1'  C -29.340   2.302 41.031 . . . 1.0 . . . . . . . . . . . . A . 10 C C1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7038 . 1 1 10 C C2   C -30.102   3.267 38.905 . . . 1.0 . . . . . . . . . . . . A . 10 C C2   . . . . . . . . . rr_2l5z 1 
       .  9 .  7039 . 1 1 10 C C2'  C -30.639   1.696 41.549 . . . 1.0 . . . . . . . . . . . . A . 10 C C2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7040 . 1 1 10 C C3'  C -30.260   0.238 41.724 . . . 1.0 . . . . . . . . . . . . A . 10 C C3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7041 . 1 1 10 C C4   C -29.345   2.435 36.844 . . . 1.0 . . . . . . . . . . . . A . 10 C C4   . . . . . . . . . rr_2l5z 1 
       .  9 .  7042 . 1 1 10 C C4'  C -28.809   0.327 42.191 . . . 1.0 . . . . . . . . . . . . A . 10 C C4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7043 . 1 1 10 C C5   C -28.539   1.452 37.503 . . . 1.0 . . . . . . . . . . . . A . 10 C C5   . . . . . . . . . rr_2l5z 1 
       .  9 .  7044 . 1 1 10 C C5'  C -28.008  -0.927 41.830 . . . 1.0 . . . . . . . . . . . . A . 10 C C5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7045 . 1 1 10 C C6   C -28.557   1.428 38.851 . . . 1.0 . . . . . . . . . . . . A . 10 C C6   . . . . . . . . . rr_2l5z 1 
       .  9 .  7046 . 1 1 10 C H1'  H -29.230   3.321 41.406 . . . 1.0 . . . . . . . . . . . . A . 10 C H1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7047 . 1 1 10 C H2'  H -31.426   1.792 40.796 . . . 1.0 . . . . . . . . . . . . A . 10 C H2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7048 . 1 1 10 C H3'  H -30.369  -0.323 40.792 . . . 1.0 . . . . . . . . . . . . A . 10 C H3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7049 . 1 1 10 C H4'  H -28.784   0.473 43.269 . . . 1.0 . . . . . . . . . . . . A . 10 C H4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7050 . 1 1 10 C H41  H -29.919   3.191 35.044 . . . 1.0 . . . . . . . . . . . . A . 10 C H41  . . . . . . . . . rr_2l5z 1 
       .  9 .  7051 . 1 1 10 C H42  H -28.789   1.857 34.973 . . . 1.0 . . . . . . . . . . . . A . 10 C H42  . . . . . . . . . rr_2l5z 1 
       .  9 .  7052 . 1 1 10 C H5   H -27.938   0.754 36.940 . . . 1.0 . . . . . . . . . . . . A . 10 C H5   . . . . . . . . . rr_2l5z 1 
       .  9 .  7053 . 1 1 10 C H5'  H -27.014  -0.853 42.273 . . . 1.0 . . . . . . . . . . . . A . 10 C H5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7054 . 1 1 10 C H5'' H -28.515  -1.801 42.236 . . . 1.0 . . . . . . . . . . . . A . 10 C H5'' . . . . . . . . . rr_2l5z 1 
       .  9 .  7055 . 1 1 10 C H6   H -27.965   0.696 39.381 . . . 1.0 . . . . . . . . . . . . A . 10 C H6   . . . . . . . . . rr_2l5z 1 
       .  9 .  7056 . 1 1 10 C HO2' H -31.851   2.775 42.626 . . . 1.0 . . . . . . . . . . . . A . 10 C HO2' . . . . . . . . . rr_2l5z 1 
       .  9 .  7057 . 1 1 10 C N1   N -29.320   2.317 39.551 . . . 1.0 . . . . . . . . . . . . A . 10 C N1   . . . . . . . . . rr_2l5z 1 
       .  9 .  7058 . 1 1 10 C N3   N -30.090   3.297 37.545 . . . 1.0 . . . . . . . . . . . . A . 10 C N3   . . . . . . . . . rr_2l5z 1 
       .  9 .  7059 . 1 1 10 C N4   N -29.352   2.499 35.513 . . . 1.0 . . . . . . . . . . . . A . 10 C N4   . . . . . . . . . rr_2l5z 1 
       .  9 .  7060 . 1 1 10 C O2   O -30.784   4.054 39.559 . . . 1.0 . . . . . . . . . . . . A . 10 C O2   . . . . . . . . . rr_2l5z 1 
       .  9 .  7061 . 1 1 10 C O2'  O -31.039   2.289 42.790 . . . 1.0 . . . . . . . . . . . . A . 10 C O2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7062 . 1 1 10 C O3'  O -31.047  -0.311 42.784 . . . 1.0 . . . . . . . . . . . . A . 10 C O3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7063 . 1 1 10 C O4'  O -28.273   1.488 41.549 . . . 1.0 . . . . . . . . . . . . A . 10 C O4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7064 . 1 1 10 C O5'  O -27.874  -1.082 40.414 . . . 1.0 . . . . . . . . . . . . A . 10 C O5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7065 . 1 1 10 C OP1  O -27.038  -3.442 40.462 . . . 1.0 . . . . . . . . . . . . A . 10 C OP1  . . . . . . . . . rr_2l5z 1 
       .  9 .  7066 . 1 1 10 C OP2  O -26.872  -2.038 38.326 . . . 1.0 . . . . . . . . . . . . A . 10 C OP2  . . . . . . . . . rr_2l5z 1 
       .  9 .  7067 . 1 1 10 C P    P -26.821  -2.136 39.802 . . . 1.0 . . . . . . . . . . . . A . 10 C P    . . . . . . . . . rr_2l5z 1 
       .  9 .  7068 . 1 1 11 A C1'  C -35.758   2.413 40.307 . . . 1.0 . . . . . . . . . . . . A . 11 A C1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7069 . 1 1 11 A C2   C -35.558   4.067 36.204 . . . 1.0 . . . . . . . . . . . . A . 11 A C2   . . . . . . . . . rr_2l5z 1 
       .  9 .  7070 . 1 1 11 A C2'  C -36.843   1.355 40.487 . . . 1.0 . . . . . . . . . . . . A . 11 A C2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7071 . 1 1 11 A C3'  C -36.197   0.388 41.461 . . . 1.0 . . . . . . . . . . . . A . 11 A C3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7072 . 1 1 11 A C4   C -34.984   2.729 37.866 . . . 1.0 . . . . . . . . . . . . A . 11 A C4   . . . . . . . . . rr_2l5z 1 
       .  9 .  7073 . 1 1 11 A C4'  C -35.369   1.313 42.346 . . . 1.0 . . . . . . . . . . . . A . 11 A C4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7074 . 1 1 11 A C5   C -34.029   2.082 37.116 . . . 1.0 . . . . . . . . . . . . A . 11 A C5   . . . . . . . . . rr_2l5z 1 
       .  9 .  7075 . 1 1 11 A C5'  C -34.174   0.590 42.974 . . . 1.0 . . . . . . . . . . . . A . 11 A C5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7076 . 1 1 11 A C6   C -33.874   2.513 35.794 . . . 1.0 . . . . . . . . . . . . A . 11 A C6   . . . . . . . . . rr_2l5z 1 
       .  9 .  7077 . 1 1 11 A C8   C -33.992   1.197 39.011 . . . 1.0 . . . . . . . . . . . . A . 11 A C8   . . . . . . . . . rr_2l5z 1 
       .  9 .  7078 . 1 1 11 A H1'  H -36.220   3.395 40.215 . . . 1.0 . . . . . . . . . . . . A . 11 A H1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7079 . 1 1 11 A H2   H -36.155   4.886 35.801 . . . 1.0 . . . . . . . . . . . . A . 11 A H2   . . . . . . . . . rr_2l5z 1 
       .  9 .  7080 . 1 1 11 A H2'  H -37.040   0.855 39.536 . . . 1.0 . . . . . . . . . . . . A . 11 A H2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7081 . 1 1 11 A H3'  H -35.588  -0.359 40.944 . . . 1.0 . . . . . . . . . . . . A . 11 A H3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7082 . 1 1 11 A H4'  H -35.999   1.720 43.135 . . . 1.0 . . . . . . . . . . . . A . 11 A H4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7083 . 1 1 11 A H5'  H -33.519   1.325 43.440 . . . 1.0 . . . . . . . . . . . . A . 11 A H5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7084 . 1 1 11 A H5'' H -34.536  -0.098 43.738 . . . 1.0 . . . . . . . . . . . . A . 11 A H5'' . . . . . . . . . rr_2l5z 1 
       .  9 .  7085 . 1 1 11 A H61  H -32.914   2.328 34.010 . . . 1.0 . . . . . . . . . . . . A . 11 A H61  . . . . . . . . . rr_2l5z 1 
       .  9 .  7086 . 1 1 11 A H62  H -32.388   1.227 35.265 . . . 1.0 . . . . . . . . . . . . A . 11 A H62  . . . . . . . . . rr_2l5z 1 
       .  9 .  7087 . 1 1 11 A H8   H -33.730   0.573 39.853 . . . 1.0 . . . . . . . . . . . . A . 11 A H8   . . . . . . . . . rr_2l5z 1 
       .  9 .  7088 . 1 1 11 A HO2' H -37.826   2.803 41.340 . . . 1.0 . . . . . . . . . . . . A . 11 A HO2' . . . . . . . . . rr_2l5z 1 
       .  9 .  7089 . 1 1 11 A N1   N -34.666   3.519 35.374 . . . 1.0 . . . . . . . . . . . . A . 11 A N1   . . . . . . . . . rr_2l5z 1 
       .  9 .  7090 . 1 1 11 A N3   N -35.789   3.735 37.471 . . . 1.0 . . . . . . . . . . . . A . 11 A N3   . . . . . . . . . rr_2l5z 1 
       .  9 .  7091 . 1 1 11 A N6   N -32.988   1.980 34.955 . . . 1.0 . . . . . . . . . . . . A . 11 A N6   . . . . . . . . . rr_2l5z 1 
       .  9 .  7092 . 1 1 11 A N7   N -33.389   1.085 37.873 . . . 1.0 . . . . . . . . . . . . A . 11 A N7   . . . . . . . . . rr_2l5z 1 
       .  9 .  7093 . 1 1 11 A N9   N -34.949   2.138 39.103 . . . 1.0 . . . . . . . . . . . . A . 11 A N9   . . . . . . . . . rr_2l5z 1 
       .  9 .  7094 . 1 1 11 A O2'  O -38.042   1.921 41.027 . . . 1.0 . . . . . . . . . . . . A . 11 A O2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7095 . 1 1 11 A O3'  O -37.225  -0.208 42.259 . . . 1.0 . . . . . . . . . . . . A . 11 A O3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7096 . 1 1 11 A O4'  O -34.942   2.379 41.492 . . . 1.0 . . . . . . . . . . . . A . 11 A O4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7097 . 1 1 11 A O5'  O -33.431  -0.146 41.999 . . . 1.0 . . . . . . . . . . . . A . 11 A O5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7098 . 1 1 11 A OP1  O -32.790  -1.849 43.720 . . . 1.0 . . . . . . . . . . . . A . 11 A OP1  . . . . . . . . . rr_2l5z 1 
       .  9 .  7099 . 1 1 11 A OP2  O -32.005  -2.081 41.292 . . . 1.0 . . . . . . . . . . . . A . 11 A OP2  . . . . . . . . . rr_2l5z 1 
       .  9 .  7100 . 1 1 11 A P    P -32.331  -1.228 42.458 . . . 1.0 . . . . . . . . . . . . A . 11 A P    . . . . . . . . . rr_2l5z 1 
       .  9 .  7101 . 1 1 12 C C1'  C -39.450   0.119 37.119 . . . 1.0 . . . . . . . . . . . . A . 12 C C1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7102 . 1 1 12 C C2   C -38.059   0.107 35.069 . . . 1.0 . . . . . . . . . . . . A . 12 C C2   . . . . . . . . . rr_2l5z 1 
       .  9 .  7103 . 1 1 12 C C2'  C -40.499  -0.976 36.871 . . . 1.0 . . . . . . . . . . . . A . 12 C C2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7104 . 1 1 12 C C3'  C -40.703  -1.597 38.252 . . . 1.0 . . . . . . . . . . . . A . 12 C C3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7105 . 1 1 12 C C4   C -35.870  -0.747 35.096 . . . 1.0 . . . . . . . . . . . . A . 12 C C4   . . . . . . . . . rr_2l5z 1 
       .  9 .  7106 . 1 1 12 C C4'  C -40.319  -0.468 39.194 . . . 1.0 . . . . . . . . . . . . A . 12 C C4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7107 . 1 1 12 C C5   C -35.980  -1.069 36.486 . . . 1.0 . . . . . . . . . . . . A . 12 C C5   . . . . . . . . . rr_2l5z 1 
       .  9 .  7108 . 1 1 12 C C5'  C -39.896  -0.978 40.574 . . . 1.0 . . . . . . . . . . . . A . 12 C C5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7109 . 1 1 12 C C6   C -37.141  -0.783 37.107 . . . 1.0 . . . . . . . . . . . . A . 12 C C6   . . . . . . . . . rr_2l5z 1 
       .  9 .  7110 . 1 1 12 C H1'  H -39.836   1.080 36.768 . . . 1.0 . . . . . . . . . . . . A . 12 C H1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7111 . 1 1 12 C H2'  H -40.100  -1.723 36.179 . . . 1.0 . . . . . . . . . . . . A . 12 C H2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7112 . 1 1 12 C H3'  H -40.085  -2.485 38.399 . . . 1.0 . . . . . . . . . . . . A . 12 C H3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7113 . 1 1 12 C H4'  H -41.155   0.220 39.298 . . . 1.0 . . . . . . . . . . . . A . 12 C H4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7114 . 1 1 12 C H41  H -34.653  -0.781 33.466 . . . 1.0 . . . . . . . . . . . . A . 12 C H41  . . . . . . . . . rr_2l5z 1 
       .  9 .  7115 . 1 1 12 C H42  H -33.961  -1.430 34.935 . . . 1.0 . . . . . . . . . . . . A . 12 C H42  . . . . . . . . . rr_2l5z 1 
       .  9 .  7116 . 1 1 12 C H5   H -35.159  -1.525 37.018 . . . 1.0 . . . . . . . . . . . . A . 12 C H5   . . . . . . . . . rr_2l5z 1 
       .  9 .  7117 . 1 1 12 C H5'  H -39.949  -0.155 41.286 . . . 1.0 . . . . . . . . . . . . A . 12 C H5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7118 . 1 1 12 C H5'' H -40.577  -1.768 40.895 . . . 1.0 . . . . . . . . . . . . A . 12 C H5'' . . . . . . . . . rr_2l5z 1 
       .  9 .  7119 . 1 1 12 C H6   H -37.262  -1.029 38.153 . . . 1.0 . . . . . . . . . . . . A . 12 C H6   . . . . . . . . . rr_2l5z 1 
       .  9 .  7120 . 1 1 12 C HO2' H -41.971  -0.938 35.599 . . . 1.0 . . . . . . . . . . . . A . 12 C HO2' . . . . . . . . . rr_2l5z 1 
       .  9 .  7121 . 1 1 12 C N1   N -38.173  -0.203 36.425 . . . 1.0 . . . . . . . . . . . . A . 12 C N1   . . . . . . . . . rr_2l5z 1 
       .  9 .  7122 . 1 1 12 C N3   N -36.889  -0.180 34.437 . . . 1.0 . . . . . . . . . . . . A . 12 C N3   . . . . . . . . . rr_2l5z 1 
       .  9 .  7123 . 1 1 12 C N4   N -34.736  -1.007 34.447 . . . 1.0 . . . . . . . . . . . . A . 12 C N4   . . . . . . . . . rr_2l5z 1 
       .  9 .  7124 . 1 1 12 C O2   O -39.000   0.630 34.474 . . . 1.0 . . . . . . . . . . . . A . 12 C O2   . . . . . . . . . rr_2l5z 1 
       .  9 .  7125 . 1 1 12 C O2'  O -41.719  -0.421 36.367 . . . 1.0 . . . . . . . . . . . . A . 12 C O2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7126 . 1 1 12 C O3'  O -42.095  -1.872 38.423 . . . 1.0 . . . . . . . . . . . . A . 12 C O3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7127 . 1 1 12 C O4'  O -39.250   0.195 38.538 . . . 1.0 . . . . . . . . . . . . A . 12 C O4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7128 . 1 1 12 C O5'  O -38.561  -1.490 40.559 . . . 1.0 . . . . . . . . . . . . A . 12 C O5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7129 . 1 1 12 C OP1  O -38.717  -2.086 42.986 . . . 1.0 . . . . . . . . . . . . A . 12 C OP1  . . . . . . . . . rr_2l5z 1 
       .  9 .  7130 . 1 1 12 C OP2  O -36.576  -2.553 41.656 . . . 1.0 . . . . . . . . . . . . A . 12 C OP2  . . . . . . . . . rr_2l5z 1 
       .  9 .  7131 . 1 1 12 C P    P -37.750  -1.697 41.935 . . . 1.0 . . . . . . . . . . . . A . 12 C P    . . . . . . . . . rr_2l5z 1 
       .  9 .  7132 . 1 1 13 G C1'  C -39.737  -3.426 33.180 . . . 1.0 . . . . . . . . . . . . A . 13 G C1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7133 . 1 1 13 G C2   C -36.127  -2.998 30.651 . . . 1.0 . . . . . . . . . . . . A . 13 G C2   . . . . . . . . . rr_2l5z 1 
       .  9 .  7134 . 1 1 13 G C2'  C -40.146  -4.802 32.645 . . . 1.0 . . . . . . . . . . . . A . 13 G C2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7135 . 1 1 13 G C3'  C -40.867  -5.435 33.826 . . . 1.0 . . . . . . . . . . . . A . 13 G C3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7136 . 1 1 13 G C4   C -37.241  -3.245 32.569 . . . 1.0 . . . . . . . . . . . . A . 13 G C4   . . . . . . . . . rr_2l5z 1 
       .  9 .  7137 . 1 1 13 G C4'  C -41.455  -4.231 34.548 . . . 1.0 . . . . . . . . . . . . A . 13 G C4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7138 . 1 1 13 G C5   C -36.095  -3.285 33.349 . . . 1.0 . . . . . . . . . . . . A . 13 G C5   . . . . . . . . . rr_2l5z 1 
       .  9 .  7139 . 1 1 13 G C5'  C -41.718  -4.518 36.028 . . . 1.0 . . . . . . . . . . . . A . 13 G C5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7140 . 1 1 13 G C6   C -34.821  -3.171 32.730 . . . 1.0 . . . . . . . . . . . . A . 13 G C6   . . . . . . . . . rr_2l5z 1 
       .  9 .  7141 . 1 1 13 G C8   C -37.718  -3.485 34.658 . . . 1.0 . . . . . . . . . . . . A . 13 G C8   . . . . . . . . . rr_2l5z 1 
       .  9 .  7142 . 1 1 13 G H1   H -34.044  -2.939 30.827 . . . 1.0 . . . . . . . . . . . . A . 13 G H1   . . . . . . . . . rr_2l5z 1 
       .  9 .  7143 . 1 1 13 G H1'  H -39.996  -2.664 32.445 . . . 1.0 . . . . . . . . . . . . A . 13 G H1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7144 . 1 1 13 G H2'  H -39.255  -5.384 32.394 . . . 1.0 . . . . . . . . . . . . A . 13 G H2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7145 . 1 1 13 G H21  H -35.121  -2.773 28.897 . . . 1.0 . . . . . . . . . . . . A . 13 G H21  . . . . . . . . . rr_2l5z 1 
       .  9 .  7146 . 1 1 13 G H22  H -36.864  -2.824 28.762 . . . 1.0 . . . . . . . . . . . . A . 13 G H22  . . . . . . . . . rr_2l5z 1 
       .  9 .  7147 . 1 1 13 G H3'  H -40.185  -6.007 34.459 . . . 1.0 . . . . . . . . . . . . A . 13 G H3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7148 . 1 1 13 G H4'  H -42.384  -3.934 34.063 . . . 1.0 . . . . . . . . . . . . A . 13 G H4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7149 . 1 1 13 G H5'  H -42.186  -5.499 36.126 . . . 1.0 . . . . . . . . . . . . A . 13 G H5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7150 . 1 1 13 G H5'' H -40.770  -4.521 36.564 . . . 1.0 . . . . . . . . . . . . A . 13 G H5'' . . . . . . . . . rr_2l5z 1 
       .  9 .  7151 . 1 1 13 G H8   H -38.312  -3.603 35.553 . . . 1.0 . . . . . . . . . . . . A . 13 G H8   . . . . . . . . . rr_2l5z 1 
       .  9 .  7152 . 1 1 13 G HO2' H -41.763  -5.260 31.663 . . . 1.0 . . . . . . . . . . . . A . 13 G HO2' . . . . . . . . . rr_2l5z 1 
       .  9 .  7153 . 1 1 13 G N1   N -34.937  -3.028 31.352 . . . 1.0 . . . . . . . . . . . . A . 13 G N1   . . . . . . . . . rr_2l5z 1 
       .  9 .  7154 . 1 1 13 G N2   N -36.030  -2.853 29.330 . . . 1.0 . . . . . . . . . . . . A . 13 G N2   . . . . . . . . . rr_2l5z 1 
       .  9 .  7155 . 1 1 13 G N3   N -37.330  -3.105 31.227 . . . 1.0 . . . . . . . . . . . . A . 13 G N3   . . . . . . . . . rr_2l5z 1 
       .  9 .  7156 . 1 1 13 G N7   N -36.427  -3.441 34.707 . . . 1.0 . . . . . . . . . . . . A . 13 G N7   . . . . . . . . . rr_2l5z 1 
       .  9 .  7157 . 1 1 13 G N9   N -38.288  -3.378 33.445 . . . 1.0 . . . . . . . . . . . . A . 13 G N9   . . . . . . . . . rr_2l5z 1 
       .  9 .  7158 . 1 1 13 G O2'  O -41.010  -4.684 31.509 . . . 1.0 . . . . . . . . . . . . A . 13 G O2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7159 . 1 1 13 G O3'  O -41.942  -6.233 33.323 . . . 1.0 . . . . . . . . . . . . A . 13 G O3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7160 . 1 1 13 G O4'  O -40.489  -3.196 34.383 . . . 1.0 . . . . . . . . . . . . A . 13 G O4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7161 . 1 1 13 G O5'  O -42.578  -3.533 36.605 . . . 1.0 . . . . . . . . . . . . A . 13 G O5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7162 . 1 1 13 G O6   O -33.712  -3.187 33.258 . . . 1.0 . . . . . . . . . . . . A . 13 G O6   . . . . . . . . . rr_2l5z 1 
       .  9 .  7163 . 1 1 13 G OP1  O -44.095  -3.371 38.592 . . . 1.0 . . . . . . . . . . . . A . 13 G OP1  . . . . . . . . . rr_2l5z 1 
       .  9 .  7164 . 1 1 13 G OP2  O -41.724  -4.316 38.826 . . . 1.0 . . . . . . . . . . . . A . 13 G OP2  . . . . . . . . . rr_2l5z 1 
       .  9 .  7165 . 1 1 13 G P    P -42.667  -3.361 38.202 . . . 1.0 . . . . . . . . . . . . A . 13 G P    . . . . . . . . . rr_2l5z 1 
       .  9 .  7166 . 1 1 14 A C1'  C -41.966  -8.919 28.055 . . . 1.0 . . . . . . . . . . . . A . 14 A C1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7167 . 1 1 14 A C2   C -43.608  -6.061 25.104 . . . 1.0 . . . . . . . . . . . . A . 14 A C2   . . . . . . . . . rr_2l5z 1 
       .  9 .  7168 . 1 1 14 A C2'  C -40.565  -8.363 27.806 . . . 1.0 . . . . . . . . . . . . A . 14 A C2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7169 . 1 1 14 A C3'  C -39.969  -8.318 29.202 . . . 1.0 . . . . . . . . . . . . A . 14 A C3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7170 . 1 1 14 A C4   C -43.394  -7.000 27.092 . . . 1.0 . . . . . . . . . . . . A . 14 A C4   . . . . . . . . . rr_2l5z 1 
       .  9 .  7171 . 1 1 14 A C4'  C -40.622  -9.515 29.887 . . . 1.0 . . . . . . . . . . . . A . 14 A C4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7172 . 1 1 14 A C5   C -44.329  -6.172 27.671 . . . 1.0 . . . . . . . . . . . . A . 14 A C5   . . . . . . . . . rr_2l5z 1 
       .  9 .  7173 . 1 1 14 A C5'  C -40.700  -9.336 31.404 . . . 1.0 . . . . . . . . . . . . A . 14 A C5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7174 . 1 1 14 A C6   C -44.921  -5.221 26.833 . . . 1.0 . . . . . . . . . . . . A . 14 A C6   . . . . . . . . . rr_2l5z 1 
       .  9 .  7175 . 1 1 14 A C8   C -43.656  -7.451 29.183 . . . 1.0 . . . . . . . . . . . . A . 14 A C8   . . . . . . . . . rr_2l5z 1 
       .  9 .  7176 . 1 1 14 A H1'  H -42.224  -9.617 27.257 . . . 1.0 . . . . . . . . . . . . A . 14 A H1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7177 . 1 1 14 A H2   H -43.337  -5.984 24.052 . . . 1.0 . . . . . . . . . . . . A . 14 A H2   . . . . . . . . . rr_2l5z 1 
       .  9 .  7178 . 1 1 14 A H2'  H -40.630  -7.352 27.395 . . . 1.0 . . . . . . . . . . . . A . 14 A H2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7179 . 1 1 14 A H3'  H -40.188  -7.372 29.703 . . . 1.0 . . . . . . . . . . . . A . 14 A H3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7180 . 1 1 14 A H4'  H -40.056 -10.417 29.657 . . . 1.0 . . . . . . . . . . . . A . 14 A H4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7181 . 1 1 14 A H5'  H -41.262 -10.167 31.832 . . . 1.0 . . . . . . . . . . . . A . 14 A H5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7182 . 1 1 14 A H5'' H -39.690  -9.342 31.815 . . . 1.0 . . . . . . . . . . . . A . 14 A H5'' . . . . . . . . . rr_2l5z 1 
       .  9 .  7183 . 1 1 14 A H61  H -46.236  -3.684 26.605 . . . 1.0 . . . . . . . . . . . . A . 14 A H61  . . . . . . . . . rr_2l5z 1 
       .  9 .  7184 . 1 1 14 A H62  H -46.140  -4.359 28.216 . . . 1.0 . . . . . . . . . . . . A . 14 A H62  . . . . . . . . . rr_2l5z 1 
       .  9 .  7185 . 1 1 14 A H8   H -43.523  -7.939 30.138 . . . 1.0 . . . . . . . . . . . . A . 14 A H8   . . . . . . . . . rr_2l5z 1 
       .  9 .  7186 . 1 1 14 A HO2' H -39.991 -10.123 27.202 . . . 1.0 . . . . . . . . . . . . A . 14 A HO2' . . . . . . . . . rr_2l5z 1 
       .  9 .  7187 . 1 1 14 A N1   N -44.528  -5.200 25.546 . . . 1.0 . . . . . . . . . . . . A . 14 A N1   . . . . . . . . . rr_2l5z 1 
       .  9 .  7188 . 1 1 14 A N3   N -42.984  -7.001 25.809 . . . 1.0 . . . . . . . . . . . . A . 14 A N3   . . . . . . . . . rr_2l5z 1 
       .  9 .  7189 . 1 1 14 A N6   N -45.840  -4.351 27.253 . . . 1.0 . . . . . . . . . . . . A . 14 A N6   . . . . . . . . . rr_2l5z 1 
       .  9 .  7190 . 1 1 14 A N7   N -44.491  -6.475 29.033 . . . 1.0 . . . . . . . . . . . . A . 14 A N7   . . . . . . . . . rr_2l5z 1 
       .  9 .  7191 . 1 1 14 A N9   N -42.963  -7.832 28.093 . . . 1.0 . . . . . . . . . . . . A . 14 A N9   . . . . . . . . . rr_2l5z 1 
       .  9 .  7192 . 1 1 14 A O2'  O -39.808  -9.217 26.941 . . . 1.0 . . . . . . . . . . . . A . 14 A O2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7193 . 1 1 14 A O3'  O -38.564  -8.566 29.101 . . . 1.0 . . . . . . . . . . . . A . 14 A O3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7194 . 1 1 14 A O4'  O -41.925  -9.622 29.309 . . . 1.0 . . . . . . . . . . . . A . 14 A O4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7195 . 1 1 14 A O5'  O -41.341  -8.107 31.758 . . . 1.0 . . . . . . . . . . . . A . 14 A O5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7196 . 1 1 14 A OP1  O -43.165  -8.416 33.447 . . . 1.0 . . . . . . . . . . . . A . 14 A OP1  . . . . . . . . . rr_2l5z 1 
       .  9 .  7197 . 1 1 14 A OP2  O -40.716  -8.243 34.180 . . . 1.0 . . . . . . . . . . . . A . 14 A OP2  . . . . . . . . . rr_2l5z 1 
       .  9 .  7198 . 1 1 14 A P    P -41.814  -7.838 33.274 . . . 1.0 . . . . . . . . . . . . A . 14 A P    . . . . . . . . . rr_2l5z 1 
       .  9 .  7199 . 1 1 15 A C1'  C -40.423  -4.850 25.842 . . . 1.0 . . . . . . . . . . . . A . 15 A C1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7200 . 1 1 15 A C2   C -43.110  -1.347 26.119 . . . 1.0 . . . . . . . . . . . . A . 15 A C2   . . . . . . . . . rr_2l5z 1 
       .  9 .  7201 . 1 1 15 A C2'  C -39.305  -3.977 25.259 . . . 1.0 . . . . . . . . . . . . A . 15 A C2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7202 . 1 1 15 A C3'  C -38.029  -4.693 25.691 . . . 1.0 . . . . . . . . . . . . A . 15 A C3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7203 . 1 1 15 A C4   C -41.947  -3.056 26.894 . . . 1.0 . . . . . . . . . . . . A . 15 A C4   . . . . . . . . . rr_2l5z 1 
       .  9 .  7204 . 1 1 15 A C4'  C -38.479  -6.140 25.841 . . . 1.0 . . . . . . . . . . . . A . 15 A C4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7205 . 1 1 15 A C5   C -42.344  -2.835 28.193 . . . 1.0 . . . . . . . . . . . . A . 15 A C5   . . . . . . . . . rr_2l5z 1 
       .  9 .  7206 . 1 1 15 A C5'  C -37.589  -6.923 26.809 . . . 1.0 . . . . . . . . . . . . A . 15 A C5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7207 . 1 1 15 A C6   C -43.206  -1.755 28.406 . . . 1.0 . . . . . . . . . . . . A . 15 A C6   . . . . . . . . . rr_2l5z 1 
       .  9 .  7208 . 1 1 15 A C8   C -41.079  -4.502 28.236 . . . 1.0 . . . . . . . . . . . . A . 15 A C8   . . . . . . . . . rr_2l5z 1 
       .  9 .  7209 . 1 1 15 A H1'  H -41.139  -5.087 25.056 . . . 1.0 . . . . . . . . . . . . A . 15 A H1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7210 . 1 1 15 A H2   H -43.430  -0.704 25.297 . . . 1.0 . . . . . . . . . . . . A . 15 A H2   . . . . . . . . . rr_2l5z 1 
       .  9 .  7211 . 1 1 15 A H2'  H -39.346  -2.977 25.702 . . . 1.0 . . . . . . . . . . . . A . 15 A H2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7212 . 1 1 15 A H3'  H -37.623  -4.280 26.620 . . . 1.0 . . . . . . . . . . . . A . 15 A H3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7213 . 1 1 15 A H4'  H -38.471  -6.626 24.866 . . . 1.0 . . . . . . . . . . . . A . 15 A H4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7214 . 1 1 15 A H5'  H -37.892  -7.969 26.803 . . . 1.0 . . . . . . . . . . . . A . 15 A H5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7215 . 1 1 15 A H5'' H -36.553  -6.851 26.477 . . . 1.0 . . . . . . . . . . . . A . 15 A H5'' . . . . . . . . . rr_2l5z 1 
       .  9 .  7216 . 1 1 15 A H61  H -44.295  -0.630 29.708 . . . 1.0 . . . . . . . . . . . . A . 15 A H61  . . . . . . . . . rr_2l5z 1 
       .  9 .  7217 . 1 1 15 A H62  H -43.408  -1.959 30.422 . . . 1.0 . . . . . . . . . . . . A . 15 A H62  . . . . . . . . . rr_2l5z 1 
       .  9 .  7218 . 1 1 15 A H8   H -40.473  -5.327 28.579 . . . 1.0 . . . . . . . . . . . . A . 15 A H8   . . . . . . . . . rr_2l5z 1 
       .  9 .  7219 . 1 1 15 A HO2' H -40.072  -4.527 23.557 . . . 1.0 . . . . . . . . . . . . A . 15 A HO2' . . . . . . . . . rr_2l5z 1 
       .  9 .  7220 . 1 1 15 A N1   N -43.567  -1.030 27.332 . . . 1.0 . . . . . . . . . . . . A . 15 A N1   . . . . . . . . . rr_2l5z 1 
       .  9 .  7221 . 1 1 15 A N3   N -42.295  -2.348 25.802 . . . 1.0 . . . . . . . . . . . . A . 15 A N3   . . . . . . . . . rr_2l5z 1 
       .  9 .  7222 . 1 1 15 A N6   N -43.674  -1.421 29.609 . . . 1.0 . . . . . . . . . . . . A . 15 A N6   . . . . . . . . . rr_2l5z 1 
       .  9 .  7223 . 1 1 15 A N7   N -41.772  -3.784 29.058 . . . 1.0 . . . . . . . . . . . . A . 15 A N7   . . . . . . . . . rr_2l5z 1 
       .  9 .  7224 . 1 1 15 A N9   N -41.122  -4.150 26.937 . . . 1.0 . . . . . . . . . . . . A . 15 A N9   . . . . . . . . . rr_2l5z 1 
       .  9 .  7225 . 1 1 15 A O2'  O -39.399  -3.901 23.833 . . . 1.0 . . . . . . . . . . . . A . 15 A O2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7226 . 1 1 15 A O3'  O -37.090  -4.623 24.614 . . . 1.0 . . . . . . . . . . . . A . 15 A O3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7227 . 1 1 15 A O4'  O -39.819  -6.064 26.313 . . . 1.0 . . . . . . . . . . . . A . 15 A O4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7228 . 1 1 15 A O5'  O -37.688  -6.414 28.142 . . . 1.0 . . . . . . . . . . . . A . 15 A O5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7229 . 1 1 15 A OP1  O -36.143  -7.973 29.349 . . . 1.0 . . . . . . . . . . . . A . 15 A OP1  . . . . . . . . . rr_2l5z 1 
       .  9 .  7230 . 1 1 15 A OP2  O -37.946  -6.672 30.620 . . . 1.0 . . . . . . . . . . . . A . 15 A OP2  . . . . . . . . . rr_2l5z 1 
       .  9 .  7231 . 1 1 15 A P    P -37.503  -7.394 29.407 . . . 1.0 . . . . . . . . . . . . A . 15 A P    . . . . . . . . . rr_2l5z 1 
       .  9 .  7232 . 1 1 16 A C1'  C -39.694  -0.351 25.150 . . . 1.0 . . . . . . . . . . . . A . 16 A C1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7233 . 1 1 16 A C2   C -41.098   0.429 29.269 . . . 1.0 . . . . . . . . . . . . A . 16 A C2   . . . . . . . . . rr_2l5z 1 
       .  9 .  7234 . 1 1 16 A C2'  C -39.171   0.918 24.484 . . . 1.0 . . . . . . . . . . . . A . 16 A C2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7235 . 1 1 16 A C3'  C -38.000   0.405 23.667 . . . 1.0 . . . . . . . . . . . . A . 16 A C3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7236 . 1 1 16 A C4   C -39.668  -0.237 27.724 . . . 1.0 . . . . . . . . . . . . A . 16 A C4   . . . . . . . . . rr_2l5z 1 
       .  9 .  7237 . 1 1 16 A C4'  C -38.446  -1.005 23.266 . . . 1.0 . . . . . . . . . . . . A . 16 A C4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7238 . 1 1 16 A C5   C -38.716  -0.600 28.650 . . . 1.0 . . . . . . . . . . . . A . 16 A C5   . . . . . . . . . rr_2l5z 1 
       .  9 .  7239 . 1 1 16 A C5'  C -37.263  -1.966 23.105 . . . 1.0 . . . . . . . . . . . . A . 16 A C5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7240 . 1 1 16 A C6   C -39.049  -0.404 29.995 . . . 1.0 . . . . . . . . . . . . A . 16 A C6   . . . . . . . . . rr_2l5z 1 
       .  9 .  7241 . 1 1 16 A C8   C -37.904  -1.020 26.768 . . . 1.0 . . . . . . . . . . . . A . 16 A C8   . . . . . . . . . rr_2l5z 1 
       .  9 .  7242 . 1 1 16 A H1'  H -40.779  -0.297 25.225 . . . 1.0 . . . . . . . . . . . . A . 16 A H1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7243 . 1 1 16 A H2   H -42.062   0.846 29.561 . . . 1.0 . . . . . . . . . . . . A . 16 A H2   . . . . . . . . . rr_2l5z 1 
       .  9 .  7244 . 1 1 16 A H2'  H -38.821   1.622 25.243 . . . 1.0 . . . . . . . . . . . . A . 16 A H2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7245 . 1 1 16 A H3'  H -37.072   0.413 24.248 . . . 1.0 . . . . . . . . . . . . A . 16 A H3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7246 . 1 1 16 A H4'  H -38.997  -0.954 22.328 . . . 1.0 . . . . . . . . . . . . A . 16 A H4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7247 . 1 1 16 A H5'  H -37.630  -2.923 22.735 . . . 1.0 . . . . . . . . . . . . A . 16 A H5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7248 . 1 1 16 A H5'' H -36.562  -1.550 22.381 . . . 1.0 . . . . . . . . . . . . A . 16 A H5'' . . . . . . . . . rr_2l5z 1 
       .  9 .  7249 . 1 1 16 A H61  H -38.521  -0.549 31.955 . . . 1.0 . . . . . . . . . . . . A . 16 A H61  . . . . . . . . . rr_2l5z 1 
       .  9 .  7250 . 1 1 16 A H62  H -37.322  -1.108 30.810 . . . 1.0 . . . . . . . . . . . . A . 16 A H62  . . . . . . . . . rr_2l5z 1 
       .  9 .  7251 . 1 1 16 A H8   H -37.237  -1.338 25.981 . . . 1.0 . . . . . . . . . . . . A . 16 A H8   . . . . . . . . . rr_2l5z 1 
       .  9 .  7252 . 1 1 16 A HO2' H -39.748   1.737 22.815 . . . 1.0 . . . . . . . . . . . . A . 16 A HO2' . . . . . . . . . rr_2l5z 1 
       .  9 .  7253 . 1 1 16 A N1   N -40.261   0.117 30.262 . . . 1.0 . . . . . . . . . . . . A . 16 A N1   . . . . . . . . . rr_2l5z 1 
       .  9 .  7254 . 1 1 16 A N3   N -40.886   0.286 27.965 . . . 1.0 . . . . . . . . . . . . A . 16 A N3   . . . . . . . . . rr_2l5z 1 
       .  9 .  7255 . 1 1 16 A N6   N -38.231  -0.711 31.001 . . . 1.0 . . . . . . . . . . . . A . 16 A N6   . . . . . . . . . rr_2l5z 1 
       .  9 .  7256 . 1 1 16 A N7   N -37.571  -1.109 28.015 . . . 1.0 . . . . . . . . . . . . A . 16 A N7   . . . . . . . . . rr_2l5z 1 
       .  9 .  7257 . 1 1 16 A N9   N -39.122  -0.518 26.499 . . . 1.0 . . . . . . . . . . . . A . 16 A N9   . . . . . . . . . rr_2l5z 1 
       .  9 .  7258 . 1 1 16 A O2'  O -40.168   1.520 23.650 . . . 1.0 . . . . . . . . . . . . A . 16 A O2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7259 . 1 1 16 A O3'  O -37.902   1.198 22.480 . . . 1.0 . . . . . . . . . . . . A . 16 A O3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7260 . 1 1 16 A O4'  O -39.330  -1.448 24.300 . . . 1.0 . . . . . . . . . . . . A . 16 A O4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7261 . 1 1 16 A O5'  O -36.584  -2.175 24.346 . . . 1.0 . . . . . . . . . . . . A . 16 A O5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7262 . 1 1 16 A OP1  O -34.947  -3.892 23.541 . . . 1.0 . . . . . . . . . . . . A . 16 A OP1  . . . . . . . . . rr_2l5z 1 
       .  9 .  7263 . 1 1 16 A OP2  O -35.348  -3.536 26.047 . . . 1.0 . . . . . . . . . . . . A . 16 A OP2  . . . . . . . . . rr_2l5z 1 
       .  9 .  7264 . 1 1 16 A P    P -35.864  -3.580 24.661 . . . 1.0 . . . . . . . . . . . . A . 16 A P    . . . . . . . . . rr_2l5z 1 
       .  9 .  7265 . 1 1 17 G C1'  C -37.246   2.958 26.999 . . . 1.0 . . . . . . . . . . . . A . 17 G C1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7266 . 1 1 17 G C2   C -37.938   2.026 31.269 . . . 1.0 . . . . . . . . . . . . A . 17 G C2   . . . . . . . . . rr_2l5z 1 
       .  9 .  7267 . 1 1 17 G C2'  C -36.943   4.450 26.892 . . . 1.0 . . . . . . . . . . . . A . 17 G C2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7268 . 1 1 17 G C3'  C -35.860   4.468 25.832 . . . 1.0 . . . . . . . . . . . . A . 17 G C3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7269 . 1 1 17 G C4   C -36.761   2.092 29.376 . . . 1.0 . . . . . . . . . . . . A . 17 G C4   . . . . . . . . . rr_2l5z 1 
       .  9 .  7270 . 1 1 17 G C4'  C -36.333   3.379 24.881 . . . 1.0 . . . . . . . . . . . . A . 17 G C4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7271 . 1 1 17 G C5   C -35.640   1.490 29.929 . . . 1.0 . . . . . . . . . . . . A . 17 G C5   . . . . . . . . . rr_2l5z 1 
       .  9 .  7272 . 1 1 17 G C5'  C -35.181   2.804 24.058 . . . 1.0 . . . . . . . . . . . . A . 17 G C5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7273 . 1 1 17 G C6   C -35.654   1.108 31.297 . . . 1.0 . . . . . . . . . . . . A . 17 G C6   . . . . . . . . . rr_2l5z 1 
       .  9 .  7274 . 1 1 17 G C8   C -35.184   1.875 27.921 . . . 1.0 . . . . . . . . . . . . A . 17 G C8   . . . . . . . . . rr_2l5z 1 
       .  9 .  7275 . 1 1 17 G H1   H -36.956   1.168 32.902 . . . 1.0 . . . . . . . . . . . . A . 17 G H1   . . . . . . . . . rr_2l5z 1 
       .  9 .  7276 . 1 1 17 G H1'  H -38.303   2.810 27.215 . . . 1.0 . . . . . . . . . . . . A . 17 G H1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7277 . 1 1 17 G H2'  H -36.549   4.823 27.841 . . . 1.0 . . . . . . . . . . . . A . 17 G H2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7278 . 1 1 17 G H21  H -39.023   1.969 32.990 . . . 1.0 . . . . . . . . . . . . A . 17 G H21  . . . . . . . . . rr_2l5z 1 
       .  9 .  7279 . 1 1 17 G H22  H -39.835   2.679 31.613 . . . 1.0 . . . . . . . . . . . . A . 17 G H22  . . . . . . . . . rr_2l5z 1 
       .  9 .  7280 . 1 1 17 G H3'  H -34.876   4.255 26.254 . . . 1.0 . . . . . . . . . . . . A . 17 G H3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7281 . 1 1 17 G H4'  H -37.090   3.789 24.216 . . . 1.0 . . . . . . . . . . . . A . 17 G H4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7282 . 1 1 17 G H5'  H -34.834   3.560 23.354 . . . 1.0 . . . . . . . . . . . . A . 17 G H5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7283 . 1 1 17 G H5'' H -34.364   2.539 24.726 . . . 1.0 . . . . . . . . . . . . A . 17 G H5'' . . . . . . . . . rr_2l5z 1 
       .  9 .  7284 . 1 1 17 G H8   H -34.666   1.936 26.976 . . . 1.0 . . . . . . . . . . . . A . 17 G H8   . . . . . . . . . rr_2l5z 1 
       .  9 .  7285 . 1 1 17 G HO2' H -37.990   5.392 25.549 . . . 1.0 . . . . . . . . . . . . A . 17 G HO2' . . . . . . . . . rr_2l5z 1 
       .  9 .  7286 . 1 1 17 G N1   N -36.867   1.422 31.899 . . . 1.0 . . . . . . . . . . . . A . 17 G N1   . . . . . . . . . rr_2l5z 1 
       .  9 .  7287 . 1 1 17 G N2   N -39.020   2.243 32.017 . . . 1.0 . . . . . . . . . . . . A . 17 G N2   . . . . . . . . . rr_2l5z 1 
       .  9 .  7288 . 1 1 17 G N3   N -37.933   2.388 29.981 . . . 1.0 . . . . . . . . . . . . A . 17 G N3   . . . . . . . . . rr_2l5z 1 
       .  9 .  7289 . 1 1 17 G N7   N -34.624   1.357 28.966 . . . 1.0 . . . . . . . . . . . . A . 17 G N7   . . . . . . . . . rr_2l5z 1 
       .  9 .  7290 . 1 1 17 G N9   N -36.439   2.334 28.066 . . . 1.0 . . . . . . . . . . . . A . 17 G N9   . . . . . . . . . rr_2l5z 1 
       .  9 .  7291 . 1 1 17 G O2'  O -38.096   5.193 26.482 . . . 1.0 . . . . . . . . . . . . A . 17 G O2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7292 . 1 1 17 G O3'  O -35.901   5.722 25.146 . . . 1.0 . . . . . . . . . . . . A . 17 G O3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7293 . 1 1 17 G O4'  O -36.932   2.386 25.717 . . . 1.0 . . . . . . . . . . . . A . 17 G O4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7294 . 1 1 17 G O5'  O -35.582   1.640 23.330 . . . 1.0 . . . . . . . . . . . . A . 17 G O5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7295 . 1 1 17 G O6   O -34.763   0.569 31.950 . . . 1.0 . . . . . . . . . . . . A . 17 G O6   . . . . . . . . . rr_2l5z 1 
       .  9 .  7296 . 1 1 17 G OP1  O -36.643   3.217 21.698 . . . 1.0 . . . . . . . . . . . . A . 17 G OP1  . . . . . . . . . rr_2l5z 1 
       .  9 .  7297 . 1 1 17 G OP2  O -35.929   0.864 20.975 . . . 1.0 . . . . . . . . . . . . A . 17 G OP2  . . . . . . . . . rr_2l5z 1 
       .  9 .  7298 . 1 1 17 G P    P -36.478   1.777 22.001 . . . 1.0 . . . . . . . . . . . . A . 17 G P    . . . . . . . . . rr_2l5z 1 
       .  9 .  7299 . 1 1 18 U C1'  C -36.359   7.162 30.487 . . . 1.0 . . . . . . . . . . . . A . 18 U C1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7300 . 1 1 18 U C2   C -35.652   5.593 32.270 . . . 1.0 . . . . . . . . . . . . A . 18 U C2   . . . . . . . . . rr_2l5z 1 
       .  9 .  7301 . 1 1 18 U C2'  C -35.615   8.472 30.789 . . . 1.0 . . . . . . . . . . . . A . 18 U C2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7302 . 1 1 18 U C3'  C -35.249   9.000 29.406 . . . 1.0 . . . . . . . . . . . . A . 18 U C3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7303 . 1 1 18 U C4   C -34.055   3.771 31.798 . . . 1.0 . . . . . . . . . . . . A . 18 U C4   . . . . . . . . . rr_2l5z 1 
       .  9 .  7304 . 1 1 18 U C4'  C -36.344   8.420 28.533 . . . 1.0 . . . . . . . . . . . . A . 18 U C4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7305 . 1 1 18 U C5   C -34.025   4.249 30.435 . . . 1.0 . . . . . . . . . . . . A . 18 U C5   . . . . . . . . . rr_2l5z 1 
       .  9 .  7306 . 1 1 18 U C5'  C -35.934   8.358 27.064 . . . 1.0 . . . . . . . . . . . . A . 18 U C5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7307 . 1 1 18 U C6   C -34.763   5.319 30.053 . . . 1.0 . . . . . . . . . . . . A . 18 U C6   . . . . . . . . . rr_2l5z 1 
       .  9 .  7308 . 1 1 18 U H1'  H -37.333   7.177 30.981 . . . 1.0 . . . . . . . . . . . . A . 18 U H1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7309 . 1 1 18 U H2'  H -34.707   8.259 31.361 . . . 1.0 . . . . . . . . . . . . A . 18 U H2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7310 . 1 1 18 U H3   H -34.943   4.192 33.624 . . . 1.0 . . . . . . . . . . . . A . 18 U H3   . . . . . . . . . rr_2l5z 1 
       .  9 .  7311 . 1 1 18 U H3'  H -34.255   8.672 29.094 . . . 1.0 . . . . . . . . . . . . A . 18 U H3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7312 . 1 1 18 U H4'  H -37.250   9.014 28.637 . . . 1.0 . . . . . . . . . . . . A . 18 U H4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7313 . 1 1 18 U H5   H -33.405   3.745 29.707 . . . 1.0 . . . . . . . . . . . . A . 18 U H5   . . . . . . . . . rr_2l5z 1 
       .  9 .  7314 . 1 1 18 U H5'  H -36.818   8.168 26.456 . . . 1.0 . . . . . . . . . . . . A . 18 U H5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7315 . 1 1 18 U H5'' H -35.501   9.315 26.775 . . . 1.0 . . . . . . . . . . . . A . 18 U H5'' . . . . . . . . . rr_2l5z 1 
       .  9 .  7316 . 1 1 18 U H6   H -34.708   5.661 29.032 . . . 1.0 . . . . . . . . . . . . A . 18 U H6   . . . . . . . . . rr_2l5z 1 
       .  9 .  7317 . 1 1 18 U HO2' H -37.268   8.937 31.707 . . . 1.0 . . . . . . . . . . . . A . 18 U HO2' . . . . . . . . . rr_2l5z 1 
       .  9 .  7318 . 1 1 18 U N1   N -35.564   5.987 30.937 . . . 1.0 . . . . . . . . . . . . A . 18 U N1   . . . . . . . . . rr_2l5z 1 
       .  9 .  7319 . 1 1 18 U N3   N -34.887   4.498 32.632 . . . 1.0 . . . . . . . . . . . . A . 18 U N3   . . . . . . . . . rr_2l5z 1 
       .  9 .  7320 . 1 1 18 U O2   O -36.364   6.182 33.079 . . . 1.0 . . . . . . . . . . . . A . 18 U O2   . . . . . . . . . rr_2l5z 1 
       .  9 .  7321 . 1 1 18 U O2'  O -36.452   9.396 31.494 . . . 1.0 . . . . . . . . . . . . A . 18 U O2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7322 . 1 1 18 U O3'  O -35.376  10.424 29.411 . . . 1.0 . . . . . . . . . . . . A . 18 U O3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7323 . 1 1 18 U O4   O -33.422   2.810 32.226 . . . 1.0 . . . . . . . . . . . . A . 18 U O4   . . . . . . . . . rr_2l5z 1 
       .  9 .  7324 . 1 1 18 U O4'  O -36.570   7.124 29.066 . . . 1.0 . . . . . . . . . . . . A . 18 U O4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7325 . 1 1 18 U O5'  O -34.977   7.325 26.831 . . . 1.0 . . . . . . . . . . . . A . 18 U O5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7326 . 1 1 18 U OP1  O -34.934   7.909 24.396 . . . 1.0 . . . . . . . . . . . . A . 18 U OP1  . . . . . . . . . rr_2l5z 1 
       .  9 .  7327 . 1 1 18 U OP2  O -33.425   6.058 25.328 . . . 1.0 . . . . . . . . . . . . A . 18 U OP2  . . . . . . . . . rr_2l5z 1 
       .  9 .  7328 . 1 1 18 U P    P -34.711   6.789 25.338 . . . 1.0 . . . . . . . . . . . . A . 18 U P    . . . . . . . . . rr_2l5z 1 
       .  9 .  7329 . 1 1 19 G C1'  C -34.221   9.691 34.835 . . . 1.0 . . . . . . . . . . . . A . 19 G C1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7330 . 1 1 19 G C2   C -32.254   6.561 37.261 . . . 1.0 . . . . . . . . . . . . A . 19 G C2   . . . . . . . . . rr_2l5z 1 
       .  9 .  7331 . 1 1 19 G C2'  C -33.577  10.998 35.313 . . . 1.0 . . . . . . . . . . . . A . 19 G C2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7332 . 1 1 19 G C3'  C -33.776  11.936 34.131 . . . 1.0 . . . . . . . . . . . . A . 19 G C3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7333 . 1 1 19 G C4   C -32.651   7.733 35.407 . . . 1.0 . . . . . . . . . . . . A . 19 G C4   . . . . . . . . . rr_2l5z 1 
       .  9 .  7334 . 1 1 19 G C4'  C -35.053  11.409 33.499 . . . 1.0 . . . . . . . . . . . . A . 19 G C4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7335 . 1 1 19 G C5   C -31.736   7.027 34.637 . . . 1.0 . . . . . . . . . . . . A . 19 G C5   . . . . . . . . . rr_2l5z 1 
       .  9 .  7336 . 1 1 19 G C5'  C -35.172  11.812 32.031 . . . 1.0 . . . . . . . . . . . . A . 19 G C5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7337 . 1 1 19 G C6   C -30.994   5.970 35.232 . . . 1.0 . . . . . . . . . . . . A . 19 G C6   . . . . . . . . . rr_2l5z 1 
       .  9 .  7338 . 1 1 19 G C8   C -32.589   8.468 33.380 . . . 1.0 . . . . . . . . . . . . A . 19 G C8   . . . . . . . . . rr_2l5z 1 
       .  9 .  7339 . 1 1 19 G H1   H -30.823   5.049 37.075 . . . 1.0 . . . . . . . . . . . . A . 19 G H1   . . . . . . . . . rr_2l5z 1 
       .  9 .  7340 . 1 1 19 G H1'  H -34.899   9.322 35.605 . . . 1.0 . . . . . . . . . . . . A . 19 G H1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7341 . 1 1 19 G H2'  H -32.509  10.843 35.492 . . . 1.0 . . . . . . . . . . . . A . 19 G H2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7342 . 1 1 19 G H21  H -31.901   5.499 38.961 . . . 1.0 . . . . . . . . . . . . A . 19 G H21  . . . . . . . . . rr_2l5z 1 
       .  9 .  7343 . 1 1 19 G H22  H -33.097   6.767 39.102 . . . 1.0 . . . . . . . . . . . . A . 19 G H22  . . . . . . . . . rr_2l5z 1 
       .  9 .  7344 . 1 1 19 G H3'  H -32.929  11.909 33.443 . . . 1.0 . . . . . . . . . . . . A . 19 G H3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7345 . 1 1 19 G H4'  H -35.914  11.780 34.051 . . . 1.0 . . . . . . . . . . . . A . 19 G H4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7346 . 1 1 19 G H5'  H -36.058  11.342 31.604 . . . 1.0 . . . . . . . . . . . . A . 19 G H5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7347 . 1 1 19 G H5'' H -35.279  12.896 31.967 . . . 1.0 . . . . . . . . . . . . A . 19 G H5'' . . . . . . . . . rr_2l5z 1 
       .  9 .  7348 . 1 1 19 G H8   H -32.830   9.069 32.515 . . . 1.0 . . . . . . . . . . . . A . 19 G H8   . . . . . . . . . rr_2l5z 1 
       .  9 .  7349 . 1 1 19 G HO2' H -35.154  11.595 36.285 . . . 1.0 . . . . . . . . . . . . A . 19 G HO2' . . . . . . . . . rr_2l5z 1 
       .  9 .  7350 . 1 1 19 G N1   N -31.325   5.807 36.571 . . . 1.0 . . . . . . . . . . . . A . 19 G N1   . . . . . . . . . rr_2l5z 1 
       .  9 .  7351 . 1 1 19 G N2   N -32.431   6.250 38.546 . . . 1.0 . . . . . . . . . . . . A . 19 G N2   . . . . . . . . . rr_2l5z 1 
       .  9 .  7352 . 1 1 19 G N3   N -32.957   7.556 36.710 . . . 1.0 . . . . . . . . . . . . A . 19 G N3   . . . . . . . . . rr_2l5z 1 
       .  9 .  7353 . 1 1 19 G N7   N -31.711   7.521 33.322 . . . 1.0 . . . . . . . . . . . . A . 19 G N7   . . . . . . . . . rr_2l5z 1 
       .  9 .  7354 . 1 1 19 G N9   N -33.194   8.667 34.565 . . . 1.0 . . . . . . . . . . . . A . 19 G N9   . . . . . . . . . rr_2l5z 1 
       .  9 .  7355 . 1 1 19 G O2'  O -34.222  11.498 36.490 . . . 1.0 . . . . . . . . . . . . A . 19 G O2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7356 . 1 1 19 G O3'  O -34.027  13.253 34.630 . . . 1.0 . . . . . . . . . . . . A . 19 G O3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7357 . 1 1 19 G O4'  O -34.974   9.996 33.651 . . . 1.0 . . . . . . . . . . . . A . 19 G O4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7358 . 1 1 19 G O5'  O -34.024  11.414 31.279 . . . 1.0 . . . . . . . . . . . . A . 19 G O5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7359 . 1 1 19 G O6   O -30.152   5.242 34.710 . . . 1.0 . . . . . . . . . . . . A . 19 G O6   . . . . . . . . . rr_2l5z 1 
       .  9 .  7360 . 1 1 19 G OP1  O -34.390  12.714 29.170 . . . 1.0 . . . . . . . . . . . . A . 19 G OP1  . . . . . . . . . rr_2l5z 1 
       .  9 .  7361 . 1 1 19 G OP2  O -32.890  10.636 29.185 . . . 1.0 . . . . . . . . . . . . A . 19 G OP2  . . . . . . . . . rr_2l5z 1 
       .  9 .  7362 . 1 1 19 G P    P -34.089  11.355 29.672 . . . 1.0 . . . . . . . . . . . . A . 19 G P    . . . . . . . . . rr_2l5z 1 
       .  9 .  7363 . 1 1 20 A C1'  C -30.805  11.497 38.624 . . . 1.0 . . . . . . . . . . . . A . 20 A C1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7364 . 1 1 20 A C2   C -27.733   8.354 39.058 . . . 1.0 . . . . . . . . . . . . A . 20 A C2   . . . . . . . . . rr_2l5z 1 
       .  9 .  7365 . 1 1 20 A C2'  C -30.173  12.782 39.178 . . . 1.0 . . . . . . . . . . . . A . 20 A C2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7366 . 1 1 20 A C3'  C -31.006  13.889 38.538 . . . 1.0 . . . . . . . . . . . . A . 20 A C3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7367 . 1 1 20 A C4   C -28.954   9.833 37.965 . . . 1.0 . . . . . . . . . . . . A . 20 A C4   . . . . . . . . . rr_2l5z 1 
       .  9 .  7368 . 1 1 20 A C4'  C -32.345  13.211 38.297 . . . 1.0 . . . . . . . . . . . . A . 20 A C4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7369 . 1 1 20 A C5   C -28.359   9.548 36.758 . . . 1.0 . . . . . . . . . . . . A . 20 A C5   . . . . . . . . . rr_2l5z 1 
       .  9 .  7370 . 1 1 20 A C5'  C -33.144  13.900 37.190 . . . 1.0 . . . . . . . . . . . . A . 20 A C5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7371 . 1 1 20 A C6   C -27.364   8.564 36.770 . . . 1.0 . . . . . . . . . . . . A . 20 A C6   . . . . . . . . . rr_2l5z 1 
       .  9 .  7372 . 1 1 20 A C8   C -29.777  11.041 36.384 . . . 1.0 . . . . . . . . . . . . A . 20 A C8   . . . . . . . . . rr_2l5z 1 
       .  9 .  7373 . 1 1 20 A H1'  H -31.049  10.831 39.450 . . . 1.0 . . . . . . . . . . . . A . 20 A H1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7374 . 1 1 20 A H2   H -27.454   7.843 39.977 . . . 1.0 . . . . . . . . . . . . A . 20 A H2   . . . . . . . . . rr_2l5z 1 
       .  9 .  7375 . 1 1 20 A H2'  H -29.131  12.857 38.851 . . . 1.0 . . . . . . . . . . . . A . 20 A H2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7376 . 1 1 20 A H3'  H -30.552  14.259 37.615 . . . 1.0 . . . . . . . . . . . . A . 20 A H3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7377 . 1 1 20 A H4'  H -32.925  13.209 39.218 . . . 1.0 . . . . . . . . . . . . A . 20 A H4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7378 . 1 1 20 A H5'  H -33.894  13.207 36.810 . . . 1.0 . . . . . . . . . . . . A . 20 A H5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7379 . 1 1 20 A H5'' H -33.644  14.775 37.605 . . . 1.0 . . . . . . . . . . . . A . 20 A H5'' . . . . . . . . . rr_2l5z 1 
       .  9 .  7380 . 1 1 20 A H61  H -25.991   7.468 35.742 . . . 1.0 . . . . . . . . . . . . A . 20 A H61  . . . . . . . . . rr_2l5z 1 
       .  9 .  7381 . 1 1 20 A H62  H -26.908   8.611 34.787 . . . 1.0 . . . . . . . . . . . . A . 20 A H62  . . . . . . . . . rr_2l5z 1 
       .  9 .  7382 . 1 1 20 A H8   H -30.392  11.779 35.891 . . . 1.0 . . . . . . . . . . . . A . 20 A H8   . . . . . . . . . rr_2l5z 1 
       .  9 .  7383 . 1 1 20 A HO2' H -29.499  13.321 40.923 . . . 1.0 . . . . . . . . . . . . A . 20 A HO2' . . . . . . . . . rr_2l5z 1 
       .  9 .  7384 . 1 1 20 A N1   N -27.079   7.987 37.952 . . . 1.0 . . . . . . . . . . . . A . 20 A N1   . . . . . . . . . rr_2l5z 1 
       .  9 .  7385 . 1 1 20 A N3   N -28.689   9.272 39.160 . . . 1.0 . . . . . . . . . . . . A . 20 A N3   . . . . . . . . . rr_2l5z 1 
       .  9 .  7386 . 1 1 20 A N6   N -26.701   8.184 35.678 . . . 1.0 . . . . . . . . . . . . A . 20 A N6   . . . . . . . . . rr_2l5z 1 
       .  9 .  7387 . 1 1 20 A N7   N -28.904  10.343 35.734 . . . 1.0 . . . . . . . . . . . . A . 20 A N7   . . . . . . . . . rr_2l5z 1 
       .  9 .  7388 . 1 1 20 A N9   N -29.878  10.810 37.705 . . . 1.0 . . . . . . . . . . . . A . 20 A N9   . . . . . . . . . rr_2l5z 1 
       .  9 .  7389 . 1 1 20 A O2'  O -30.260  12.827 40.607 . . . 1.0 . . . . . . . . . . . . A . 20 A O2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7390 . 1 1 20 A O3'  O -31.195  14.929 39.503 . . . 1.0 . . . . . . . . . . . . A . 20 A O3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7391 . 1 1 20 A O4'  O -32.015  11.873 37.949 . . . 1.0 . . . . . . . . . . . . A . 20 A O4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7392 . 1 1 20 A O5'  O -32.299  14.313 36.112 . . . 1.0 . . . . . . . . . . . . A . 20 A O5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7393 . 1 1 20 A OP1  O -33.501  15.691 34.399 . . . 1.0 . . . . . . . . . . . . A . 20 A OP1  . . . . . . . . . rr_2l5z 1 
       .  9 .  7394 . 1 1 20 A OP2  O -31.801  13.910 33.690 . . . 1.0 . . . . . . . . . . . . A . 20 A OP2  . . . . . . . . . rr_2l5z 1 
       .  9 .  7395 . 1 1 20 A P    P -32.869  14.370 34.607 . . . 1.0 . . . . . . . . . . . . A . 20 A P    . . . . . . . . . rr_2l5z 1 
       .  9 .  7396 . 1 1 21 C C1'  C -25.291  13.190 38.479 . . . 1.0 . . . . . . . . . . . . A . 21 C C1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7397 . 1 1 21 C C2   C -24.142  11.439 37.198 . . . 1.0 . . . . . . . . . . . . A . 21 C C2   . . . . . . . . . rr_2l5z 1 
       .  9 .  7398 . 1 1 21 C C2'  C -24.388  14.390 38.153 . . . 1.0 . . . . . . . . . . . . A . 21 C C2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7399 . 1 1 21 C C3'  C -25.365  15.561 38.066 . . . 1.0 . . . . . . . . . . . . A . 21 C C3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7400 . 1 1 21 C C4   C -25.132  10.459 35.309 . . . 1.0 . . . . . . . . . . . . A . 21 C C4   . . . . . . . . . rr_2l5z 1 
       .  9 .  7401 . 1 1 21 C C4'  C -26.518  15.105 38.943 . . . 1.0 . . . . . . . . . . . . A . 21 C C4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7402 . 1 1 21 C C5   C -26.309  11.255 35.475 . . . 1.0 . . . . . . . . . . . . A . 21 C C5   . . . . . . . . . rr_2l5z 1 
       .  9 .  7403 . 1 1 21 C C5'  C -27.824  15.823 38.597 . . . 1.0 . . . . . . . . . . . . A . 21 C C5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7404 . 1 1 21 C C6   C -26.342  12.117 36.510 . . . 1.0 . . . . . . . . . . . . A . 21 C C6   . . . . . . . . . rr_2l5z 1 
       .  9 .  7405 . 1 1 21 C H1'  H -24.934  12.705 39.388 . . . 1.0 . . . . . . . . . . . . A . 21 C H1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7406 . 1 1 21 C H2'  H -23.898  14.238 37.187 . . . 1.0 . . . . . . . . . . . . A . 21 C H2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7407 . 1 1 21 C H3'  H -25.681  15.755 37.037 . . . 1.0 . . . . . . . . . . . . A . 21 C H3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7408 . 1 1 21 C H4'  H -26.271  15.277 39.990 . . . 1.0 . . . . . . . . . . . . A . 21 C H4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7409 . 1 1 21 C H41  H -24.225   9.035 34.172 . . . 1.0 . . . . . . . . . . . . A . 21 C H41  . . . . . . . . . rr_2l5z 1 
       .  9 .  7410 . 1 1 21 C H42  H -25.823   9.512 33.645 . . . 1.0 . . . . . . . . . . . . A . 21 C H42  . . . . . . . . . rr_2l5z 1 
       .  9 .  7411 . 1 1 21 C H5   H -27.143  11.168 34.794 . . . 1.0 . . . . . . . . . . . . A . 21 C H5   . . . . . . . . . rr_2l5z 1 
       .  9 .  7412 . 1 1 21 C H5'  H -27.626  16.888 38.465 . . . 1.0 . . . . . . . . . . . . A . 21 C H5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7413 . 1 1 21 C H5'' H -28.219  15.416 37.667 . . . 1.0 . . . . . . . . . . . . A . 21 C H5'' . . . . . . . . . rr_2l5z 1 
       .  9 .  7414 . 1 1 21 C H6   H -27.214  12.732 36.667 . . . 1.0 . . . . . . . . . . . . A . 21 C H6   . . . . . . . . . rr_2l5z 1 
       .  9 .  7415 . 1 1 21 C HO2' H -23.619  13.990 39.896 . . . 1.0 . . . . . . . . . . . . A . 21 C HO2' . . . . . . . . . rr_2l5z 1 
       .  9 .  7416 . 1 1 21 C N1   N -25.281  12.217 37.362 . . . 1.0 . . . . . . . . . . . . A . 21 C N1   . . . . . . . . . rr_2l5z 1 
       .  9 .  7417 . 1 1 21 C N3   N -24.100  10.566 36.156 . . . 1.0 . . . . . . . . . . . . A . 21 C N3   . . . . . . . . . rr_2l5z 1 
       .  9 .  7418 . 1 1 21 C N4   N -25.054   9.599 34.294 . . . 1.0 . . . . . . . . . . . . A . 21 C N4   . . . . . . . . . rr_2l5z 1 
       .  9 .  7419 . 1 1 21 C O2   O -23.201  11.546 37.983 . . . 1.0 . . . . . . . . . . . . A . 21 C O2   . . . . . . . . . rr_2l5z 1 
       .  9 .  7420 . 1 1 21 C O2'  O -23.417  14.602 39.185 . . . 1.0 . . . . . . . . . . . . A . 21 C O2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7421 . 1 1 21 C O3'  O -24.753  16.704 38.669 . . . 1.0 . . . . . . . . . . . . A . 21 C O3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7422 . 1 1 21 C O4'  O -26.610  13.706 38.708 . . . 1.0 . . . . . . . . . . . . A . 21 C O4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7423 . 1 1 21 C O5'  O -28.797  15.658 39.632 . . . 1.0 . . . . . . . . . . . . A . 21 C O5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7424 . 1 1 21 C OP1  O -30.595  17.070 40.655 . . . 1.0 . . . . . . . . . . . . A . 21 C OP1  . . . . . . . . . rr_2l5z 1 
       .  9 .  7425 . 1 1 21 C OP2  O -30.391  16.849 38.111 . . . 1.0 . . . . . . . . . . . . A . 21 C OP2  . . . . . . . . . rr_2l5z 1 
       .  9 .  7426 . 1 1 21 C P    P -30.283  16.254 39.461 . . . 1.0 . . . . . . . . . . . . A . 21 C P    . . . . . . . . . rr_2l5z 1 
       .  9 .  7427 . 1 1 22 G C1'  C -19.847  14.358 39.908 . . . 1.0 . . . . . . . . . . . . A . 22 G C1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7428 . 1 1 22 G C2   C -17.638  11.199 37.728 . . . 1.0 . . . . . . . . . . . . A . 22 G C2   . . . . . . . . . rr_2l5z 1 
       .  9 .  7429 . 1 1 22 G C2'  C -18.705  15.369 39.852 . . . 1.0 . . . . . . . . . . . . A . 22 G C2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7430 . 1 1 22 G C3'  C -19.445  16.655 39.544 . . . 1.0 . . . . . . . . . . . . A . 22 G C3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7431 . 1 1 22 G C4   C -19.251  12.712 38.018 . . . 1.0 . . . . . . . . . . . . A . 22 G C4   . . . . . . . . . rr_2l5z 1 
       .  9 .  7432 . 1 1 22 G C4'  C -20.717  16.488 40.360 . . . 1.0 . . . . . . . . . . . . A . 22 G C4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7433 . 1 1 22 G C5   C -19.835  12.479 36.781 . . . 1.0 . . . . . . . . . . . . A . 22 G C5   . . . . . . . . . rr_2l5z 1 
       .  9 .  7434 . 1 1 22 G C5'  C -21.852  17.361 39.828 . . . 1.0 . . . . . . . . . . . . A . 22 G C5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7435 . 1 1 22 G C6   C -19.273  11.505 35.914 . . . 1.0 . . . . . . . . . . . . A . 22 G C6   . . . . . . . . . rr_2l5z 1 
       .  9 .  7436 . 1 1 22 G C8   C -20.971  13.973 37.710 . . . 1.0 . . . . . . . . . . . . A . 22 G C8   . . . . . . . . . rr_2l5z 1 
       .  9 .  7437 . 1 1 22 G H1   H -17.668  10.210 35.884 . . . 1.0 . . . . . . . . . . . . A . 22 G H1   . . . . . . . . . rr_2l5z 1 
       .  9 .  7438 . 1 1 22 G H1'  H -19.641  13.612 40.672 . . . 1.0 . . . . . . . . . . . . A . 22 G H1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7439 . 1 1 22 G H2'  H -18.022  15.122 39.035 . . . 1.0 . . . . . . . . . . . . A . 22 G H2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7440 . 1 1 22 G H21  H -16.162   9.820 37.471 . . . 1.0 . . . . . . . . . . . . A . 22 G H21  . . . . . . . . . rr_2l5z 1 
       .  9 .  7441 . 1 1 22 G H22  H -16.134  10.678 38.996 . . . 1.0 . . . . . . . . . . . . A . 22 G H22  . . . . . . . . . rr_2l5z 1 
       .  9 .  7442 . 1 1 22 G H3'  H -19.649  16.762 38.477 . . . 1.0 . . . . . . . . . . . . A . 22 G H3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7443 . 1 1 22 G H4'  H -20.519  16.741 41.400 . . . 1.0 . . . . . . . . . . . . A . 22 G H4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7444 . 1 1 22 G H5'  H -22.706  17.282 40.501 . . . 1.0 . . . . . . . . . . . . A . 22 G H5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7445 . 1 1 22 G H5'' H -21.518  18.398 39.797 . . . 1.0 . . . . . . . . . . . . A . 22 G H5'' . . . . . . . . . rr_2l5z 1 
       .  9 .  7446 . 1 1 22 G H8   H -21.720  14.722 37.907 . . . 1.0 . . . . . . . . . . . . A . 22 G H8   . . . . . . . . . rr_2l5z 1 
       .  9 .  7447 . 1 1 22 G HO2' H -18.661  15.348 41.798 . . . 1.0 . . . . . . . . . . . . A . 22 G HO2' . . . . . . . . . rr_2l5z 1 
       .  9 .  7448 . 1 1 22 G N1   N -18.154  10.907 36.480 . . . 1.0 . . . . . . . . . . . . A . 22 G N1   . . . . . . . . . rr_2l5z 1 
       .  9 .  7449 . 1 1 22 G N2   N -16.557  10.510 38.094 . . . 1.0 . . . . . . . . . . . . A . 22 G N2   . . . . . . . . . rr_2l5z 1 
       .  9 .  7450 . 1 1 22 G N3   N -18.162  12.113 38.551 . . . 1.0 . . . . . . . . . . . . A . 22 G N3   . . . . . . . . . rr_2l5z 1 
       .  9 .  7451 . 1 1 22 G N7   N -20.954  13.309 36.600 . . . 1.0 . . . . . . . . . . . . A . 22 G N7   . . . . . . . . . rr_2l5z 1 
       .  9 .  7452 . 1 1 22 G N9   N -20.010  13.691 38.603 . . . 1.0 . . . . . . . . . . . . A . 22 G N9   . . . . . . . . . rr_2l5z 1 
       .  9 .  7453 . 1 1 22 G O2'  O -18.009  15.447 41.101 . . . 1.0 . . . . . . . . . . . . A . 22 G O2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7454 . 1 1 22 G O3'  O -18.697  17.755 40.069 . . . 1.0 . . . . . . . . . . . . A . 22 G O3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7455 . 1 1 22 G O4'  O -21.032  15.096 40.266 . . . 1.0 . . . . . . . . . . . . A . 22 G O4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7456 . 1 1 22 G O5'  O -22.257  16.964 38.516 . . . 1.0 . . . . . . . . . . . . A . 22 G O5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7457 . 1 1 22 G O6   O -19.656  11.165 34.797 . . . 1.0 . . . . . . . . . . . . A . 22 G O6   . . . . . . . . . rr_2l5z 1 
       .  9 .  7458 . 1 1 22 G OP1  O -23.747  18.960 38.254 . . . 1.0 . . . . . . . . . . . . A . 22 G OP1  . . . . . . . . . rr_2l5z 1 
       .  9 .  7459 . 1 1 22 G OP2  O -23.669  17.139 36.453 . . . 1.0 . . . . . . . . . . . . A . 22 G OP2  . . . . . . . . . rr_2l5z 1 
       .  9 .  7460 . 1 1 22 G P    P -23.622  17.534 37.879 . . . 1.0 . . . . . . . . . . . . A . 22 G P    . . . . . . . . . rr_2l5z 1 
       .  9 .  7461 . 1 1 23 G C1'  C -15.311  14.572 36.984 . . . 1.0 . . . . . . . . . . . . A . 23 G C1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7462 . 1 1 23 G C2   C -15.628  12.212 33.269 . . . 1.0 . . . . . . . . . . . . A . 23 G C2   . . . . . . . . . rr_2l5z 1 
       .  9 .  7463 . 1 1 23 G C2'  C -14.119  15.344 36.410 . . . 1.0 . . . . . . . . . . . . A . 23 G C2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7464 . 1 1 23 G C3'  C -14.273  16.717 37.041 . . . 1.0 . . . . . . . . . . . . A . 23 G C3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7465 . 1 1 23 G C4   C -16.352  13.626 34.831 . . . 1.0 . . . . . . . . . . . . A . 23 G C4   . . . . . . . . . rr_2l5z 1 
       .  9 .  7466 . 1 1 23 G C4'  C -14.891  16.389 38.386 . . . 1.0 . . . . . . . . . . . . A . 23 G C4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7467 . 1 1 23 G C5   C -17.592  13.816 34.239 . . . 1.0 . . . . . . . . . . . . A . 23 G C5   . . . . . . . . . rr_2l5z 1 
       .  9 .  7468 . 1 1 23 G C5'  C -15.606  17.595 38.997 . . . 1.0 . . . . . . . . . . . . A . 23 G C5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7469 . 1 1 23 G C6   C -17.897  13.134 33.028 . . . 1.0 . . . . . . . . . . . . A . 23 G C6   . . . . . . . . . rr_2l5z 1 
       .  9 .  7470 . 1 1 23 G C8   C -17.570  14.993 35.973 . . . 1.0 . . . . . . . . . . . . A . 23 G C8   . . . . . . . . . rr_2l5z 1 
       .  9 .  7471 . 1 1 23 G H1   H -16.983  11.809 31.729 . . . 1.0 . . . . . . . . . . . . A . 23 G H1   . . . . . . . . . rr_2l5z 1 
       .  9 .  7472 . 1 1 23 G H1'  H -14.986  13.587 37.321 . . . 1.0 . . . . . . . . . . . . A . 23 G H1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7473 . 1 1 23 G H2'  H -14.211  15.419 35.323 . . . 1.0 . . . . . . . . . . . . A . 23 G H2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7474 . 1 1 23 G H21  H -14.952  10.922 31.846 . . . 1.0 . . . . . . . . . . . . A . 23 G H21  . . . . . . . . . rr_2l5z 1 
       .  9 .  7475 . 1 1 23 G H22  H -13.827  11.271 33.140 . . . 1.0 . . . . . . . . . . . . A . 23 G H22  . . . . . . . . . rr_2l5z 1 
       .  9 .  7476 . 1 1 23 G H3'  H -14.912  17.371 36.445 . . . 1.0 . . . . . . . . . . . . A . 23 G H3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7477 . 1 1 23 G H4'  H -14.119  16.037 39.068 . . . 1.0 . . . . . . . . . . . . A . 23 G H4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7478 . 1 1 23 G H5'  H -15.784  17.401 40.056 . . . 1.0 . . . . . . . . . . . . A . 23 G H5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7479 . 1 1 23 G H5'' H -14.971  18.476 38.901 . . . 1.0 . . . . . . . . . . . . A . 23 G H5'' . . . . . . . . . rr_2l5z 1 
       .  9 .  7480 . 1 1 23 G H8   H -17.857  15.675 36.759 . . . 1.0 . . . . . . . . . . . . A . 23 G H8   . . . . . . . . . rr_2l5z 1 
       .  9 .  7481 . 1 1 23 G HO2' H -13.054  14.139 37.508 . . . 1.0 . . . . . . . . . . . . A . 23 G HO2' . . . . . . . . . rr_2l5z 1 
       .  9 .  7482 . 1 1 23 G N1   N -16.834  12.340 32.610 . . . 1.0 . . . . . . . . . . . . A . 23 G N1   . . . . . . . . . rr_2l5z 1 
       .  9 .  7483 . 1 1 23 G N2   N -14.730  11.403 32.707 . . . 1.0 . . . . . . . . . . . . A . 23 G N2   . . . . . . . . . rr_2l5z 1 
       .  9 .  7484 . 1 1 23 G N3   N -15.333  12.848 34.406 . . . 1.0 . . . . . . . . . . . . A . 23 G N3   . . . . . . . . . rr_2l5z 1 
       .  9 .  7485 . 1 1 23 G N7   N -18.370  14.708 34.996 . . . 1.0 . . . . . . . . . . . . A . 23 G N7   . . . . . . . . . rr_2l5z 1 
       .  9 .  7486 . 1 1 23 G N9   N -16.361  14.402 35.961 . . . 1.0 . . . . . . . . . . . . A . 23 G N9   . . . . . . . . . rr_2l5z 1 
       .  9 .  7487 . 1 1 23 G O2'  O -12.875  14.734 36.776 . . . 1.0 . . . . . . . . . . . . A . 23 G O2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7488 . 1 1 23 G O3'  O -12.971  17.273 37.251 . . . 1.0 . . . . . . . . . . . . A . 23 G O3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7489 . 1 1 23 G O4'  O -15.796  15.322 38.112 . . . 1.0 . . . . . . . . . . . . A . 23 G O4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7490 . 1 1 23 G O5'  O -16.858  17.851 38.358 . . . 1.0 . . . . . . . . . . . . A . 23 G O5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7491 . 1 1 23 G O6   O -18.935  13.174 32.369 . . . 1.0 . . . . . . . . . . . . A . 23 G O6   . . . . . . . . . rr_2l5z 1 
       .  9 .  7492 . 1 1 23 G OP1  O -17.253  19.795 39.888 . . . 1.0 . . . . . . . . . . . . A . 23 G OP1  . . . . . . . . . rr_2l5z 1 
       .  9 .  7493 . 1 1 23 G OP2  O -18.938  19.214 38.047 . . . 1.0 . . . . . . . . . . . . A . 23 G OP2  . . . . . . . . . rr_2l5z 1 
       .  9 .  7494 . 1 1 23 G P    P -17.961  18.783 39.072 . . . 1.0 . . . . . . . . . . . . A . 23 G P    . . . . . . . . . rr_2l5z 1 
       .  9 .  7495 . 1 1 24 C C1'  C -12.775  15.570 31.670 . . . 1.0 . . . . . . . . . . . . A . 24 C C1'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7496 . 1 1 24 C C2   C -14.792  14.797 30.432 . . . 1.0 . . . . . . . . . . . . A . 24 C C2   . . . . . . . . . rr_2l5z 1 
       .  9 .  7497 . 1 1 24 C C2'  C -12.262  16.826 30.947 . . . 1.0 . . . . . . . . . . . . A . 24 C C2'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7498 . 1 1 24 C C3'  C -11.603  17.649 32.058 . . . 1.0 . . . . . . . . . . . . A . 24 C C3'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7499 . 1 1 24 C C4   C -16.948  15.289 31.220 . . . 1.0 . . . . . . . . . . . . A . 24 C C4   . . . . . . . . . rr_2l5z 1 
       .  9 .  7500 . 1 1 24 C C4'  C -11.299  16.609 33.123 . . . 1.0 . . . . . . . . . . . . A . 24 C C4'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7501 . 1 1 24 C C5   C -16.410  15.970 32.357 . . . 1.0 . . . . . . . . . . . . A . 24 C C5   . . . . . . . . . rr_2l5z 1 
       .  9 .  7502 . 1 1 24 C C5'  C -11.165  17.226 34.516 . . . 1.0 . . . . . . . . . . . . A . 24 C C5'  . . . . . . . . . rr_2l5z 1 
       .  9 .  7503 . 1 1 24 C C6   C -15.068  16.034 32.475 . . . 1.0 . . . . . . . . . . . . A . 24 C C6   . . . . . . . . . rr_2l5z 1 
       .  9 .  7504 . 1 1 24 C H1'  H -12.285  14.686 31.253 . . . 1.0 . . . . . . . . . . . . A . 24 C H1'  . . . . .